WO2022023564A1 - Whole nucleic acids rt-qpcr method for detecting histoplasma capsulatum fungus pathogen(s), histoplasmosis diagnosis and treatment methods, means thereof - Google Patents

Abstract

The invention relates to an in vitro method of detecting by RT-qPCR on a sample, presence of a nucleic acid molecule contained in the mitochondrial Small Sub-Unit (mtSSU) gene of Histoplasma capsulatum, or a variant thereof, by Whole Nucleic Acid (WNA) reverse transcriptase qPCR (RT-qPCR). The method can be coupled to an in vitro method of detecting nucleic acid content of Mycobacterium tuberculosis in particular by RT-PCR. The invention also relates to an in vitro method of diagnosing whether an animal or human subject is infected with Histoplasma capsulatum, or has histoplasmosis, optionally whether the animal or human subject has or has a risk to develop tuberculosis, based on the detection method of the invention. The invention can be applied to determining the efficacy of a therapeutic active ingredient. Are also encompassed therapeutic applications for patients diagnosed as having histoplasmosis with the method of the invention, kits and their uses for carrying out a method of the invention, primer nucleic acid molecules.

Description

WHOLE NUCLEIC ACIDS RT-qPCR METHOD FOR DETECTING HISTOPLASMA CAPSULATUM FUNGUS PATHOGEN(S), HISTOPLASMOSIS DIAGNOSIS AND TREATMENT METHODS, MEANS THEREOF

FIELD OF THE INVENTION

The invention relates to the field of whole nucleic acids amplification, especially for pathogens detection, more particularly for detection of Histoplasma capsulatum fungus pathogen(s) in a sample retrieved from the environment, a biological sample retrieved from an animal, including a biological sample from a human patient suspected of carrying the same. The invention is based on the determination of a novel target for a Whole Nucleic Acids RT-qPCR method. The invention also relates to diagnosis methods based on the disclosed detection method, histoplasmosis treatment methods, and means to theses ends.

BACKGROUND OF THE INVENTION

The fungus Histoplasma was first described in Panama by T. Darling in a lung sample from a patient from Martinique (French Caribbean islands) [1] by observation of free or intracellular small yeasts in a smear. Since then, three distinct varieties are described including initially identified by morphological aspects in tissues and epidemiological criteria (i) Histoplasma capsulatum var. capsulatum (Hoc, New World human pathogen) associated with small ovoid (3-5 pm) yeasts, (ii) Histoplasma capsulatum var. duboisii (Hod, Old World human pathogen) associated with large citrus shaped yeasts and Africa (iii) Histoplasma capsulatum var. farciminosum (Old World animal pathogen) associated with infections in horses. However, this classification has been revisited based on recent multilocus sequencing. Histoplasma capsulatum is now composed of at least 4 phylogenetically different groups [2], including a specific group for var. duboisii. Histoplasma capsulatum var. farciminosum appeared to be polyphyletic suggesting this variety does not correspond to a specific phylogenetic group [2] Recent analyses of multiple isolates by whole genome sequencing revealed the presence of 5 clades, 2 in North America 1 in Latin America, 1 in Panama, and 1 in Africa (var. duboisii ) [3]

Therefore, it can be considered that the genus Histoplasma contains one species, which is Histoplasma capsulatum. The Histoplasma capsulatum species has two varieties: Histoplasma capsulatum var. capsulatum (Hoc) and Histoplasma capsulatum var. duboisii (Hcd). Histoplasma capsulatum var. farciminosum is a pathogen in horses, but still pertains to the Histoplasma capsulatum species.

The Histoplasma capsulatum species may be referred to by the wording “Histoplasma” herein, unless the context dictates otherwise.

Nowadays, diagnosis of histoplasmosis still relies on microscopic direct examination and culture, together with antibody or antigen detection [4] In addition, PCR methods have been developed based on the amplification of various DNA targets, especially from Histoplasma capsulatum var. capsulatum ( Hcc ) or H. capsulatum var. duboisii ( Hcd ), and using different methodologies [5- 11 ,15,16] with a sensitivity ranging from 67 to 100% depending on the studies [14] More recently, real-time quantitative PCR (RT-qPCR) methods based on DNA detection [6,10,15,17] have been developed and seem suitable for human diagnosis. Indeed, a specific quantitative PCR (qPCR) assay was shown to be more sensitive than culture [13] The different qPCR methods are interesting to rapidly detect Histoplasma from tissue or fluid.

Of note, infection of an animal, especially a human, with an Histoplasma species, causes “histoplasmosis infection” as termed herein, which in turn means that the infected animal, especially human, has at least contracted “histoplasmosis disease” possibly in an asymptomatic form. If histoplasmosis infection and presence of histoplasmosis disease may remain asymptomatic, tissue lesions necessarily arise when a subject has contracted histoplasmosis disease necessarily caused by an histoplasmosis infection. Histoplasmosis infection and thus histoplasmosis disease even in an asymptomatic form can be detected by the presence of an Histoplasma species in a biological sample drawn from the said subject. For example, localized histoplasmosis disease may be asymptomatic, i.e., no visible symptoms can be seen, although tissue lesions are present in the subject.

To enable diagnosis in non-invasive diagnosis in blood specimens as described before [10,11], the inventors developed and validated, as described herein, a Histoplasma reverse transcriptase (in vitro) qPCR (RT-qPCR) assay based on a new repeated target gene and the detection of whole nucleic acids (RNA plus DNA) to improve the specificity and the sensitivity of existing qPCR assays.

The assay described herein allows amplification of both RNA and DNA of the mitochondrial small subunit gene (mtSSU) of Histoplasma capsulatum by RT-qPCR.

It is discussed in Alanio, A. et al., 2017 ( Diagnosis of histoplasmosis: switching from microscopy/culture to RNA/DNA detection. Mycoses, 60, pp.28-29), an attempt to improve sensitivity of PCR testing by including RNA detection along with DNA detection. However, this attempt focused on a qPCR assay allowing amplification of both RNA and DNA of the mitochondrial large sub unit gene of Histoplasma capsulatum (mtLSU gene).

It is also known from [10] and [13] discussed herein qPCR assays to which instant invention was compared. These prior art assays target the ITS1 regions of H. capsulatum [10,13] following the published protocols [10,13] Of note, the ITS1 regions correspond to nuclear ribosomal RNA, and not mitochondrial ribosomal RNA so that the methods described in these documents and the method of instant invention cannot compare.

In contrast to the prior art, there is still a need to improve prior art Histoplasma detection methods to achieve better sensitivity when pathogen loads are low in a sample/subject.

In instant invention, the inventors first determined the limit of detection and specificity of the developed RT-qPCR assay against 95 fungal species (99 clinical isolates) as initial validation. They then performed routinely and prospectively for clinical evaluation, this RT-qPCR for all French patients suspected of histoplasmosis tested in their center. They evaluate here the diagnostic value of their RT-qPCR assay over 5 years of testing on whole nucleic acids of 1 ,319 prospectively collected consecutive samples from 907 patients suspected of histoplasmosis, tested routinely between May 2015 and May 2019 in parallel with standard diagnostic procedures. As reported herein, from the 907 patients suspected of/at risk for histoplasmosis tested, 44 had proven histoplasmosis due to Hcc (n=40) and Hcd (n=4) infections according to the European Organization for Research and Treatment of Cancer/Invasive Fungal Infections Cooperative Group and the National Institute of Allergy and Infectious Diseases Mycoses Study Group (EORTC/MSG) criteria (Pauw, B., et al. (2008). Revised Definitions of Invasive Fungal Disease from the EORTC/MSG, Consensus Group Clinical Infectious Diseases 46(12), 1813-1821. https ://dx.doi.org/10.1086/588660). The sensitivity of the PCR was 100% in those 44 patients with at least one positive-RT-qPCR result/case (97 RT-qPCR positive/169 samples). An additional 9 cases classified as possible cases had a positive RT-qPCR as the only positive mycological evidence but no other reliable/putative/compatible diagnosis. RT-qPCR was tested on whole blood in 30/44 proven cases (68.2%) and was positive in 13/30 (43.3%), but none involved Hcd infections. Follow up using blood samples of 9 patients showed a decreased fungal load with approximately a two-fold decrease per day upon treatment.

Actually, the new RT-qPCR assay described herein, which is based on the detection a particular target in whole nucleic acid of Histoplasma, is highly sensitive and allows the diagnosis of histoplasmosis from various specimens. More importantly, a qPCR positive result can be the only clue for the diagnosis. In present case, inventors could report a low Limit Of Detection (LOD) for their assay, which was able to detect as little as 10 copies of DNA/well. Therefore, inventors have designed and set the principle for an assay, which should become a helpful tool for the diagnosis, and should be tested prospectively to investigate if RT-qPCR results can improve the management of histoplasmosis cases.

The invention therefore relies on the experiments described herein, and proposes new means and tools for addressing the above-mentioned problems.

DETAILED DESCRIPTION OF THE INVENTION

The invention therefore relates to an in vitro method of detecting by reverse transcriptase quantitative PCR (RT-qPCR) on a sample, presence of a nucleic acid molecule contained in the mitochondrial Small Sub-Unit ( mtSSU) gene of Histoplasma capsulatum, ora variant thereof, said method comprising the steps of: a. Providing a sample, in particular a sample suspected of being infected by H. capsulatum, in particular a biological sample suspected of being infected by H. capsulatum, said sample having been previously retrieved from the environment, or obtained from an animal or a human patient, in conditions enabling targeted detection of the whole nucleic acid content of the sample, and b. Carrying a Whole Nucleic Acid (WNA) reverse transcriptase qPCR (RT-qPCR) assay on the sample of a., wherein the target nucleic acid molecule for amplification by the RT-qPCR assay of b. is contained in the mitochondrial Small Sub-Unit ( mtSSU) gene of Histoplasma capsulatum or a variant thereof, and c. detecting whether amplicons of said target nucleic acid molecule sequence are obtained.

By “detecting whole nucleic acids content of the mitochondrial Small Sub-Unit (mtSSU) gene of Histoplasma capsulatum” it is meant that DNA corresponding to that specific mitochondrial gene or fragments thereof, and the RNA transcripts of the same are both targeted and whenever present are detected, and, actually, amplified using the assay at the basis of instant invention. Throughout present description “whole nucleic acids” (such as in Whole Nucleic Acid (WNA)) or “whole nucleic acid content”, or “total nucleic acid(s)” refer to both RNA and DNA nucleic acid molecules.

By “variant thereof in the above paragraph, it is meant a variant of the mtSSU gene of Histoplasma capsulatum whose sequence has at least 80% identity with SEQ ID NO: 6, or SEQ ID NO: 17 or SEQ ID NO: 18.

The inventors could in particular determine that the mitochondrial Small Sub-Unit (mtSSU) gene of Histoplasma capsulatum represents a unique target of interest for use in a Whole Nucleic Acid (WNA) reverse transcriptase qPCR (RT-qPCR) assay aimed at detecting presence of Histoplasma in a sample, histoplasma infection or disease. Other mtSSU gene sequences in other organisms are systematically different.

According to a particular embodiment the so-called mtSSU gene of Histoplasma capsulatum is described by reference to the Ajellomyces capsulatus G186AR mitochondrial small subunit rRNA (mtSSU) gene disclosed herein as SEQ ID NO: 6 or by reference to SEQ ID NO: 17 or SEQ ID NO: 18. SEQ ID NO: 6 is 1503 bases long. SEQ ID NO: 6 can be found in the whole concatenated sequence available under GenBank accession number GG663449.1 (https://www.ncbi.nlm.nih.gOv/nuccore/GG663449.1) (whole sequence provided as SEQ ID NO: 9). The Ajellomyces capsulatus G186AR mitochondrial small subunit rRNA (mtSSU) gene having the sequence SEQ ID NO: 6 can be found between nucleic acid positions 4771 and 6273 of GenBank accession number GG663449.1 entry, being said that at present, there is no annotation for that gene available in public databases. Identification of the sequence of the mtSSU gene of use within the present invention, is therefore part of the conception of present invention. Concretely, from the whole genome sequence of Ajellomyces capsulatus G186AR mitochondrial scaffold supercont 1.87, whole genome shotgun sequence available under GenBank accession number GG663449.1 , the inventors identified the mtSSU gene based on similarity with otherfungi mtLSSU, because no annotation of the mtSSU gene was available on this sequence. The mtSSU sequence was, at the time of the invention, not delimited perse, and not identified as such, in its source NCBI Nucleotide database. It could only be determined proactively from a whole genome shotgun sequence database, where it was present without further identification. Only after identification of the mtSSU gene the inventors could design a PCR protocol using the mtSSU gene, ending up with a 77bp amplicon. SEQ ID NO: 17 and 18 are 1503 bases long. SEQ ID NO: 17 differs from SEQ ID NO: 6 by a single point mutation (A72T with respect to the 355 bp fragment illustrated in Figure 5) found in a mutant strain found in a patient with Histoplasmosis coming from Laos. SEQ ID NO: 18 is a consensus sequence for SEQ ID NO: 6 and SEQ ID NO: 17.

Of note, the mtSSU gene is found repeated in the genome of Histoplasma capsulatum because mitochondria is repeated in a fungal cell and because mitochondrial DNA is repeated in fungal mitochondria.

