CN106755502B - Primer, probe combination and kit for detecting hyphomycete mildew pathogenic bacteria RT-PCR - Google Patents

Abstract

The invention provides a real-time fluorescent quantitative PCR detection primer and probe combination for hyphomycete mildew pathogenic bacteria and a kit. The nucleotide sequences of the primer and probe combination are respectively shown as SEQ ID NO 1-12. The kit can quickly, specifically, sensitively and stably carry out molecular diagnosis on the hyphomycete pathogenic bacteria. On the basis of establishing a reliable detection system for the hyphomycete mildew pathogenic bacteria, the invention designs a competitive internal reference in a targeted manner and ensures the trueness and credibility of a negative result. Meanwhile, the invention performs some targeted optimization on the DNA extraction scheme and the molecular detection method so as to ensure that pathogenic bacteria in the hyphomycete mildew can be accurately detected.

Description

Primer, probe combination and kit for detecting hyphomycete mildew pathogenic bacteria RT-PCR

Technical Field

The invention belongs to the technical field of microbial detection, and particularly relates to a real-time fluorescent quantitative PCR (RT-PCR) detection primer and probe combination for hyphomycete mildew pathogenic bacteria and a kit.

Background

Phaeohyphomycosis (phaeohyphomycosis) refers to infection of superficial tissues such as skin and subcutaneous tissues, and even deep organs, by a large group of dark fungi. A common feature of these infections is the formation of dark hyphae within the parasitic tissue. There are cases of phaeohyphomycosis, which are reported worldwide, but are mainly concentrated in tropical regions. The phaeohyphomycosis includes light phaeohyphomycosis, phaeomycotic keratitis, phaeohyphomycosis of skin and subcutaneous tissue, and systemic phaeohyphomycosis. Among them, the darkling myceliophthora diseases of skin and subcutaneous tissues are the most common, and the most major pathogenic bacteria are mainly from Exophiala (exophila) and Phosphaera (Pholophora). Among them, pathogenic bacteria of Exophiala including Exophiala dermatitidis, Exophiala jeanselmei, Exophiala echinata and Exophiala verrucosa are common.

Currently, the phaeohyphomycosis of skin and subcutaneous tissues is usually diagnosed by microscopic examination, culture, histopathology and other methods, and is empirically administered in combination with clinical symptoms. Therefore, the development of an accurate molecular diagnosis technology for diagnosing and treating the phaeohyphomycosis is of great significance.

Disclosure of Invention

The invention aims to provide a real-time fluorescent quantitative PCR (RT-PCR) detection primer and probe combination for hyphomycete mildew pathogenic bacteria and a kit.

It is another object of the present invention to provide a method for detecting fusarium oxysporum f.sp.sp.for non-disease diagnostic purposes.

It is a further object of the present invention to provide an improved method for DNA extraction.

In order to achieve the purpose of the invention, the real-time fluorescence quantitative PCR detection primer and probe combination for the hyphomycete mildew pathogenic bacteria comprises the following components:

(I) universal primers and probes for detecting dark fungi including Nostoc, Exophiala, Cladosporium and Chromomyces (SEQ ID NO:1-3)

Panblack-F：5′-CTGATCTGTCCTCCTAATCG-3′

Panblack-R：5′-GCCTGCTTTGAACACTCTAAT-3′

Panblack-P：5′-FAM-ATGCCCTTC[A][C][T]GGGTGT-BHQ1-3′

Wherein [ A ], [ C ] and [ T ] represent locked nucleic acids;

(II) specific primers and probes for detecting Exophiala dermatitidis (SEQ ID NO:4-6)

Eder-F：5′-GTGTTGGACGGTCTGGTC-3′

Eder-R：5′-ATACGTGCTCAGTGAAGAAG-3′

Eder-P：5′-FAM-AATGACGGCGGCCTGGTTGGAC-BHQ1-3′；

(III) specific primers and probes for the detection of Exophiala jeanselmei (SEQ ID NO:7-9)

Ejea-F：5′-CTTCAAACCGTCCTCTGG-3′

Ejea-R：5′-AACAACGGATCTCTTGGTT-3′

Ejea-P: 5 '-FAM-GCCCGCGCTCGTCGGTGG-BHQ 1-3'; and

(IV) specific primers and probes for detecting Chlamydomonas verrucosa (SEQ ID NO:10-12)

PV-F：5′-CTTGCTGCATGTTGCTTTGGC-3′

PV-R：5′-TAGGTTGGCTATCGGCGGAC-3′

PV-P：5′-FAM-GGACCCGTCTCACGACCGCC-BHQ1-3′。

The invention also provides a competitive internal reference template (SEQ ID NO:13-15) and an internal reference probe (SEQ ID NO:17) which are matched with the combination of the primer and the probe.

The invention also provides a kit containing the primer and the probe combination and used for detecting the hyphomycete mildew pathogenic bacteria by real-time fluorescence quantitative PCR.