By a “variant of mitochondrial Small Sub-Unit ( mtSSU) gene” of Histoplasma capsulatum, it is meant a sequence having at least 80% identity with the Ajellomyces capsulatus G186AR mitochondrial small subunit rRNA (mtSSU) gene having the sequence SEQ ID NO: 6, which can be found between nucleic acid positions 4771 and 6273 of the GenBank accession number GG663449.1 entry, or SEQ ID NO: 17 or SEQ ID NO: 18. Identity percentage can reach 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. The length of the variant can be the same as the length of the considered reference sequence, or is a length in accordance with the identity percentage of the said variant with respect to the considered reference sequence, i.e., a length as authorized by at least 80% identity with the Ajellomyces capsulatus G186AR mitochondrial small subunit rRNA (mtSSU) gene having the sequence SEQ ID NO: 6, or SEQ ID NO: 17 or SEQ ID NO: 18, or identity percentages indicated above, The length can be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119% or 120% of the considered reference sequence.

Software tools for carrying out identity percentage calculation are commonly known and readily accessible to the skilled person: they can in particular be freely accessible over the internet. The literature provides details regarding available tools. In particular, identity percentages can conventionally be calculated through local, preferably global, sequence alignment algorithms and their available computerized implementations. In a most preferred embodiment, identity percentages are calculated over the entire length of the compared sequences. Global alignments, which attempt to align every residue in every sequence, are most useful when the sequences in the query set are similar and of roughly equal size. Computerized implementations of the algorithms used are generally associated with default parameters in the literature, which can be used for running said algorithm. The skilled person can readily adapt the same taking into account its objective or the sequences comparison made. Global alignments are preferably used when identity percentage calculation is done with regards to primers or probes.

By “nucleic acid molecule contained in the mtSSU gene of Histoplasma capsulatum” , it is meant, given that the considered mtSSU gene is 1503 bases long, a fragment of the same or a fragment of a variant thereof. Accordingly, with respect to a fragment of the same, the target sequence may be a nucleic acid molecule sequence that is 1503 bp long or less, including but not limited to a nucleic acid molecule sequence that is, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500 bp long, or any value in between, and according to any range between the mentioned values, having contiguous bases as contained in SEQ ID NO: 6 or SEQ ID NO: 17 or SEQ ID NO: 18 or a variant thereof, as defined herein, where SEQ ID NO: 6 or SEQ ID NO: 17 or SEQ ID NO: 18 are taken as a reference sequence.

With respect to a fragment of a variant thereof, and according to a particular embodiment, it is meant the target sequence may be a nucleic acid molecule sequence that is 1503 bp long or less, including but not limited to a nucleic acid molecule sequence that is, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500 bp long, or any value in between, and according to any range between the mentioned values, having contiguous bases as contained in a variant of SEQ ID NO: 6 or SEQ ID NO: 17 or SEQ ID NO: 18, said variant of SEQ ID NO: 6 or SEQ ID NO: 17 or SEQ ID NO: 18 being as defined in the preceding paragraphs.

Since the invention is associated with an outstanding sensibility, as demonstrated herein, and/or a low Limit Of Detection (LOD), as demonstrated herein, and the target gene sequence used is unique, as discussed herein, it will be understood that the method of detection of the invention is appropriate for being implemented with any sample which may be infected with Histoplasma, in particular a sample previously retrieved from the environment, e.g., as a non limitative list a water sample , an air sample, a sample whatever its form or nature embedding plant residues, a sample whatever its form or nature embedding feces of animals or putatively embedding the same, or the like.

According to another embodiment, the assayed sample is a biological sample previously retrieved from an animal subject. The animal can be an insect, a fish, a bird, a mammal, including a mammal selected amongst Carnivores (such as lion, fox, bear, dog, cat...), Chiroptera (bats), Cetaceans (whales, dolphins...), Marsupials (koala, kangaroo...), Rodents (rat, mouse...), Ungulates (elephant, horse...), Primates (monkeys, apes including gorillas and humans...).

According to a particular embodiment, the assayed sample is a biological sample previously retrieved from an animal or human subject.

According to another embodiment, taken in combination with any source for the considered biological sample, the assayed biological sample is obtained from: serum, plasma, whole blood, urine, bone marrow aspirate, lymph node aspirate, Broncho-Alveolar Lavage (BAL), liquids (cerebrospinal fluid, synovial liquid, ...) or tissue biopsie(s).

According to a particular embodiment, the target nucleic acid molecule contained in the mitochondrial Small Sub-Unit ( mtSSU) gene of Histoplasma capsulatum is represented by SEQ ID NO: 7 or SEQ ID NO: 12 or SEQ ID NO :16 or a sequence differing therefrom by up to 3 nucleic acid substitution^) and/or addition(s) and/or deletion(s), or a fragment thereof. SEQ ID NO: 7 or SEQ ID NO: 12 are 355 bp long. According to these embodiments, the target sequence may be a nucleic acid molecule sequence that is 355 bp long or less, including a nucleic acid molecule sequence that is, 50, 100, 150, 200, 250, 300, 350 bp long, or any value in between, and according to any range between the mentioned values, having contiguous bases as contained in SEQ ID NO: 7 or SEQ ID NO 12 or SEQ ID NO: 16 or a variant thereof where SEQ ID NO: 7 or SEQ ID NO 12 or SEQ ID NO: 16 are taken as a reference sequence. Target nucleic acid molecules SEQ ID NO: 7 or SEQ ID NO 12 or SEQ ID NO: 16 can be targeted by primers SEQ ID NO: 4 GATGATGGCTCTGATTGAACG (7F) and SEQ ID NO: 5 AATGTGATCGATCGACCTCT (361 R) as exemplified in the experimental section. These primers SEQ ID NO: 4 and 5 allow, together, for amplification of a 355 bp amplicon on the genome of the Ajellomyces capsulatus G186AR sequence in SEQ ID NO: 7 (SEQ ID NO: 7 :

SEQ ID NO 12 differs from SEQ ID NO: 7 by a single point mutation (A72T with respect to the 355 bp fragment illustrated in Figure 5) found in a mutant strain found in a patient with Histoplasmosis coming from Laos. SEQ ID NO: 16 is a consensus sequence for SEQ ID NO: 7 and SEQ ID NO: 12.

By a “variant of SEQ ID NO: 7 or SEQ ID NO 12 or SEQ ID NO: 16”, it is meant a sequence having at least 80% identity with SEQ ID NO: 7 or SEQ ID NO 12 or SEQ ID NO: 16. Identity percentage can reach 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. The length of the variant can be the same as the length of the considered reference sequence, or is a length in accordance with the identity percentage of the said variant with respect to the considered reference sequence, i.e., a length as authorized by at least 80% identity with SEQ ID NO: 7 or SEQ ID NO 12 or SEQ ID NO: 16, or identity percentages indicated above, The length can be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119% or 120% of the considered reference sequence.

When, throughout the present description, reference is made to a sequence differing from a reference sequence by up to 3 nucleic acid substitution(s) and/or addition(s) and/or deletion(s), it is to be understood that the same (i.e., nucleic acid substitution(s) and/or addition(s) and/or deletion(s)) can be envisioned cumulatively, and/or according to all combinations thereof, up to 1 , 2 or 3 occurrence^) each.

According to an aspect, the invention seeks to determine whether the assayed sample contains genetic material from at least one Histoplasma species, in particular one Histoplasma species selected amongst: Histoplasma capsulatum var. capsulatum (Hoc) and Histoplasma. capsulatum var. duboisii (Hod). These species are all phylogenetically close. In order to distinguish or discriminate between Histoplasma capsulatum var. capsulatum ( Hcc ), Histoplasma. capsulatum var. duboisii (, Hcd ), if needed, one must rely on polymorphisms in the sequences shown in Figure 5. Such polymorphisms can become apparent considering the knowledge of the skilled person in the art, by comparing available sequences of interest, for example sequences retrieved from publicly known databases.

Figure 5 shows a BLAST alignment between the sequences of these species and the one of Histoplasma capsulatum var. farciminosum, which infects horses, over the section of the mtSSU gene corresponding to the SEQ ID NO: 7 or SEQ ID NO 12 or SEQ ID NO: 16 sequences. Actually, as shown in Figure 5, one polymorphism is shown outside this target sequence, for a H. var. deboisii (A -> G) member. This polymorphism is embedded within the region of a 355 bp amplicon discussed herein.

It will be understood that sequencing of the amplified amplicon can, whatever the amplicon is, allow for both verification of the sequence of the obtained amplicon (e.g., as a quality check), and further characterization of the detected Histoplasma species, for example amongst Histoplasma capsulatum var. capsulatum (Hcc), Histoplasma. capsulatum var. duboisii (Hcd), if needed, by comparison with the sequences and portions of corresponding sequences readily available in the databases or described herein.

Therefore, using boundaries framing a possible polymorphic region between Histoplasma members, including as delimited by possible other primers than primers SEQ ID NO: 4 and 5 as shown herein (also termed “outer primers” herein), possible polymorphisms with respect to Histoplama members or other species can be used to assist a further discrimination between sequences, using routinely available sequencing techniques, if needed.

It will be understood that the skilled person can readily adapt to the polymorphisms known and reported in the art, for example within databases made for this purpose. According to a particular embodiment, the primers used have no mismatches at their 3’ terminal end, i.e., over the last 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotides of the primers used herein, especially in the experimental section, or disclosed throughout the present disclosure.

According to a particular embodiment, the target nucleic acid molecule contained in the mitochondrial Small Sub-Unit (mtSSU) gene of Histoplasma capsulatum is represented by SEQ ID NO: 1 or SEQ ID NO: 14 or SEQ ID NO: 15 or a sequence differing therefrom by up to 3 nucleic acid substitution(s) and/or addition(s) and/or deletion(s), or a fragment thereof. SEQ ID NO: 14 differs from SEQ ID NO: 1 by a single point mutation (A72T with respect to the 355 bp fragment illustrated in Figure 5) found in a mutant strain found in a patient with Histoplasmosis coming from Laos. SEQ ID NO: 15 is a consensus sequence for SEQ ID NO: 1 and SEQ ID NO: 14.

In a particular embodiment, the target nucleic acid molecule is contained in the mitochondrial Small Sub-Unit (mtSSU) gene of Histoplasma capsulatum having for consensus sequence SEQ ID NO: 15

or a sequence differing therefrom by up to 3 nucleic acid

substitution(s) and/or addition(s) and/or deletion(s), or a fragment thereof.

The consensus sequence SEQ ID NO: 15, SEQ ID NO: 1 and SEQ ID NO: 14 are 74 bp long. According to particular embodiments, the target sequence may be a nucleic acid molecule sequence that is 74 bp long or less, including a nucleic acid molecule sequence that is, 50, 55, 60, 65, 70 bp long, or any value in between, and according to any range between the mentioned values, having contiguous bases as contained in SEQ ID NO: 15, SEQ ID NO: 1 or SEQ ID NO: 14 or a variant thereof from SEQ ID NO: 15, 1 or 14 taken as a reference sequence. Target nucleic acid molecule SEQ ID NO: 1 can be targeted by primers SEQ ID NO: 2

(R128), as exemplified in the experimental section. SEQ ID NO: 15 or SEQ ID NO: 1 or SEQ ID NO: 14 can be targeted by primers SEQ ID NO: 13 CGTACGACAT CATATT AAAAAT G (F55 short) and SEQ ID NO: 3

SEQ ID NO: 1 is a 74 bp target sequence, as shown in particular in the Ajellomyces capsulatus G186AR sequence described above. (SEQ ID NO: 1 :

CCTTAAAGAAAG). This sequence (in its double-stranded version) has for boundaries two sequences matching particular primers used by the inventors herein, i.e., primers SEQ ID NO: 2 and 3

respectively).

SEQ ID NO: 14 is a 74 bp target sequence, as shown in particular in a mutant strain found in a patient with Histoplasmosis coming from Laos described above and shown in Figure 5. (SEQ ID NO: 14

CCTTAAAGAAAG). This sequence (in its double-stranded version) has for boundaries two sequences matching particular primers used by the inventors herein, i.e., primers SEQ ID NO: 13 and 3 (F55 short: and R128:

.

SEQ ID NO: 15 is a 74 bp consensus target sequence for SEQ ID NO: 1 and SEQ NO: 14. This sequence (in its double-stranded version) has for boundaries two sequences matching particular primers used by the inventors herein, i.e., primers SEQ ID NO: 13 and 3 (F55 short:

Interestingly, apart the mutation found in SEQ ID NO: 14 discussed above, no polymorphisms have been shown to exist in target sequence SEQ ID NO: 1 , between the several members of Histoplasma spp. described herein or in the literature, and known so far. Therefore, SEQ ID NO: 1 and SEQ ID NO: 14 are very specific of Histoplasma spp. in general, which comes as an advantage.

Whole Nucleic Acid (WNA) reverse transcriptase qPCR (RT-qPCR), as used herein, means a RT-qPCR as well detailed in that art to the attention to the skilled person, applied to WNA content. An example of protocol is provided in instant invention. It stands clear from the knowledge in the field of the invention that this protocol is by no means limitative. The skilled person can readily adapt and adjust the protocol according to his/her knowledge and guidance provided in the art.

According to a particular embodiment, carrying a Whole Nucleic Acid (WNA) reverse transcriptase qPCR (RT-qPCR) assay, wherein the target nucleic acid molecule for amplification by the RT-qPCR assay of b. is SEQ ID NO: 1 , 14 or 15 or a sequence differing therefrom by up to 3 nucleic acid substitution(s) and/or addition(s) and/or deletion(s) is carried using suited primers, which can be readily determined by the skilled person according to his/her common knowledge, or using any guidance as provided herein, in particular is carried out using any of the primers disclosed herein.

According to a particular embodiment, the invention relates to an in vitro method of detecting by reverse transcriptase quantitative PCR (RT-qPCR) on a sample, presence of SEQ ID NO: 1 , 14 or 15 of the mitochondrial Small Sub-Unit ( mtSSU ), ora sequence differing therefrom by up to 3 nucleic acid substitution^) and/or addition(s) and/or deletion(s) , said method comprising the steps of: a. Providing a biological sample, in particular a biological sample suspected for infection by H. capsulatum, previously obtained from an animal or a human patient, in conditions enabling targeted detection of whole nucleic acid of the biological sample, in particular nucleic acid from at least one H. capsulatum species selected amongst: Histoplasma capsulatum var. capsulatum ( Hcc ), Histoplasma. capsulatum var. duboisii ( Hcd ), and b. Carrying a Whole Nucleic Acid (WNA) reverse transcriptase qPCR (RT-qPCR) assay on the sample of a., wherein the target nucleic acid molecule for amplification by the RT-qPCR assay of b. is SEQ ID NO: 1 , 14 or 15 or a sequence differing therefrom by up to 3 nucleic acid substitution^) and/or addition(s) and/or deletion(s) and c. detecting whether amplicons of said target sequence are obtained.

According to a particular embodiment, a Whole Nucleic Acid (WNA) reverse transcriptase qPCR (RT-qPCR) assay as implemented in any embodiment described herein, has performance as for example illustrated by any one of the following parameters, or any combination thereof:

It has an ability to detect 1 ng of DNA of Histoplasma with a Cq of between 16 and 20, in particular 16, 17, 18, 19 or 20, or within any range defined by any one of these values, according to all combinations. It has been exemplified herein a detection of 1 ng of DNA of Hcd with a mean Cq of 17.2, and a detection of 1 ng of DNA of var. capsulatum with a mean Cq of 16.3. The skilled person can readily adjust dilution to optimize these values (see examples).

It has an ability to detect as little as 10 copies of DNA in a well of an assay plate, i.e., with a Cq value of less than 45. Exemplary experiment for calculation of such a parameter can be found in the experimental section. The efficiency of the RT-qPCR is at least 1.8, or at least 1.9 (95% efficiency), or is between 1.8 and 2.0 (2.0 indicates 100% efficiency), in particular is 1.9 (95% efficiency).

According to a particular embodiment, detecting whether amplicons of a target sequence are obtained, can be done by measuring the Cq value of the WNA RT-qPCR method carried out, in particular according to any embodiment as described herein. Considering Cq value obtained, alone or in combination with other parameters of the WNA RT-qPCR, the skilled person can conclude about presence of amplicons and target sequence the assayed sample. A threshold of 45 or more generally means that the amplification failed so that the target sequence is not present.

According to a particular embodiment, the assayed sample is a sample retrieved from the environment. It can be a liquid sample, for example water collected from a surface or collected at a place where infection by Histoplasma is suspected or a place where one seek to determine presence of Histoplasma. As indicated above, assayed sample can be or derive from a liquid, especially a water sample, an air sample, a sample whatever its form or nature embedding plant residues, a sample whatever its form or nature embedding feces of animals or putatively embedding the same, or the like.

According to a particular embodiment, the assayed sample is a biological sample, especially a liquid sample, obtained from: serum, plasma, whole blood, urine, bone marrow aspirate, lymph node aspirate, Broncho-Alveolar Lavage (BAL), liquids (cerebrospinal fluid, synovial liquid, ...), tissue biopsie(s), of a patient. This is by no means limitative. All biological samples enabling carrying out a WNA RT-qPCR can be readily used by the skilled person.

According to a particular embodiment, in the case of a biological sample, using whole blood may be advantageous in the sense that less manipulations may be required from the sample collection up to the implementation of the WNA RT-qPCR method of the invention. In an aspect whole blood analysis may enable obtaining lower Cqs that plasma or serum.

WNA RT-qPCR commonly requires nucleic acids extraction, i.e., whole nucleic acids extraction. According to a particular embodiment, a method as described herein further comprises a step wherein the assayed sample, i.e., the sample previously and independently obtained from the environment, an animal or a human patient, is subjected to a nucleic acids extraction protocol involving cells mechanical lysis, in particular through bead beating, for example using zirconium bead tubes, prior to Whole Nucleic Acid (WNA) reverse transcriptase qPCR.

It will be understood that cell mechanical lysis is however not mandatory in order to carry out the invention. Extraction of nucleic acid molecules/content can be done through conventional techniques. For instance, extraction aims at recovering all the nucleic acid molecules of the sample, i.e., total nucleic acid content. Mainly, two categories of methods of extraction of nucleic acid molecules from biological samples are known:

The first one is based on lysis/extraction through organic solvents (e.g. Phenol/Chloroform extraction technique, TrizoL.) followed by the precipitation of the extracted nucleic acid molecules in alcohol; The second one is based on lysis/extraction in the presence of strong concentrations of chaotropic agents/compounds/salts (e.g. Guanidium isothiocyanate, guanidine hydrochloride...), optionally assisted by the action of added detergents and/or enzymes (e.g. Proteinase K, lyzozymes...). Detergents might facilitate lysis but may not be indispensable. Extracted nucleic acid molecules are subsequently generally purified on affinity/resins columns, such as generally known in the art or sold in commercial kits.

These two categories of methods of extraction of nucleic acid molecules can be used jointly with physical treatments, which can be heating or sonication (non-exhaustive list), resulting in multisteps nucleic acid molecules extraction methods.

Chemical lysis can be achieved for example by using sodium dodecyl sulphate or guanidium thiocyanate, or hydroxide electro-generation-induced cell lysis, or alkaline buffers. Multisteps methods including heating may be used, or mechanical disruption methods, such as sonication. Another method is the use of proteinase K digestion in the absence or presence of detergents, phenol-chloroform extraction followed by alcohol precipitation. DNA capture can also be achieved on silica-based resins or glass matrices or capture membranes.

Otherwise, as stated above, and according to a preferred embodiment, using Zirconium/Silicium beads or other means can be used to mechanically disrupt fungus pathogens in the assayed sample.

According to a particular embodiment, Zirconium beads, or Silicium beads, or Zirconium/Silicium beads are used to mechanically disrupt fungus pathogens in the assayed sample.

According to a particular embodiment, 0.1 mm zirconium beads tubes are used.

The experimental section herein provides guidance to the skilled person and a particular example regarding an extraction procedure using a bead beating protocol. Bead beating can be carried out at, e.g., 6000 rpm, for several seconds, e.g., 30 sec. Commercial devices are known, e.g., Precellys device (Bertin Technologies, Montigny-le-Bretonneux, France): several milliliters of, e.g., a lysing matrix B 0.1mm zirconium beads tubes (MP Biomedicals, Graffenstaden, France) can be added.

According to a particular embodiment bead beating is carried out at 4000, 5000, 6000 or 7000 rpm, or any value in between or according to any ranges of values defined by all mentioned boundaries.

According to a particular embodiment bead beating is carried out during 10, 20, 30, 40 or 50 secondes, or any value in between or according to any ranges of values defined by all mentioned boundaries.

According to a particular embodiment, the RT-qPCR assay is carried out using the primers pairs: SEQ ID NO: 2

( ) Q

However, it is observed that knowing the gene cautiously defined by the inventors as being suited for the purposive detection of instant invention, firstly disclosed with present description for that purpose, the skilled person can readily define any suitable primer or primer pairs for the sequence region that he/she seeks to amplify within the defined gene sequence. Examples of target sequences within the defined genre sequence are provided. Examples of primer or primers pairs are provided herein, as well as guidance enabling he/she to connect primers desired position with region amplification choice(s). Primer design can be achieved through commonly available tools, by the skilled person using his/her knowledge to that effect. The skilled person can readily appreciate, according to his/her knowledge and if necessary by reasonable testing, the factors that may be taken into account when determining primers for amplifying a known target sequence. The skilled person can readily determine compatible primers.

According to a particular embodiment, the RT-qPCR assay is carried out using variants of the primers pairs: SEQ ID NO:

( )

description.

According to another particular aspect, the RT-qPCR assay is carried out using the primers pairs and SEQ ID NO: 5

AATGTGATCGATCGACCTCT (361 R). That way, a broader portion of the fungus pathogen genome sought can be amplified. The same may be used with a view to further implement a sequencing step on the obtained amplicons, for example to discriminate between Histoplasma capsulatum var. capsulatum ( Hcc ) or Histoplasma. capsulatum var. duboisii ( Hcd) on the basis of the polymorphism known in the SEQ ID NO: 7 region.

According to a particular embodiment, the RT-qPCR assay is carried out using variants of the primers pairs: SEQ ID NO: 4 GAT GATGGCT CT GATT GAACG (7F) and SEQ ID NO: 5

( ), the variants being as defined throughout the present description.

According to particular embodiments, “variants” are defined as nucleic acid molecules having at least 80% identity with their corresponding reference sequence, i.e., SEQ ID NO: 2, SEQ ID NO: 13, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5.

When identity percentages are considered, they can reach 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

According to particular embodiments, identity percentages are calculated over the whole length of SEQ ID NO: 2, SEQ ID NO: 13, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, taken as a reference sequence, respectively.

In more particular embodiments, identity percentages are calculated over the whole length of the reference sequence using a global alignment tool, as described herein (see EMBOSS alignment tools description in present description). In this respect, “having at least a certain identity percentage” means that the variant sequence “consists of” a sequence having at least said certain identity percentage when aligned with SEQ ID NO: 2, SEQ ID NO: 13, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, as a reference sequence, when aligned with a global alignment tool. Nonetheless, according to other particular embodiments, when used in any one of the methods described herein, variants sequence identity percentages can also be calculated using local alignment tools. As stated above, the skilled person can readily adapt the type of alignment used, taking into account its objective or the sequences comparison made.

According to particular embodiments, “variants” are defined as nucleic acid molecules which, additionally to a certain identity percentage with respect to a reference sequence (see above) or not, have no mismatche(s) at their 3’ terminal end, i.e. , over the last 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotides with respect to their reference sequence.

According to particular embodiments, “variants” are defined as nucleic acid molecules which, additionally to a certain identity percentage with respect to a reference sequence (see above) or not, and/or additionally to the absence of mismatches(s) with respect to their reference sequence (see above), or not, differ from their reference sequence only by 1 , 2, 3, 4, or 5 nucleotides at most. A “difference” means a different nucleotide with respect to the reference sequence at a particular position or a gap.

According to particular embodiments, which can be combined to any one of the other embodiments described herein, “variants” have contiguous nucleotides, i.e., at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides, with respect to their reference sequence, especially at their 3’ terminal end, i.e., over the last 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotides with respect to their reference sequence.

According to a particular embodiment, the RT-qPCR assay is carried out using the primers pairs: a. SEQ ID NO: 2 CGT ACG AC AT CAT ATT AAAAAT G A (F55) or SEQ ID NO: 13 CGTACGACAT CAT ATT AAAAAT G (F55 short) and SEQ ID NO: 3 CTTTCTTTAAGGTAGCCAAAAT (R128), or variants thereof having at least 80% identity with those sequences, or b. SEQ ID NO: 4 GAT GATGGCT CT GATT GAACG (7F) and SEQ ID NO: 5 AATGTGATCGATCGACCTCT (361 R) variants thereof having at least 80% identity with those sequences.

Identity percentages can reach 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

According to a particular embodiment, identity percentages are calculated for the primers, using a global alignment algorithm, such as the Needleman-Wunsch algorithm or any modification of the Needleman-Wunsch algorithm known in the art (see EMBOSS tool, for instance). Standard parameters as generally used and readily adaptable by the skilled person, can be used.

All variants described herein can be used in such a RT-qPCR assay. According to a particular embodiment, the in vitro method of the invention further comprises a step of determining whether the obtained amplicons match the sequence of the mitochondrial Small Sub-Unit ( mtSSU) gene of Histoplasma capsulatum and/or match a sequence within the genomes of Histoplasma capsulatum var. capsulatum (Hoc) or Histoplasma. capsulatum var. duboisii (Hod) and/or of discriminating whether the obtained amplicons match the sequence of the mitochondrial Small Sub-Unit ( mtSSU) gene from either the Histoplasma capsulatum var. capsulatum ( Hcc ) or Histoplasma. capsulatum var. duboisii ( Hod ) genomes. It will be readily understood that use of an amplicon targeting a sequence embedding a difference in sequence between these two species can be used to this end. This also applies to such determinations with respect to mutants known to date, including those described herein, such as the mutant strain found in a patient with Histoplasmosis coming from Laos, defined by the single point mutation A72T with respect to the 355 bp fragment illustrated in Figure 5.

According to a particular embodiment, the in vitro method described herein comprises a step of sequencing the amplified nucleic acid target sequence, for the reasons detailed above. Sequencing techniques are well known in the art. In a particular embodiment, once sequenced, a method as described herein can encompass a further step of comparing the sequenced sequence to known polymorphisms, for example in order discriminate between Histoplasma spp. genomes. Figure 5 shows examples of known polymorphisms and their location with the genome, by reference to the sequence that can be found under GenBank accession number GG663449.1 .

According to a particular embodiment, the in vitro method of the invention is for detecting the presence of Histoplasma capsulatum in a sample, including an environmental sample, including a sample of pure strain (see specificity tests in the experimental sections), including a biological sample drawn from an animal or a human.

According to another aspect, the in vitro method of the invention may be coupled to an in vitro method of detecting nucleic acid content of Mycobacterium tuberculosis, which is carried out concomitantly on a same aliquot of sample to be assayed, or in parallel on a separate aliquot of sample to be assayed, in particular a method of detecting nucleic acid content by RT-PCR.