The kit also comprises competitive internal reference templates Panblack-IAC, Eder-IAC, Ejea-IAC, PV-IAC and an internal reference probe IACP, and the sequence information of the competitive internal reference templates Panblack-IAC, Eder-IAC, Ejea-IAC, PV-IAC and the internal reference probe IACP is as follows:

Panblack-IAC：5′-CTGATCTGTCCTCCTAATCGAGCTGACTTG AACTGACTGGACCTGCCATGATTAGAGTGTTCAAAGCAGGC-3′(SEQ ID NO:13)

Eder-IAC：5′-GTGTTGGACGGTCTGGTCAGCTGACTTGAACT GACTGGACCTGCCATGCTTCTTCACTGAGCACGTAT-3′(SEQ ID NO:14)

Ejea-IAC：5′-GCCTTCAAACCGTCCTCTGGAGCTGACTTGAA CTGACTGGACCTGCCATGAACCAAGAGATCCGTTGTT-3′(SEQ I D NO:15)

PV-IAC：5′-CTTGCTGCATGTTGCTTTGGCAGCTGACTTGAAC TGACTGGACCTGCCATGGTCCGCCGATAGCCAACCTA-3′(SEQ I D NO:16)

IACP：5′-TAMRA-ACTTGAACTGACTGGACCTG-BHQ1-3′(SEQ ID NO:17)。

the kit further comprises at least one of a digestive fluid, a protease K, DNA lysate, glass beads, and the like.

Wherein, the formula of the digestive juice is as follows:

100mM Tris-HCl pH 8.5

20mM EDTA pH 8.0

0.5％ SDS

the formula of the DNA lysate is as follows:

the diameter of the glass beads is 710-1180 mu m, and the acid-washed glass beads with the diameter of 800 mu m are preferred.

The invention also provides a method for detecting hyphomycete disease germs for non-disease diagnostic purposes, comprising the following steps:

1) extracting DNA of a sample to be detected;

2) respectively carrying out real-time fluorescence quantitative PCR amplification by using the extracted DNA as a template and the kit of the invention;

3) analyzing the PCR amplification product.

The preparation of the real-time fluorescent quantitative PCR amplification reaction system is as follows:

(1) the following reagents were prepared in sequence

① PCR mix A, recipe:

② PCR mix B, recipe:

③ PCR mix C, recipe:

④ PCR mix D, formulation:

⑤ PCR mix E, recipe:

(2) preparation of dark fungus detection system

Mixing 15 μ l of PCR mixture A and 13 μ l of PCR mixture B, and adding 2 μ l of DNA template to obtain;

(3) preparation of ectodermic phialide detection system

Mixing 15 μ l of PCR mixture A and 13 μ l of PCR mixture C, and adding 2 μ l of DNA template to obtain;

(4) preparation of detection system for Aureobasidium

Mixing 15 μ l of PCR mixture A and 13 μ l of PCR mixture D, and adding 2 μ l of DNA template to obtain;

(5) preparation of pseudolypocladium verrucosum detection system

Mixing 15. mu.l of PCR mixture A and 13. mu.l of PCR mixture E, and adding 2. mu.l of DNA template.

The real-time fluorescent quantitative PCR amplification reaction program is as follows: 10min at 95 ℃; 95 ℃ 15s, 54 ℃ 20s, 72 ℃ 30s (data collected), for a total of 40 cycles.

In the method, step 3) analyzes whether the sample to be detected contains corresponding trichoderma atroviride pathogenic bacteria according to whether an amplification curve appears or not; the corresponding amplification curve can appear in the sample to be detected containing pathogenic bacteria, and the sample to be detected shows a positive result; the sample to be detected which does not contain pathogenic bacteria does not have an amplification curve or the signal of the amplification curve is always lower than a threshold value, and the result is a negative result.

Because the skin lesion specimen of the hyphomycete disease usually contains more human cells, the invention carries out some targeted optimization on a DNA extraction scheme and a molecular detection method so as to ensure that pathogenic bacteria in the hyphomycete disease are accurately detected.

The invention provides a method for quickly and stably extracting nucleic acid from a tissue specimen, which comprises the following steps:

s1, collecting 100-500mg of skin lesion samples, placing the samples in 800 mu l of digestive juice, adding 50 mu l of 20mg/ml proteinase K, and incubating for 1h at 58 ℃;

s2, 8000g centrifuging for 10min, discarding the supernatant;

s3, adding 700 mu l of DNA lysate into the precipitate;

s4, adding 100mg of acid-washed glass beads, and oscillating for 10min at 30 Hz;

s5, incubation at 95 ℃ for 10min, centrifugation at 10000g, and taking the supernatant as a DNA template.

The above-described method for extracting nucleic acids can be used in step 1) of the method for detecting fusarium solani pathogens for non-disease diagnostic purposes.