According to a particular embodiment, the in vitro method of detecting nucleic acid content of Mycobacterium tuberculosis comprises the steps of: a. Providing a sample, in particular a biological sample suspected of being infected by either H. capsulatum or Mycobacterium tuberculosis, previously retrieved from the environment, or obtained from an animal or a human patient, and b. Carrying a reverse transcriptase qPCR (RT-qPCR) assay, in particular a Whole Nucleic Acid (WNA) reverse transcriptase qPCR (RT-qPCR) assay, on the sample of a., wherein the target nucleic acid molecule for amplification by the RT-qPCR assay of b. is a sequence for detecting nucleic acid content of Mycobacterium tuberculosis, and c. detecting whether amplicons of said target sequence are obtained. Such embodiments seek to allow the provision of an assay suitably enabling the end-user to detect both pathogens as described herein and pathogen(s) responsible for tuberculosis, an example of which is provided herein, so as to, e.g., ultimately detect or diagnose or seek diagnosis for either histoplasmosis or tuberculosis in a patient. Symptoms and prevalence zones for these diseases may overlap with each other, and patients subject to them may have a compatible clinical picture. Therefore, it can be advantageous to have the possibility to detect or diagnose or seek diagnosis for either histoplasmosis or tuberculosis simply, within a single test carried out on a same patient sample, or within a test carried out on two samples from a same patient, sequentially in time. Examples of RT-qPCR target sequences for the Mycobacterium tuberculosis pathogen are for example provided in Demirci, M., Saribas, S., Ozer, N., Toprak, S., Caglar, E., Ortakoylu, G., Yuksel, P., Ayaz, G., Tokman, H., Uysal, O., Dine, H., Ziver, T., Kocazeybek, B. (2018). Diagnostic performance of the RT-qPCR method targeting 85B mRNA in the diagnosis of pulmonary Mycobacterium tuberculosis infection Journal of Infection and Public Health 11 (Ann Intern Med 161 6 2014), 662-666. https: //dx.doi.org/10.1016/j.jiph .2018.02.002, which is hereby incorporated by reference in its entirety. Example targets can be IS6110, 65 kDa heat shock protein, 16S rRNA, and 85B mRNA. The skilled person can readily envision combination of the assay described herein with the assay(s) described in that reference for implementing an assay seeking both detection of H. capsulum spp - like pathogen(s) as described herein and the Mycobacterium tuberculosis pathogen.

According to another aspect, the invention provides an in vitro method of diagnosing whether an animal or human subject is infected with Histoplasma capsulatum, wherein said method comprises: a. Performing a “detection” method as described above and according to any embodiment herein, on a biological sample previously obtained from said animal or human subject, in particular a biological sample suspected of being infected by H. capsulatum, in particular wherein the target nucleic acid molecule for amplification of Whole Nucleic Acids (WNA) by reverse transcriptase qPCR (RT- qPCR) assay carried out is SEQ ID NO: 1 , 14 or 15, and b. If the Cq value of the WNA RT-qPCR assay of a. is less than 45, concluding that the animal or respectively human subject is infected by Histoplasma capsulatum.

The skilled person can, readily determine the target nucleic acid molecule as detailed in any embodiment disclosed herein. According to a particular embodiment, the target nucleic acid molecule for amplification of Whole Nucleic Acids (WNA) by reverse transcriptase qPCR (RT- qPCR) assay carried out is SEQ ID NO: 1. According to a particular embodiment, the target nucleic acid molecule for amplification of Whole Nucleic Acids (WNA) by reverse transcriptase qPCR (RT-qPCR) assay carried out is SEQ ID NO: 14. According to a particular embodiment, the target nucleic acid molecule for amplification of Whole Nucleic Acids (WNA) by reverse transcriptase qPCR (RT-qPCR) assay carried out is SEQ ID NO: 15. According to another aspect, the invention also provides for an in vitro method of diagnosing or predicting whether a whether an animal or human subject has histoplasmosis, wherein said method comprises: a. Performing a “detection” method as described above and according to any embodiment herein, on a biological sample previously obtained from said animal or human subject, in particular a biological sample suspected of being infected by H. capsulatum, in particular wherein the target nucleic acid molecule for amplification of Whole Nucleic Acids (WNA) by reverse transcriptase qPCR (RT-qPCR) assay carried out is SEQ ID NO: 1 , 14 or 15 and b. If the Cq value of the WNA RT-qPCR assay of a. is less than 45, concluding that the animal or respectively human subject has or is at risk of having or developing histoplasmosis.

The skilled person can readily determine the target nucleic acid molecule as detailed in any embodiment disclosed herein. According to a particular embodiment, the target nucleic acid molecule for amplification of Whole Nucleic Acids (WNA) by reverse transcriptase qPCR (RT- qPCR) assay carried out is SEQ ID NO: 1. According to a particular embodiment, the target nucleic acid molecule for amplification of Whole Nucleic Acids (WNA) by reverse transcriptase qPCR (RT-qPCR) assay carried out is SEQ ID NO: 14. According to a particular embodiment, the target nucleic acid molecule for amplification of Whole Nucleic Acids (WNA) by reverse transcriptase qPCR (RT-qPCR) assay carried out is SEQ ID NO: 15.

According to a particular embodiment, the human subject is a human patient. According to a particular embodiment, the human subject is a human patient suspected of being a Histoplasma capsulatum var. capsulatum ( Hcc ) or Histoplasma. capsulatum var. duboisii ( Hcd) carrier. According to a particular embodiment, the human subject is a human patient which is not suspected of being a Histoplasma capsulatum var. capsulatum (Hcc) or Histoplasma. capsulatum var. duboisii ( Hcd) carrier.

It can be appreciated that instant invention reports, as shown in the experimental section hereafter, that the WNA RT-qPCR method of the invention was able to detect 10 more specimens than conventional diagnosis in proven cases, and was performant enough to detect seven patients for which conventional diagnosis failed to detect Histoplasma. Although the method of the invention can always be used in combination with other tests in order to corroborate or provide a broader clinical picture of the situation of the patient, it should be appreciated that the proposed method stands above existing methods when it comes to detection specificity (based on low pathogen presence - the detection limit of instant method of the invention is remarkable - and/or prevalence of the pathogen in different parts of the world - said prevalence can be low). For instance, a drawback of tests for detecting Histoplasma that are based on antigen detection is that they are known to come with cross-reactions with other dimorphic fungal pathogens. Accordingly, present invention is clearly an asset for Histoplasma detection, given its performance with respect to Histoplasma detection limit without cross-reaction. Cq value stands for “quantification cycle” value, as commonly used in real-time quantitative PCR experiments, notably aimed at pathogen(s) diagnosis. Synonyms in the literature are Ct (Threshold Cycle) or Cp (Crossing point) or TOP (Take-Off point). As indicated herein, Cq values superior to 45 imply low efficiency of the pathogen genomic material amplification method, which means that the said pathogen genomic material is likely not to be present in the assayed sample. The skilled person can readily admit a slightly different value as an exclusion threshold, i.e. , the Cq value of the WNA RT-qPCR assay can be less than 44, 43, 42, 41 or 40. Conversely, it can also be less than 50, 49, 48, 47 or 46. Such a Cq value should not be too low in order not to eliminate valid results, but should also not be too high (increasing false positive results).

Of note, Cq values may also be dependent upon some experimental conditions. For example, as shown herein the dilution factor of the assayed sample can change the Cq value. However, the skilled person can readily adjust experiments parameters so as to optimize the Cq value for his/her purpose. It can be appreciated that given the performances shown by instant invention and the knowledge of the skilled person in the art and the context of instant invention regarding the peculiarities of the pathogens, the detection of which is sought, the Cq value can be appropriately defined as stated herein, for diagnosing whether an animal subject or human patient, who is susceptible or not to be a Histoplasma capsulatum var. capsulatum ( Hcc ) or Histoplasma. capsulatum var. duboisii ( Hcd) carrier, is infected by Histoplasma or not, and thus has histoplasmosis or not, even if the animal or human is asymptomatic. In addition, the test of present invention provides the possibility of prognosing the same starting from a standardized sampling of biological sample to be assayed, e.g., from a standardized sampling of blood or bodily fluid or liquid, as described herein.

In the context of histoplasmosis “diagnosis”, reference is made, according to a particular embodiment, to an animal or human subject susceptible to be a Histoplasma capsulatum var. capsulatum (Hcc) or Histoplasma. capsulatum var. duboisii ( Hcd) carrier, by reference to the pathogen that can be detected using the detection method described herein when the target sequence is the SEQ ID NO: 1 or 14 or the consensus sequence SEQ ID NO: 15, i.e., within the mtSSU gene of Histoplasma capsulatum var. capsulatum (Hcc) or Histoplasma. capsulatum var. duboisii (Hcd), where only one polymorphism has been detected so far, thereby offering the possibility of a pan-diagnosis assay over these two species (Hcc and Hcd) when the target sequence, especially the target sequence of the consensus sequence SEQ ID NO: 15, is precisely used, as defined in instant invention.

According to the invention, an animal or human subject who is a Histoplasma capsulatum var. capsulatum (Hcc) or Histoplasma. capsulatum var. duboisii ( Hcd) carrier has within her/his body genomic material of these species, this material encompassing a target sequence that is SEQ ID NO: 1 , 14 or 15.

It is another advantage of the invention that the performance of the histoplasmosis “diagnosis” method described herein is advantageous for the diagnosis of localized histoplasmosis disease. Localized histoplasmosis disease is harder to detect than disseminated histoplasmosis disease. While dissemination can be detected starting from a blood sample retrieved from a patient, localized histoplasmosis generally requires, for diagnostic and in the art, an invasive procedure to obtain the specimen (BAL, Biopsy, bone marrow, lymph node aspirate) to be assayed. While disseminated histoplasmosis disease comes with a higher fungal load and can be detected in blood samples or samples derived therefrom, localized histoplasmosis disease conversely generally requires detection on samples obtained from bronchoalveolar lavage fluids or other samples related to the organ affected with the pathogen. In this context, detection specificity of present invention comes as an asset.

According to a particular embodiment, the WNA RT-qPCR assay of the in vitro method discussed in the above paragraphs is followed by a step of sequencing the amplified nucleic acid target sequence, and optionally a further step of comparing the sequenced sequence to known polymorphisms in order to ascertain that the amplified sequenced sequence belongs to a Histoplasma species genome.

The further sequencing step can be a quality check step or a step aimed at further classifying the targeted pathogen based on the sequence of the obtained amplicons.

According to a particular embodiment in line with the developments above concerning tuberculosis disease, the in vitro method described herein, is further for diagnosing or predicting whether an animal as defined herein or a human patient has or has a risk to develop tuberculosis, wherein said method encompasses a step of detecting nucleic acid content of Mycobacterium tuberculosis, in particular as described herein, in order to conclude about the presence of tuberculosis or a risk of presence of tuberculosis in the animal or human patient.

According to a particular embodiment, such a method comprises the steps of:

Performing a “detection” method as described according to any embodiment herein, on a biological sample, in particular a biological sample suspected for contamination by either H. capsulatum or Mycobacterium tuberculosis, previously obtained from a patient, and

From the result of this assay determining whether the animal or human subject has or is at risk of having or developing histoplasmosis, or tuberculosis, or both. According to another aspect, instant invention also relates to an in vitro method for determining the efficacy of a therapeutic active ingredient, or a composition comprising the same, or of a treatment, against histoplasmosis in an animal or human patient, who is a Histoplasma capsulatum carrier undergoing therapy with the said active ingredient, or composition comprising the same, or the said treatment, wherein said method comprises the steps of: a. Performing, at least at a first point and a subsequent second point in time, a “detection” method as described herein on a biological sample previously obtained from said animal or human patient, in particular wherein the target nucleic acid molecule for amplification of the Whole Nucleic Acid (WNA) by reverse transcriptase qPCR (RT- qPCR) assay carried out is SEQ ID NO: 1 , 14 or 15 and b. Comparing the Cq values obtained for the WNA RT-qPCR assays performed at the at least first and second points in time, wherein an increase in the Cq values is indicative that the said active ingredient, or composition comprising the same, or treatment, is efficient for reducing the pathogen load and thus treating or alleviating histoplasmosis in said patient.

Indeed, experimental section reports the suitability of instant invention in order to monitor the effectiveness of a treatment administered in order to alleviate or treat histoplasmosis. 9 patients with at least one RT-qPCR positive and one follow-up blood sample were studied for a median follow-up duration of 25 days (see results in Table 8, Figure 3). These patients were treated with liposomal amphotericin B at DO.

Accordingly, the skilled person can readily use instant invention for the purpose of following patients administered with a treatment, with any suitable adjustment when necessary, regarding monitoring protocol. The follow-up can be used to ensure observance of the treatment or efficiency of the same.

According to another aspect, the invention also relates to a method of treatment of a subject suffering (i.e., diagnosed with) or susceptible to suffer from histoplasmosis, said treatment method comprising:

- Carrying out any one of the “detection” and/or “diagnosis” methods described herein, using WNA RT-qPCR with a target sequence that is SEQ ID NO: 1 , 14 or 15, and, if conclusion is made that the subject is suffering or at risk of suffering from histoplasmosis;

- Administering to said subject one or several active ingredient(s) for simultaneous, separate or sequential use for treating, preventing or alleviating histoplasmosis or its symptoms.

Active ingredient(s), suitable to treat, prevent or alleviate histoplasmosis or its symptoms are documented in the art. For instance, reference is made to Wheat et al., Clinical Infectious Diseases, Volume 45, Issue 7, 1 October 2007, Pages 807-825, https: //doi.org/10.1086/521259 and Almeida-Silva, F., Gongalves, D., de Abreu Almeida, M. et al. Current Aspects of Diagnosis and Therapeutics of Histoplasmosis and Future Trends: Moving onto a New Immune (Diagnosis and Therapeutic) Era?. Curr Clin Micro Rpt 6, 98-107 (2019). https: //doi.org/10.1007/s40588- 019-00118-3, which are incorporated herein in their entirety. In particular, Table 1 of Almeida- Silva, F. at al., 2019, indicating active ingredient(s) and posologies, is incorporated herein in its entirety.

According to the invention, said active ingredient(s) may, e.g., be:

Amphotericin B deoxycholate Amphotericin B (d-AmB),

Liposomal Amphotericin B (L-AmB),

Amphotericin B lipid complec,

Itraconazole, Any azole, especially oral azole, e.g., fluconazole, ketonazole, posaconazole, voriconazole (all of them can be second-line alternatives to itraconazole), isavuconazole, or methylprednisolone, or corticoid(s) in general,

Any combination thereof, whenever appropriate.

As discussed above, dosages and posologies are readily available in the literature, and can be adjusted to the patient’s needs according to guidance available in the art.

Histoplasmosis is a systemic mycosis caused by Histoplasma capsulatum, a thermally dimorphic fungus of worldwide distribution. The evolution of the disease may depend on the immunological competence of the host, inhaled fungal inoculum and virulence of the infecting strain. Asymptomatic infections occur in about 90% of the individuals exposed to low H. capsulatum inoculum. When exposed to high fungal loads, the majority of individuals develop an auto-limited acute pulmonary manifestation. In immunocompromised, such as HIV-infected, young or elderly, and auto-immune diseased individuals and immunosuppressed, such as those undergoing corticoids therapy, fungus dissemination might reach out several organs and tissues, often the liver, spleen, digestive system, bone marrow, and occasionally, the central nervous system. Universal related symptoms are high fever, anorexia, and asthenia. However, manifestations such as productive cough, dyspnea, thoracic and abdominal pain, myalgia, diarrhea, and lymphoadenomegaly/hepatosplenomegaly can be observed and be related.

Treatment is sought to cure, prevent or alleviate histoplasmosis or its symptoms, as in particular describe above.

According to a particular embodiment, the treated subject can be an immunocompromised subject (such as a HIV-infected, a young or an elderly subject), and/or an auto-immune diseased individual or immunosuppressed individual, such as those undergoing corticoids therapy.

The invention accordingly also relates to active ingredients) selected amongst: Amphotericin B, deoxycholate Amphotericin B (d-AmB), Liposomal Amphotericin B (L-AmB), Amphotericin B lipid complex, Itraconazole, Any azole, especially oral azole, e.g., fluconazole, ketonazole, posaconazole, voriconazole (all of them can be second-line alternatives to itraconazole), isavuconazole, or methylprednisolone, or corticoid(s) in general, any combination thereof, or composition comprising the same, for simultaneous, separate or sequential use for treating, preventing or alleviating histoplasmosis or its symptoms, in a patient diagnosed as having or being at risk of having or developing histoplasmosis, wherein said patient was subjected to a “detection” method as described in any embodiment herein, the latter of which was performed on a biological sample previously obtained from said patient prior to or during the course of administering the active ingredient(s), or wherein said patient was diagnosed according to any “diagnosis” method as described in any embodiment herein.

According to a particular embodiment, the treated patient can be an immunocompromised subject (such as a HIV-infected, a young or an elderly subject), and/or an auto-immune diseased individual or immunosuppressed individual, such as those undergoing corticoids therapy. The invention also relates to a kit for carrying out a method as defined in any of the embodiments described herein, let it be according a “detection”, “diagnosis” or “treatment” method, said kit comprising: a. A reverse transcriptase polymerase, such as a genetically engineered MMLV

Reverse Transcriptase, in particular a Superscript™ III Reverse Transcriptase, b. Primer(s) pairs selected amongst SEQ ID NO: 2 or 13 and 3, or SEQ ID NO: 4 and 5 or variants thereof having at least 80% identity with their corresponding reference sequence, a. Optionally, primer(s) appropriate for carrying out a method of “detection” or “diagnosis” as defined in any embodiment as disclosed herein, b. Optionally, nucleic acid probe(s), hybridizing in stringent conditions with SEQ ID

NO: 1 , 14 or 15 or a variant thereof, such as FAM-

TGTAGTGGTGTACAGGTGAGT-BHQ1 (SEQ ID NO: 8) or a variant thereof having at least 80% identity with the its corresponding reference sequence, c. Optionally, buffer(s) or reagents(s).

The Invitrogen Superscript™ III Reverse Transcriptase is a proprietary genetically engineered MMLV (Moloney Murine Leukemia Virus) reverse transcriptase (RT) that was created by introduction of several mutations for reduced RNase H activity, increased half-life, and improved thermal stability. Use of such a reverse transcriptase polymerase may therefore be used when available, for improved yields. However, the skilled person can readily use any reverse transcriptase polymerase for the purpose of carrying out present invention.

When identity percentages are considered, they can reach 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

According to a particular embodiment, identity percentages are calculated for the primers or probes, using a global alignment algorithm, such as the Needleman-Wunsch algorithm or any modification of the Needleman-Wunsch algorithm known in the art (see EMBOSS tool, for instance). Standard parameters as generally used and readily adaptable by the skilled person, can be used.

Suitable probe(s) can be readily determined by the skilled person according to conventional practice. LigthCycler-type probes as used in the experimental section herein are also known as dual hybridization probes. Other probes are FRET probes. Exemplary quenchers can be covalently attached to probes 3’-end (e.g., TAMRA® or BHQ®-1).

The invention also relates to the use of a kit as described herein, for carrying out a method according to any one of the embodiments described in the present description.

According to another aspect, the invention also relates to nucleic acid molecules, especially nucleic acid molecules suitable as primers, or probes, in the context of present invention. To this end, the invention also encompasses a nucleic acid molecule selected amongst: SEQ ID NO: 2, SEQ ID NO: 13, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8, or variants thereof having at least 80% identity with SEQ ID NO: 2, SEQ ID NO: 13, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8, respectively. As described herein, SEQ ID NO: 2, SEQ ID NO: 13, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or variants thereof can be used as primers. SEQ ID NO; 8 or a variant thereof can be used as a probe, especially in the context of any method as described herein.

According to a particular embodiment, the invention relates to a nucleic acid molecule selected amongst: SEQ ID NO: 2, SEQ ID NO: 13, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8. The selection amongst this list imparts, according to this embodiment, that the nucleic acid molecule consists of a sequence selected amongst: SEQ ID NO: 2, SEQ ID NO: 13, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8. Such nucleic acid molecules can be used in any of the methods described herein.

According to particular embodiments where variants are at stake, the invention relates to a nucleic acid molecule having at least 80% identity over its whole length with SEQ ID NO: 2, SEQ ID NO: 13, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8, respectively. In a particular embodiment, the invention relates to a nucleic acid molecule having at least 80% identity when aligned with SEQ ID NO: 2, SEQ ID NO: 13, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8, as a reference sequence, with a global alignment tool. Global alignment tools create an end-to-end alignment of the sequences to be aligned. Such algorithms are known to the skilled person. For instance, the website htps://www.ebi.ac.uk/Tools/psa/ proposes two global alignment tools, i.e., the EMBOSS Needle and the EMBOSS Stretcher, the latter of which uses a modification of the Needleman-Wunsch algorithm that allows larger sequences to be globally aligned. The parameters, which can be used, are standard and can be readily adapted by the skilled person using conventional knowledge. The “selection” amongst the above- mentioned list of sequences imparts, according to these embodiments, that the nucleic acid molecule, which is a variant with respect to a reference sequence, consists of a sequence having at least 80% identity when aligned with SEQ ID NO: 2, SEQ ID NO: 13, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8, as a reference sequence, with a global alignment tool. Such variant nucleic acid molecules can be used in any of the methods described herein.

Identity percentages for variants can reach 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

According to a particular embodiment, the variant nucleic acid molecules (primers) have no mismatches at their 3’ terminal end, i.e., over the last 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotides with respect to their reference sequence.

According to particular embodiments, “variants” of nucleic acid molecules (primers) are defined as nucleic acid molecules which, additionally to a certain identity percentage with respect to a reference sequence (see above) or not, have no mismatche(s) at their 3’ terminal end, i.e., over the last 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotides with respect to their reference sequence.

According to particular embodiments, “variants” of nucleic acid molecules (primers) are defined as nucleic acid molecules which, additionally to a certain identity percentage with respect to a reference sequence (see above) or not, and/or additionally to the absence of mismatches(s) with respect to their reference sequence (see above), or not, differ from their reference sequence only by 1 , 2, 3, 4, or 5 nucleotides at most. A “difference” means a different nucleotide with respect to the reference sequence at a particular position or a gap.

According to particular embodiments, which can be combined to any one of the other embodiments described herein, “variants” of nucleic acid molecules (primers) have contiguous nucleotides, i.e., at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 contiguous nucleotides, with respect to their reference sequence, especially at their 3’ terminal end, i.e., over the last 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotides with respect to their reference sequence.

The invention also encompasses the use of couples of nucleic acid molecules, notably as primers, amongst all nucleic acid molecules, notably primers described herein, for any purpose described herein. For example, the invention encompasses the use of SEQ ID NO: 2 or SEQ ID NO: 13 and SEQ ID NO: 3 or variants as defined herein, especially in the above paragraphs, as primers any method as described herein, involving a WNA RT-qPCR according to any embodiment defined herein. The invention also encompasses the use of SEQ ID NO: 4 and SEQ ID NO: 5 or variants as defined herein, as primers any method as described herein, involving a WNA RT-qPCR according to any embodiment defined herein.

According to a particular embodiment, the invention makes it possible to detect the mutant strain found in a patient with Histoplasmosis coming from Laos, defined by the single point mutation A72T with respect to the 355 bp fragment illustrated in Figure 5. Accordingly, the invention also relates to the use of couples nucleic acid molecules, notably as primers, amongst all nucleic acid molecules, notably primers described herein, enabling such a detection.

The invention also relates to the use of any method as described herein, for detecting an infection by Histoplasma capsulatum var. capsulatum ( Hcc ) in an animal or a human patient from which the biological sample was previously obtained, or for detecting the mutant strain found in a patient with Histoplasmosis coming from Laos, defined by the single point mutation A72T with respect to the 355 bp fragment illustrated in Figure 5, in a sample, in particular a biological sample previously obtained from an animal or a human patient.

The invention also relates to the use of the mitochondrial Small Sub-Unit ( mtSSU) gene of Histoplasma capsulatum, or a variant thereof, as a target sequence for detection of a fungal pathogen by WNA RT-qPCR in a sample susceptible of containing, or containing, at least one Histoplasma species, in particular an Histoplasma species selected amongst: Histoplasma capsulatum var. capsulatum (Hcc) and Histoplasma. capsulatum var. duboisii ( Hcd ).

According to another aspect, the invention relates to the use, as a target for a WNA RT- qPCR assay, of a nucleic acid molecule contained in the mitochondrial Small Sub-Unit ( mtSSU ) gene of Histoplasma capsulatum, or a variant of this gene.

According to the invention, the target nucleic acid molecule contained in the mtSSU gene of Histoplasma capsulatum can be as defined in any embodiment described herein. The target nucleic acid molecule can be SEQ ID NO: 7 or SEQ ID NO: 12 or SEQ ID NO: 16, or SEQ ID NO: 1 , or SEQ ID NO: 14, or SEQ ID NO: 15, or variants thereof, according to the definition provided in instant description.

According to the invention, the use of the mtSSU gene of Histoplasma capsulatum or a variant thereof as a target in the context of WNA RT-qPCR, advantageously allows for amplification of both the RNA and DNA of the mitochondrial small subunit gene (mtSSU) of Histoplasma capsulatum.

According to a particular embodiment, the invention also relates to SEQ ID NO: 1 , 14 or 15 or a sequence differing therefrom by up to 3 nucleic acid substitution^) and/or addition(s) and/or deletion(s) as a target sequence for detection of a fungal pathogen by WNA RT-qPCR in a sample susceptible of containing, or containing, at least one species selected amongst: Histoplasma capsulatum var. capsulatum ( Hcc ) and Histoplasma. capsulatum var. duboisii ( Hcd ).

Each feature or combination of features, which has been described in the context of a method of the application, applies to each product, combination, association, kit or composition as such as well as to their uses, mutatis mutandis.

The term "comprising" as used herein, which is synonymous with "including" or "containing", is open-ended, and does not exclude additional, unrecited element(s), ingredients) or method step(s), whereas the term "consisting of is a closed term, which excludes any additional element, step, or ingredient which is not explicitly recited.

The term “essentially consisting of” is a partially open term, which does not exclude additional, unrecited element(s), step(s), or ingredients), as long as these additional element(s), step(s) or ingredient(s) do not materially affect the basic and novel properties of the application.

The term “comprising” (or “comprise(s)”) hence includes the term “consisting of” (“consists) of), as well as the term “essentially consisting of (“essentially consist(s) of). Accordingly, the term “comprising” (or “comprise^)”) is, in the present application, meant as more particularly encompassing the term “consisting of (“consist(s) of”), and the term “essentially consisting of (“essentially consist(s) of).

In an attempt to help the reader of the present application, the description has been separated in various paragraphs or sections. These separations should not be considered as disconnecting the substance of a paragraph or section from the substance of another paragraph or section. To the contrary, the present description encompasses all the combinations of the various sections, paragraphs and sentences that can be contemplated.

Each of the relevant disclosures of all references cited herein is specifically incorporated by reference.

The features described here-above and other features of the invention will be apparent when reading the examples and the figures, which illustrate the experiments conducted by the inventors, in complement to the features and definitions given in the present description. The following examples are offered by way of illustration. The examples are however not limitative with respect to the described invention. LEGEND OF THE FIGURES

Figure 1. Comparison of the amplification of DNA or WNA.

Figure 2. Comparison of the WNA RT-qPCR assay with two existing qPCR assays targeting ITS locus. The WNA RT-qPCR assay gave significantly lower Cq values compared to the other assays for Hoc and Hcd varieties

Figure 3. Evaluation of the decrease of the fungal load under antifungal treatment in eight patients with initial positive RT-qPCR in blood and follow up specimens obtained (A). Evaluation of the rate of the decrease of the fungal load regarding the initial fungal load (B) with a decreased rate of half fungal load per day.

Figure 4. RT-qPCR results obtained in Whole blood (EDTA blood) compared to parallel serum or plasma in 6 patients. Whole blood analysis showed significantly lower Cqs that plasma or serum.

Figure 5. Alignment of 4 isolates of Ajellomyces capsulatus 355bp and one isolate of a mutant strain found in a patient with Histoplasmosis coming from Laos as described herein (A72T mutation, see star) upon sequencing with primers 7F (SEQ ID NO: 4) and 361 R (SEQ ID NO: 5). Bold and underlined sequences correspond to hybridization sequences of primers F55 (SEQ ID NO: 2) or F55short (SEQ ID NO: 13) and R128 (SEQ ID NO: 3), sequence in italic and framed corresponds to hybridization sequence of probe 79P (SEQ ID NO: 8). One polymorphic position is present in Histoplasma capsulatum var. duboisii, this polymorphic position is outside of the sequence amplified by primers 7F and 361 R (SEQ ID NO: 10 and 11 in Figure 5).

EXAMPLES

MATERIAL AND METHODS

Inclusion criteria

Since French mycologists and clinicians were aware of the new WNA RT-qPCR assay for the diagnosis of histoplasmosis, they requested inventors’ expertise for patients with a suspicion of histoplasmosis. All the patients for whom the assay was performed from May 2015 to May 2019 as part of the routine procedure of diagnosis were included in this analysis. Routine diagnosis of histoplasmosis in France does not include detection of Histoplasma antigens because of its low prevalence, nor detection of anti -Histoplasma antibody for lack of accuracy to detect acute histoplasmosis even in immunocompromised or immunocompetent patients from endemic areas [4] Clinical data were recorded retrospectively for all PCR positive patients. Cases of histoplasmosis were classified according to the EORTC criteria [13] No probable case was included since antigen testing was not available in France and in Saint-Louis Hospital, proven cases were thus analyzed. Histoplasmosis cases were classified as possible histoplasmosis where only qPCR was positive without other mycological criteria (histopathology, direct microscopy, culture) in a compatible epidemiological and clinical context. Disseminated cases were defined as those with >2 non-contiguous lesions associated with mycological diagnosis on at least one lesion. Localized cases were those with lesions observed only in one organ.

Samples

Various specimens including whole blood, tissues (lungs, digestive tract, adrenal glands), liquids (bronchoalveolar lavage fluid, cerebrospinal fluid, bone marrow aspirate, pleural, peritoneal, pericardic exudates) or skin/mucous scrapings (skin or mucous ulcerations) were considered. Microscopic examination and culture and/or histology were performed in parallel to RT-qPCR except in 79/184 specimens from 33 patients (28 proven and 5 possible) (57 blood samples, 5 respiratory tract and 1 skin tissue, 4 CNS tissue, 2 osteoarticular, 2 digestive tissue and 1 kidney tissue). All proven patients had at least one specimen with a positive microscopic examination and culture and/or histology. Five possible patients had no investigation but the PCR to assess mycological diagnosis in a compatible epidemiological and clinical context. Paraffin embedded tissue sections were also used in few cases requiring specific extraction procedures.

Nucleic acids extraction

Extraction procedures were optimized as follows. Bead beating (6000 rpm for 30 sec) in a Precellys device (Bertin Technologies, Montigny-le-Bretonneux, France) with 2 mL lysing matrix B 0.1 mm zirconium beads tubes (MP Biomedicals, Graffenstaden, France) was shown to be critical to increase the nucleic acid yield. Whole nucleic acids (WNA) were extracted from fresh specimens (blood (1.3 mL), pellet for all liquids, tissue biopsy) after bead beating, 5 min centrifugation at 10.000 g and 4°C with addition of 10 pL/sample of 1 :5 diluted internal control (DNA Virus Culture, DICD-CY-L100, Diagenode, Seraing, Belgium) using a Qiasymphony (Qiagen, Hilden, Germany) with the VirusPathogen extraction Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. WNA were eluted in 85 pL volume. For the paraffin embedded tissue specimens, extraction of three 10 pM-sections was performed using the DNeasy Blood and Tissue kit (Qiagen, Hilden, Germany) following the manufacturer's recommendations with a volume of elution of 110 pL in DNA grade water. All extracts and aliquots were stored at +4°C until use.

A preliminary experiment on a patient with a positive qPCR in blood (Table 1) showed a clear decreased Cq value upon bead beating compared to without mechanical lysis. Therefore, all specimens were processed with bead beating in this study. Another Preliminary experiment showed that whole blood was better than plasma (Figure 4A and 4B) to detect circulating Histoplasma spp. in blood. Therefore, blood with bead beating was used instead of serum or plasma in this study. Serum and plasma specimens were not considered further as relevant sample type.

Selection of the RT-qPCR target

The ribosomal small subunit RNA gene of H. capsulatum (GenBank GG663449.1) was used to design primer and probes using Primer3web v4.0.0 software. Outer primers (Hc_7F:

validate the Histoplasma sequence in the region of interest of this gene. The amplicons obtained with two strains of Hcc (CNRMA16.205 and CNRMA17.309), one strain of Hcd (CNRMA16.638) were sequenced resulting in a 100% (357/357bp) and 99.9% (356/357bp) similarity with the reference sequence (GenBank GG663449.1), respectively. The final RT-qPCR assay was then designed in conserved regions outside of the polymorphic region (one position in hcd) observed.

Whole nucleic acid reverse transcriptase qPCR assay (RT-qPCR)

WNA amplification was performed using the following conditions: 1 x Invitrogen RT-qPCR buffer mix (Superscript III One step RT-PCR, Life Technologies Corporation, Carlsbad, CA, USA), 0.3 pM of each primer (Hc_24_55F (also termed F55 herein): CGTACGACATCATATTAAAAATGA and Hc_22_128R: CTTTCTTTAAGGTAGCCAAAAT), 0.1 pM of probe (Hc_21_79P: FAM- TGTAGTGGTGTACAGGTGAGT-BHQ1), and 1 pM of Superscript III Platinum enzyme, in a total of 25 pL with 8 pL of WNA extract. The amplification consisted of one step of RT-PCR at 50°C for 15 min, followed by qPCR with one activation step at 95°C for 2 min and 50 cycles of denaturation at 95°C for 15 sec and annealing at 53°C for 30 sec. All the qPCR runs were performed on a Light Cycler 480 thermocycler (LC480-II; Roche Diagnostics, Mannheim, Germany) with Cq determination using the second derivative method.

Specificity

99 fungal strains of 95 species were tested in this study to assess the specificity of the qPCR assay. These strains are listed in Table 2 and 3.

Limit of detection and qPCR efficacy

A 129 base pair DNA amplicon containing the PCR target locus of the qPCR assay was synthetized at 12.57 fmol/ng (gBIock Gene Fragments, IDT, Coralville Iowa, USA), diluted at different concentrations (100,000 to 1 copies/well) and tested on a LC480-II. The standard curve allowing PCR efficiency calculation was obtained based on the result of two replicates of five 10- fold serial dilutions of the WNA of Hcc strain CNRMA16.205. Regression lines were constructed automatically by plotting the logarithm of the initial template concentration versus the corresponding Cq value by using Analysis package included in LightCycler 480 software v. 1 .5 (Roche Diagnostics, Mannheim, Germany). qPCR assay comparison

The in-house RT-qPCR targeting mtSSU was compared on the LC480-II with two previously published qPCR assays targeting ITS1 regions of H. capsulatum [10,13] following the published protocols [10,13] Real-time PCR reactions assay from Simon et al. publication (qPCR 1) was carried out as advised by the authors in a final volume of 25 pL containing 1x LC480-II Probes Master, 0.9 pM of each primer, 0.25 pM of the probe, 7 pL of template DNA [13] Real-time PCR reactions assay from Buitrago et al. publication (qPCR 2) was carried out as advised by the authors in a final volume of 25 pL containing 2x LC480-II Probes Master, 0.5 pM of each primer, 0.2 pM of the probe, 7 pL of template DNA [10] A total of 10 WNAs were tested including four WNA extracted from the two CNRMA strains of each Hcc (CNRMA17.309 and CNRMA16.205) and Hcd (CNRMA16.638 and CNRMA17.108) adjusted at 1 ng/pL, and positive WNA samples using the RT-qPCR (n=6) from whole blood, one bone marrow aspiration, one lymph node, one digestive biopsy (4 patients infected with Hcc), and one bone biopsy and one brain abscess (2 patients infected with Hcd). The three assays were performed the same day on the same LC480- II and the dilutions aliquots realized extemporaneously. A standard curve allowing PCR efficiency calculation was obtained for each assay based on the result of PCR duplicates in six serial dilutions WNAs.

Clinical strains Identification

Histoplasma isolates were sent to the National reference Center for Invasive Mycoses & antifungals, Institut Pasteur, Paris and were identified based microscopic examination of the colony and on Intein sequencing (PRP8 intein in cryptic species of Histoplasma capsulatum: Evolution and phylogeny, Raquel CordeiroTheodoro et al., Infection, Genetics and Evolution, Volume 18, August 2013, Pages 174-182, DOI: 10.1016/j.meegid.2013.05.001).

Statistical analysis

Median and interquartile range are given for specific analysis. Non-parametric paired t-test were performed to compare WNA and DNA Cq and for Cq comparison of the qPCR assays. Contingency tables and Fischer's exact test were performed to analyze the statistical link between clinical presentation, underlying disease, visited countries, positive galactomannan test and a positive qPCR test.

RESULTS

Evaluation and validation of the Histoplasma RT-qPCR

Amplification

The performances of the assay obtained using DNA with qPCR compared to using WNA with RT- qPCR was first evaluated. The same kit and specimens (containing DNA and RNA) were used but without the reverse transcriptase step (15 min at 50°C) for qPCR. Comparison of the results on 11 WNA extracts from 3 patients showed that the sensitivity on WNA (11/11 , 100%) was higher than on DNA (9/11 , 81%) specimen detected). In addition, WNA gave significantly lower Cq values (median 40.3 [29.5-41.2]) compared to DNA (median 40.2 [31.6-45]) (p=0.006, Figure 1).

Specificity

A total of 99 strains from 95 different species were tested showing no cross reactivity except for Histoplasma species ( Hcc and Hcd) (Table 2 and 3). The ability to detect 1 ng of DNA of Hcd (mean Cq 17.2) was identical to that of var. capsulatum (mean Cq= 16.3).

Limit of detection - Efficiency.

The qPCR assay was able to detect as little as 10 copies of DNA/well (Table 4). The efficiency of the RT-qPCR was 1 .9 (95%).

qPCR comparison

The RT-qPCR assay was compared to two qPCR assays from the literature based on 6 Hcc WNA and 4 Hcd WNA and gave significantly lower Cq values compared to qPCR 1 and qPCR 2 assays (p=0.004) (Figure 2A). Of 6 clinical specimens, one was not detected with qPCR 2. The RT-qPCR gave significantly lower mean Cq values (27.26 and 22.1) than qPCR 1 (31 .0 and 25.3) and qPCR 2 (31 .6 and 28.8) assays targeting ITS for Hcc (p=0.008) or Hcd (p=0.042), respectively (Figure

2B, Table 5).

Clinical evaluation

Over the 5 years, 1 ,319 samples from 907 patients were tested. A total of 44 patients had proven histoplasmosis based on a positive direct examination and/or culture (Table 6). The majority of the patients had some kind of immunosuppression (25/44, 56.8%), while 19/44 (43.2%) had no major cause of immunosuppression (immunocompetent). The predisposing factor regarding immunosuppression were HIV infection (16/44, 36.4%), hematological malignancies (2/44, 4.5%), immunosuppressive therapy for systemic diseases (2/44, 4.5%), solid organ transplantation (2/44, 4.5%), cancer (1/44, 2.3%). Histoplasmosis was disseminated in 24/44 cases (54.5%) and localized to lungs in 12/44 (27.3%) cases. Four out of 44 (9.1%) cases were due to Hcd and 40/44 (90.9%) to Hcc. Patients lived in or had travelled to different endemic area including sub-Saharan Africa (17/44, 38.6%), Central and South America (11/44, 25.0%), Caribbean islands (9/44, 20.5%), Asia (4/44, 9.1%), North America (3/44, 6.8%). Of the 17 patients potentially contaminated in sub-Saharan Africa, Hcc and Hcd were identified in 4 (23.5%) and 13 (76.5%), respectively. In all 44 proven cases, RT-qPCR gave a 100% sensitivity with a positive RT-qPCR in at least one specimen (median: 2 RT-qPCR-positive specimens/patient) (Table 6). A total of 169 specimens were recovered from these 44 proven cases including 97 PCR-positive specimens. In the 94 specimens investigated for microscopy and/or culture, PCR was positive in 59/64 (92.2%) specimens with a positive microscopy or culture vs. in 10/30 (33.3%) specimens with a negative microscopy or culture. In addition, 28/75 (37.3%) specimens not investigated for microscopy and/or culture were RT-qPCR positive.

In addition to these 44 patients with proven histoplasmosis, 9 cases were detected by RT-qPCR and classified as possible because positive RT-qPCR as the only microbiological evidence of Histoplasma infection in patients having immunosuppression (3/9, 33.3%) and lived or travelled in endemic areas (9/9, 100%). Most of the patients had localized diseases (8/9, 88.9%) [lung (7/8), digestive tract (1/8) involvement] and only 1/9 (11 .1%) had disseminated disease. RT-qPCR positive specimens were respiratory specimens (n=8), digestive tract (n=1) (Table 6). Parallel culture and/or direct examination/histopathology were negative for the seven patients for whom they were performed. In one case, galactomannan detection was positive. For all patients, no other diagnosis explained the symptoms. Blood was tested negative in 7 cases out of 7 tested. No treatment and follow up was recorded for these patients.

Overall, for the 53 patients and the 184 specimens tested, RT-qPCR positivity was significantly associated with the clinical presentation (Chi-square, p=0.03) with an increased rate of positive PCR in specimens recovered from disseminated (75/112 specimens, 67.0 %) compared to localized disease (32/72 specimens, 44.4 %) (Fisher's exact test, p=0.004). RT-qPCR positivity was not associated with the underlying disease (Chi-square, p=0.80), the country of potential contamination (p=0.94), the variety involved (p=0.53) orgalactomannan detection (p=0.37) (Table 7). PCR alone (with negative microscopy or culture) was positive in 18 specimens of 13 patients (6 proven, 7 possible) including 11 respiratory specimens, 1 urine, 1 digestive tract, 2 lymph nodes and 3 blood. Of note, the 6 proven cases were diagnosed on other specimens.

Blood RT-qPCR analysis

A median of 1 blood specimen [range 1-9] per patient was tested (Table 6). RT-qPCR in blood obtained within the first 7 days after diagnosis was positive only in 13 proven cases out of 30 cases with blood tested (43.3%) and negative in all possible cases (0/5 tested). In proven cases, a positive RT-qPCR in blood was significantly associated with disseminated cases with an increased rate of positive RT-qPCR in disseminated (12/18, 66.6%) versus localized (1/12, 8.3%) cases (p=0.0024). The same feature was observed considering specimens (chi-square, p=0.001), with 24/49 (49.0%) positive RT-qPCR in blood specimens from disseminated vs. 1/33 (3.0%) in blood specimens from localized cases (p<0.0001) (Table 7).

RT-qPCR detection in blood was significantly associated with the underlying disease (p=0.005), with RT-qPCR positivity rate significantly increased in 10/18 (55.5%) immunocompromised proven cases vs. 1/10 (10%) in immunocompetent proven cases (p=0.041). The association is also significant if samples were considered with RT-qPCR positivity observed in 24/60 (40.0%) specimens from immunocompromised vs. 1/22 (4.5%) in specimens from immunocompetent cases (p=0.002). Of note, blood was obtained from 3/4 immunocompetent patients with Hod disseminated infections and RT-qPCR was negative in all 3 cases (100%). There was a trend towards an association between RT-qPCR positive blood specimens in patients with a positive galactomannan in serum at diagnosis (P=0.11) (Table 7).

Thirty-seven blood samples from 9 patients with at least one RT-qPCR positive and one followup blood sample were studied for a median follow-up duration of 25 days [13.5-82] and with a median number of blood sample per patient of 3 (Table 8). All patients were treated with liposomal amphotericin B at DO (date ofthe first positive blood specimen). The kinetics of the fungal load is plotted in Figure 3A. The rate of negativation was dependent on the initial fungal load (Figure 3B) with a R² at 0.58 and a slope at -1.04 ± 0.44. This gain of 1 Cq per day corresponded approximatively to a 2-fold decrease of the fungal load per day of treatment. Of note, for 3 of the 9 patients (Patients # 14, 38, 45), no PCR negativation was obtained until screening was stopped (Table 8). In patient 14 (HIV positive and inobservant), RT-qPCR was still positive 334 and 611 days after the first positive result in blood with no intermediate testing.

Table 8: RT-qPCR results in the blood of patients with follow up and a initial blood positive RT- qPCR test.

DISCUSSION

This study describes and validates a new qPCR method, namely reverse transcriptase qPCR (RT-qPCR) dealing with whole nucleic acid (WNA) detection, with the idea to increase sensitivity and specificity of existing methods. Indeed, it was possible to detect WNA in 100% (44/44) proven French cases enrolled in the study, even if only 92.1% of the specimens with conventional diagnosis (positive microscopy or culture) were RT-qPCR positive. Unsurprisingly, it has been found that a positive RT-qPCR in blood was significantly associated with immunocompromised patients and with disseminated infection as already observed [24] Indeed, 50% of HIV positive patients with Histoplasmosis have blood culture [25] In this study, from the 30 patients with proven infection and blood tested, 15 were HIV-positive patients and 10 of them (66.6%) and a positive RT-qPCR in blood. Of note, a positive RT-qPCR in blood was also detected in a solid organ transplant recipient (#27), a patient with hematological malignancy (#04) and in an apparently immunocompetent patient (#10). All of them had a disseminated acute disease. These results demonstrated a decreased of the fungal load overtime under liposomal amphotericin B therapy with a rate of 2 times decreased every day of treatment. Thus, follow up of the RT-qPCR fungal load in blood is to be recommended since a persistence or a complete negativation helps at managing the patient properly, as demonstrated several years ago in the study of J. Wheat, looking at the decrease of the fungal load in blood of patients treated with liposomal amphotericin B or Itraconazole [26]

These results contrast with recent publication comparing Internal Transcribed Spacer (ITS) Loop- mediated Isothermal Amplification (LAMP) PCR and HSP100 nested PCR for which a positive PCR was observed in only 54 and 64% of the culture positive specimens and in 83% of the total specimens [9] Indeed, the WNA RT-qPCR was able to detect 10 more specimens that conventional diagnosis in proven cases. In this study, on a restricted number of strains and clinical specimens WNA, it was possible to assess the superiority of the WNA RT-qPCR test targeting WNA of mtSSU gene as compared to qPCR targeting ITS DNA. It was also demonstrated that the WNA RT-qPCR gained in the detection of Hcd over the other tests, which is of outmost importance since Histoplasmosis due to Hcd is frequently underdiagnosed in Africa [22], although the clinical picture is clearly different than that of Hcc patients in patients without immunosuppression but could be similar in HIV-positive patients [23] In the cohort, 4 patients were diagnosed with Hcd infections. All were considered immunocompetent and HIV-negative but with disseminated infections. Nevertheless, it was not possible to detect a positive PCR in blood in ¾ patients investigated at diagnosis with a blood specimen. This suggests that either the fungal load of circulating yeasts in blood in low resulting in a negative RT-qPCR, or that dissemination occurred previously and was not active by itself at diagnosis. The second hypothesis is more likely, since the patients presented at the hospital with very chronic disease without acute symptoms and since the volume of the lesions observed in tissues were high. In addition, RT-qPCR was performant enough to detect seven patients for which conventional diagnosis failed to detect Histoplasma. These patients have been classified as possible cases. Of note three additional possible cases were detected although no conventional diagnosis was performed. Possible cases were in mainly immunocompetent and for which in some cases treatment was not given when symptoms amended spontaneously. These cases are indeed debatable since no other diagnostic mean was positive for Histoplasma. Anti-Histoplasma antibody or Histoplasma antigen were not tested in these patients since no reproductible test are implemented in the lab or at the French national reference center for invasive mycoses and Antifungals due to lack or reproducibility of the immunodiffusion test and poor performances in immunocompromised patients [18] However, antigen detection seems more adapted to detect Histoplasma in immunocompromised patients as expected from what is known in patients with invasive aspergillosis [19,20] Nevertheless, systematic review of the detection of antigen in patients with histoplasmosis failed to find studies dealing with large cohort of patients and homogenous group of patients [21]

In this study, a large number of patients (n=907) were screened and it was possible to detect a total of 53 patients with at least one RT-qPCR positive specimen. As a routine diagnostic tool with no implementation of a specific clinical or diagnostic protocol, it was not possible to obtained data from the 854 patients (1135 specimens) with a negative result. It is possible that they could have been diagnosed with a proven histoplasmosis by other means. Nevertheless, as a reference center with an implemented management stewardship of invasive fungal infection in France, suspicion or histoplasmosis cases are referred by clinician or mycologist to us (two referent and 3 referent mycologists) at the reference center. There is little chance that such unusual case in France would have been not referred for the purpose of diagnosis or clinical management, but it cannot be exclude that it could be the cases for rare patients included in this study.

To evaluate the WNA RT-qPCR and evaluate fully this diagnostic tool, inventors strongly argue that a prospective study including the evaluation of conventional diagnosis, but also Histoplasma antigen testing in serum and/or urine should be implemented. This tool will also be used to investigate the rate of decrease of the fungal load under different therapeutic regimens aiming to show that rapid decrease will be associated with better outcome in patients.

Nevertheless, in this setting, i.e. non-endemic region with a high burden of patients originated for endemic regions, or travelers to endemic region with histoplasmosis still considered as a very rare invasive fungal disease, the WNA RT-qPCR plays an important role in confirming the microscopic diagnosis as detected eventually by mycologists or hematologists without waiting for a confirmation on culture. Indeed, as a no-endemic area, inventors consider this organism as a BSL3 organism with the recommendation not to open the tubes of Histoplasmosis suspected patients and investigations were done at the reference center in Institut Pasteur in a BSL3 facility. Based on these results, inventors consider the WNA RT-qPCR as a very useful diagnostic test, which will play a role in the diagnostic and the management of at-risk patients in the future. REFERENCES

1. DARLING ST. A PROTOZOON GENERAL INFECTION PRODUCING PSEUDOTUBERCLES IN THE

LUNGS AND FOCAL NECROSES IN THE LIVER, SPLEEN AND LYMPHNODES. J Amer Med Assoc. 1906;XLVI: 1283-1285. doi:10.1001/jama.1906.62510440037003

2. Kasuga T, White TJ, Koenig G, Mcewen J, Restrepo A, Castaneda E, et al. Phylogeography of the fungal pathogen Histoplasma capsulatum. Mol Ecol. 2003; 12: 3383-3401. doi : 10.1046/j.1365-294x.2003.01995.x

3. SepOlveda VE, Marquez R, Turissini DA, Goldman WE, Matute DR. Genome Sequences Reveal Cryptic

Speciation in the Human Pathogen Histoplasma capsulatum. Mbio. 2017;8: e01339-17. doi:10.1128/mbio.01339-17

4. Almeida-Silva F, de Gongalves D, de Almeida M, Guimaraes AJ. Current Aspects of Diagnosis and Therapeutics of Histoplasmosis and Future Trends: Moving onto a New Immune (Diagnosis and Therapeutic) Era? Curr Clin Microbiol Reports. 2019;6: 98-107. doi:10.1007/s40588-019-00118-3

5. Dantas K, Freitas RS, Moreira A, da Silva M, Benard G, Vasconcellos C, et al. The use of nested Polymerase Chain Reaction (nested PCR) for the early diagnosis of Histoplasma capsulatum infection in serum and whole blood of HIV-positive patients^*. An Bras Dermatol. 2013;88: 141-143. doi:10.1590/s0365- 05962013000100025

6. Muraosa Y, Toyotome T, Yahiro M, Watanabe A, Shikanai-Yasuda M, Kamei K. Detection of Histoplasma capsulatum from clinical specimens by cycling probe-based real-time PCR and nested real-time PCR. Med Mycol. 2016;54: 433-438. doi:10.1093/mmy/myv106

7. Bialek R, Feucht A, Aepinus C, Just-Nubling G, Robertson VJ, Knobloch J, et al. Evaluation of two nested

PCR assays for detection of Histoplasma capsulatum DNA in human tissue. J Clin Microbiol. 2002;40: 1644 1647. doi:10.1128/jcm.40.5.1644-1647.2002

8. heel C, Zhou Y, Theodora RC, Abrams B, Balajee AS, Litvintseva AP. Development of a loop-mediated isothermal amplification method for detection of Histoplasma capsulatum DNA in clinical samples. J Clin Microbiol. 2014;52: 483 488. doi:10.1128/jcm.02739-13

9. da Zatti M, Arantes T, Fernandes J, Bay M, Milan E, Naliato G, et al. Loop-mediated Isothermal Amplification and nested PCR of the Internal Transcribed Spacer (ITS) for Histoplasma capsulatum detection. Plos Neglect Trap D. 2019;13: e0007692. doi: 10.1371/journal pntd.0007692

10. Buitrago M, Berenguer J, Mellado E, Rodriguez-Tudela J, Cuenca-Estrella M. Detection of imported histoplasmosis in serum of HIV-infected patients using a real-time PCR-based assay. European J Clin Microbiol Infect Dis. 2006;25: 665-668. doi:10.1007/s10096-006-0207-y

11 . Gago S, Esteban C, Valero C, Zaragoza 0, de la Bellacasa J, Buitrago M. A Multiplex Real-Time PCR

Assay for Identification of Pneumocystis jirovecii, Histoplasma capsulatum, and Cryptococcus neoformans/Cryptococcus gattii in Samples from AIDS Patients with Opportunistic Pneumonia. J Clin Microbiol. 2014;52: 1168-1176. doi:10.1128/jcm.02895-13

12. Tang Y-W, Li H, Durkin MM, Sefers SE, Meng S, Connolly PA, et al. Urine polymerase chain reaction is not as sensitive as urine antigen for the diagnosis of disseminated histoplasmosis. Diagn Micr Infec Dis. 2006;54: 283-287. doi:10.1016/j.diagmicrobio.2005.10.008

13. Brilhante R, de Guedes G, Riello G, Ribeiro J, Alencar L, Bandeira S, et al. RYP1 gene as a target for molecular diagnosis of histoplasmosis. J Microbiol Meth. 2016;130: 112-114. doi:10.1016/j.mimet.2016.09.006

14. Azar MM, Hage CA. Laboratory Diagnostics for Histoplasmosis. J Clin Microbiol. 2017;55: 1612-1620. doi:10.1128/jcm.02430-16

15. Simon S, Veron V, Boukhari R, Blanche† D, Aznar C. Detection of Histoplasma capsulatum DNA in human samples by real-time polymerase chain reaction. Diagn Micr Infec Dis. 2010;66: 268-273. doi:10.1016/j.diagmicrobio.2009.10.010

16. Babady EN, Buckwalter SP, Hall L, Febre KM, Binnicker MJ, Wengenack NL. Detection of Blastomyces dermatitidis and Histoplasma capsulatum from Culture Isolates and Clinical Specimens by Use of Real-Time PCR †. J Clin Microbiol. 2011 ;49: 3204-3208. doi:10.1128/jcm.00673-11

17. Pauw B, Walsh TJ, Donnelly PJ, Stevens DA, Edwards JE, Calandra T, et al. Revised Definitions of Invasive Fungal Disease from the European Organization for Research and Treatment of Cancer/Invasive Fungal Infections Cooperative Group and the National Institute of Allergy and Infectious Diseases Mycoses Study Group (EORTC/MSG) Consensus Group. Clin Infect Dis. 2008;46: 1813-1821. doi:10.1086/588660

18. de Oliveira F, Fernandes S, Severn C, Guazzelli L, Severn L. Histoplasma capsulatum fungemia in patients with acquired immunodeficiency syndrome: detection by lysis-centrifugation blood-culturing technique. Revista Instituto De Medicina Tropical De Sao Paulo. 2007;49: 135-138. doi:10.1590/s0036- 46652007000300001

19. Kauffman CA. Histoplasmosis: a Clinical and Laboratory Update. Clin Microbiol Rev. 2007;20: 115-132. doi:10.1128/cmr.00027-06

20. Wheat JL, Cloud G, Johnson PC, Connolly P, Goldman M, Monte A, et al. Clearance of Fungal Burden during Treatment of Disseminated Histoplasmosis with Liposomal Amphotericin B versus Itraconazole. Antimicrob Agents Ch. 2001 ;45: 2354-2357. doi:10.1128/aac.45.8.2354-2357.2001

21 . Oladele RO, Ayanlowo OO, Richardson MD, Denning DW. Histoplasmosis in Africa: An emerging or a neglected disease? Plos Neglect Trap D. 2018; 12: e0006046. doi: 10.1371/journal. pntd.0006046

22. Loulergue P, Bastides F, Baudouin V, Chandenier J, Mariani-Kurkdjian P, Dupont B, et al. Literature review and case histories of Histoplasma capsulatum var. duboisii infections in HIV-infected patients. Emerg Infect Dis. 2007;13: 1647 1652. doi: 10.3201/eid1311 .070665

23. Guimaraes A, Nosanchuk JD, Zancope-Oliveira R. Diagnosis of histoplasmosis. Braz J Microbiol.

2006;37: 1-13. doi:10.1590/s1517-83822006000100001

24. Alanio A, Menotti J, Gits-Muselli M, Hamane S, Denis B, Rafoux E, et al. Circulating Aspergillus fumigatus DNA Is Quantitatively Correlated to Galactomannan in Serum. Front Microbiol. 2017;8: 2040. doi:10.3389/fmicb.2017.02040

25. Schwarzinger M, Sagaon-Teyssier L, Cabaret O, Bretagne S, Cordonnier C, Pautas C, et al.

Performance of Serum Biomarkers for the Early Detection of Invasive Aspergillosis in Febrile, Neutropenic Patients: A Multi-State Model. Plos One. 2013;8: e65776. doi: 10.1371/journal pone.0065776

26. Nacher M, Blanchet D, Bongomin F, Chakrabarti A, Couppie P, Demar M, et al. Histoplasma capsulatum antigen detection tests as an essential diagnostic tool for patients with advanced HIV disease in low and middle income countries: A systematic review of diagnostic accuracy studies. Plos Neglect Trap D. 2018; 12: e0006802. doi:10.1371/journal.pntd.0006802

Claims

1. An in vitro method of detecting by reverse transcriptase quantitative PCR (RT-qPCR) on a sample, presence of a nucleic acid molecule contained in the mitochondrial Small Sub- Unit ( mtSSU) gene of Histoplasma capsulatum, or a variant of the mtSSU gene of Histoplasma capsulatum whose sequence has at least 80% identity with SEQ ID NO: 6, or SEQ ID NO: 17 or SEQ ID NO: 18, said method comprising the steps of: a. Providing a sample, in particular a sample suspected of being infected by H. capsulatum, in particular a biological sample suspected of being infected by H. capsulatum, said sample having been previously retrieved from the environment, or obtained from an animal or a human patient, in conditions enabling targeted detection of the whole nucleic acid content of the sample, and b. Carrying a Whole Nucleic Acid (WNA) reverse transcriptase qPCR (RT-qPCR) assay on the sample of a., wherein the target nucleic acid molecule for amplification by the RT-qPCR assay of b. is contained in the mitochondrial Small Sub-Unit ( mtSSU) gene of Histoplasma capsulatum or variant thereof, and, c. detecting whether amplicons of said target nucleic acid molecule sequence are obtained.

2. The in vitro method of claim 1 , wherein the sample is: a. a sample previously retrieved from the environment, or b. a biological sample previously retrieved from an animal subject and obtained from: serum, plasma, whole blood, bodily fluids such as cerebrospinal fluid or synovial liquid, urine, bone marrow aspirate, lymph node aspirate, Broncho- Alveolar Lavage (BAL), tissue biopsie(s), and/or c. a biological sample previously retrieved from a human subject and obtained from: serum, plasma, whole blood, bodily fluids such as cerebrospinal fluid or synovial liquid, urine, bone marrow aspirate, lymph node aspirate, Broncho-Alveolar Lavage (BAL), tissue biopsie(s).

3. The in vitro method of any one of claims 1 to 2, wherein the target nucleic acid molecule contained in the mitochondrial Small Sub-Unit ( mtSSU) gene of Histoplasma capsulatum is represented by SEQ ID NO: 7, or SEQ ID 12 or SEQ ID NO: 16, or SEQ ID NO: 1 , or SEQ ID 14 or SEQ ID NO: 15 or a sequence differing therefrom by up to 3 nucleic acid substitution(s) and/or addition(s) and/or deletion(s), or a fragment thereof.

4. The in vitro method of any one of claims 1 to 3, which further comprises a step wherein the assayed sample is subjected to a nucleic acids extraction protocol involving cells mechanical lysis, in particular through bead beating, for example in zirconium bead tubes prior to Whole Nucleic Acid (WNA) reverse transcriptase qPCR.

5. The in vitro method of any one of claims 1 to 4, wherein the RT-qPCR assay is carried out using the primers pairs:

SEQ ID NO: 13

and SEQ ID NO: 3

, orvariants thereof having at least 80% identity with those sequences, or b. SEQ ID NO: 4 GAT GATGGCT CT GATT GAACG (7F) and SEQ ID NO: 5 AATGTGATCGATCGACCTCT (361 R) variants thereof having at least 80% identity with those sequences.

6. The in vitro method of any one of claims 1 to 5, which further comprises a step of: i. determining whether the obtained amplicons match the sequence of the mitochondrial Small Sub-Unit ( mtSSU) gene of Histoplasma capsulatum and/or match a sequence within the genomes of Histoplasma capsulatum var. capsulatum (Hoc) or Histoplasma. capsulatum var. duboisii (Hod) and/or ii. discriminating whether the obtained amplicons match the sequence of the mitochondrial Small Sub-Unit ( mtSSU) gene from either the Histoplasma capsulatum var. capsulatum (Hoc) or Histoplasma. capsulatum var. duboisii (Hod) genomes.

7. The in vitro method of any one of claims 1 to 6, which further comprises a step of sequencing the amplified nucleic acid sequence(s).

8. The in vitro method of any one of claims 1 to 7, which is for detecting the presence of Histoplasma capsulatum in a biological sample.

9. The in vitro method of any one of claims 1 to 8, which is coupled to an in vitro method of detecting nucleic acid content of Mycobacterium tuberculosis in particular by RT-PCR, which is carried out concomitantly on a same aliquot of sample to be assayed, or in parallel on a separate aliquot of sample to be assayed, in particular where the in vitro method of detecting nucleic acid content of Mycobacterium tuberculosis comprises the steps of: a. Providing a sample, in particular a biological sample suspected of being infected by either H. capsulatum or Mycobacterium tuberculosis, previously retrieved from the environment, or obtained from an animal, or a human patient, and b. Carrying a reverse transcriptase qPCR (RT-qPCR) assay, in particular a Whole Nucleic Acid (WNA) reverse transcriptase qPCR (RT-qPCR) assay, on the sample of a., wherein the target nucleic acid molecule for amplification by the RT-qPCR assay of b. is a sequence for detecting nucleic acid content of Mycobacterium tuberculosis, and c. detecting whether amplicons of said target sequence are obtained.

10. An in vitro method of diagnosing whether an animal or human subject is infected with Histoplasma capsulatum, wherein said method comprises: a. Performing a method according to any one of claims 1 to 9 on a biological sample previously obtained from said animal or human subject, in particular a biological sample suspected of being infected by H. capsulatum, and b. If the Cq value of the WNA RT-qPCR assay of a. is less than 45, concluding that the animal or respectively human subject is infected by Histoplasma capsulatum.

11 . An in vitro method of diagnosing whether an animal or human subject has histoplasmosis, wherein said method comprises: a. Performing a method according to any one of claims 1 to 9 on a biological sample previously obtained from said animal or human subject, in particular a biological sample suspected of being infected by H. capsulatum, and b. If the Cq value of the WNA RT-qPCR assay of a. is less than 45, concluding that the animal or respectively human subject has histoplasmosis.

12. The in vitro method of claim 10 or 11 , wherein the WNA RT-qPCR assay of step a. is followed by a step of sequencing the amplified nucleic acid target sequence, and optionally a further step of comparing the sequenced sequence to known polymorphisms in order to ascertain that the amplified sequenced sequence belongs to a Histoplasma species genome.

13. The in vitro method of claims 10 to 12, which is further for diagnosing or predicting whether an animal or human patient has or is at risk of developing tuberculosis, wherein said method encompasses a step of detecting nucleic acid content of Mycobacterium tuberculosis, in particular according to claim 9, in order to conclude about the presence of tuberculosis or a risk of presence of tuberculosis in the human patient, in particular wherein said method comprises the steps of: a. Performing a method according claim 9 on a biological sample, in particular a biological sample suspected of being infected by either H. capsulatum or Mycobacterium tuberculosis, previously obtained from a patient, and b. From the result of the assay of b. determining whether the animal or human patient has or is at risk of having or developing histoplasmosis, or tuberculosis, or both.

14. An in vitro method for determining the efficacy of a therapeutic active ingredient, or a composition comprising the same, or of a treatment, against histoplasmosis in an animal or human patient who is a Histoplasma capsulatum carrier undergoing therapy with the said active ingredient, or composition comprising the same, or the said treatment, wherein said method comprises the steps of: a. Performing, at least at a first point and a subsequent second point in time, a method according to any one of claims 1 to 9 on a biological sample previously obtained from said animal or human patient, in particular wherein the target nucleic acid molecule for the amplification of the Whole Nucleic Acid (WNA) by reverse transcriptase qPCR (RT-qPCR) assay carried out is SEQ ID NO: 1 , 14 or 15 and b. Comparing the Cq values obtained for the WNA RT-qPCR assays performed at the at least first and second points in time, wherein an increase in the Cq values is indicative that the said active ingredient, or composition comprising the same, or treatment, is efficient for reducing pathogen load and thus for treating or alleviating histoplasmosis in said animal or human patient.

15. Active ingredients) selected amongst: Amphotericin B, deoxycholate Amphotericin B, Liposomal Amphotericin B, Amphotericin B lipid complex, Itraconazole, fluconazole, ketonazole, posaconazole, voriconazole isavuconazole, or methylprednisolone, or corticoid(s), any combination thereof, or composition^) comprising the same, for simultaneous, separate or sequential use for treating, preventing or alleviating histoplasmosis or its symptoms, in an animal or human patient diagnosed as having histoplasmosis, wherein a method according to any one of claims 10 to 13 was performed on a biological sample previously obtained from said patient prior to or during the course of administering the active ingredient(s).

16. Kit for carrying out a method according to any one of claims 1 to 14, comprising: a. A reverse transcriptase polymerase, such as a genetically engineered MMLV Reverse Transcriptase, b. Primer(s) pairs selected amongst SEQ ID NO: 2 or 13 and 3, or SEQ ID NO: 4 and 5, or variants thereof having at least 80% identity with their corresponding reference sequence, c. Optionally, primer(s) appropriate for carrying out a method according to claim 9 or 13, d. Optionally, nucleic acid probe(s), in particular nucleic acid probe(s) hybridizing in stringent conditions with SEQ ID NO: 1 , 14 or 15 or a variant thereof, such as FAM-TGTAGTGGTGTACAGGTGAGT-BHQ1 or a variant thereof having at least 80% identity with the its corresponding reference sequence, e. Optionally, buffer(s) or reagents(s).

17. Use of a kit according to claim 16, for carrying out a method according to any one of claims 1 to 14.

18. Nucleic acid molecule selected amongst: SEQ ID NO: 2, SEQ ID NO: 13, SEQ ID NO: 3,

SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8, or nucleic acid molecule having at least 80% identity over its whole length with SEQ ID NO: 2, SEQ ID NO: 13, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8, respectively, in particular a nucleic acid molecule having at least 80% identity when aligned with SEQ ID NO: 2, SEQ ID NO: 13, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 8 as a reference sequence, with a global alignment tool.