The primer, the probe combination and the kit for real-time fluorescent quantitative PCR detection of the hyphomycete pathogenic bacteria can quickly, specifically, sensitively and stably carry out molecular diagnosis on the hyphomycete pathogenic bacteria. On the basis of establishing a reliable detection system for the hyphomycete mildew pathogenic bacteria, the invention designs a competitive internal reference in a targeted manner and ensures the trueness and credibility of a negative result. Meanwhile, the invention performs some targeted optimization on the DNA extraction scheme and the molecular detection method so as to ensure that pathogenic bacteria in the hyphomycete mildew can be accurately detected.

Drawings

FIG. 1 is a diagram showing the alignment of conserved regions of 18S rDNA sequences of dark fungi in example 1 of the present invention.

FIG. 2 is a standard curve of four detection systems in example 3 of the present invention.

FIG. 3 is a graph showing the amplification curve of the Panblack detection system in example 3 of the present invention.

FIG. 4 is an amplification curve of the specific detection system in example 3 of the present invention; wherein, 7 amplification curves respectively correspond to 7 detection samples.

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise indicated, the examples follow conventional experimental conditions, such as the Molecular Cloning handbook, Sambrook et al (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual,2001), or the conditions as recommended by the manufacturer's instructions.

Example 1DNA extraction protocol optimization and design of primers and probes

The dark-colored hyphomycete specimen contains many human cells. Fungal cells and human cells, present a thicker cell wall. Human cells are lysed by proteinase K, but fungal cells are not. Therefore, it is considered that human cells are degraded in advance before DNA extraction, which contributes to an increase in detection rate. This is true in fact. The validation of 7 clinical specimens with the primer probe of Panblack demonstrated that proteinase K pretreatment reduced Ct values by 1-2 cycles when Ct values were greater than 30 (i.e., lower fungal DNA concentrations, samples 4 and 6 of Table 1), as shown in Table 1:

TABLE 1 Effect of proteinase K on the assay results

The optimized method for quickly and stably extracting nucleic acid from the tissue specimen comprises the following steps:

s1, collecting 100-500mg of skin lesion samples, placing the samples in 800 mu l of digestive juice, adding 50 mu l of 20mg/ml proteinase K, and incubating for 1h at 58 ℃;

s2, 8000g centrifuging for 10min, discarding the supernatant;

s3, adding 700 mu l of DNA lysate into the precipitate;

s4, adding 100mg of acid-washed glass beads, and oscillating for 10min at 30 Hz;

s5, incubation at 95 ℃ for 10min, centrifugation at 10000g, and taking the supernatant as a DNA template.

At present, there is no literature on molecular detection of dark fungi. Thus, the 18S rDNA sequences of four genera of species were downloaded from NBCI, including Exophiala (Exophiala attenuata, Exophiala bergeri, Exophiala digitatitis, Exophiala jeanselmei, Exophiala oligosperma, Exophiala spinoera, Exophiala xenobiotica), Podospora (Phycomucosa), Stachybotrys (Fonscoeapedrosoi, Fonscaea monophonia), Cladosporium (Cladophyllophora carriononi). The seqman software alignment was used to find the regions with relatively stable sequences (FIG. 1) for the target sequence detection. Primer selection software is used for primer primary screening (determining a relatively stable segment to set a primer), and an empirical manual correction is assisted to select a region without base variation as an amplification primer.

After the primer is preliminarily selected, calculation is performed by combining ions of the system by the Tm estimation formula using a concentration-dependent approximation method (nearest-neighbor).

The specific formula is as follows:

in the above formula, △ H is the reaction heat, △ S is the entropy change, R is the gas constant, C is the initial concentration of the primer, and M is the total concentration of monovalent cations.

By adjusting the length of the primer and the base at the 5' end, the primer and the probe system tend to be reasonable, and the obtained primer information is as follows:

the general primers and probes for simultaneously detecting dark fungi of the genera of bottle mold, outer vase, cladosporium and chromomyces have the following sequence information:

Panblack-F: GCTGATCTGTCCTCCTAATCG (SEQ ID NO:1) has a Tm of 52.57 DEG C

Panblack-R: GCCTGCTTTGAACACTCTAAT (SEQ ID NO:2) has a Tm value of 51.46 DEG C

Panblack-P: ATGCCCTTC [ A ] [ C ] [ T ] GGGTGT (SEQ ID NO:3) Tm value of 67.8 DEG C

Panblack-P was modified with FAM at 5 'and BHQ1 at 3'.

Similarly, specific primers and probes for Exophiala dermatitidis, Exophiala jeanselmei and Chlamydomonas verrucosa are designed, and the sequence information is as follows:

Eder-F: GTGTTGGACGGTCTGGTC (SEQ ID NO:4) has a Tm value of 52.58 DEG C

Eder-R: ATACGTGCTCAGTGAAGAAG (SEQ ID NO:5) has a Tm of 50.60 DEG C

Eder-P: AATGACGGCGGCCTGGTTGGAC (SEQ ID NO:6) has a Tm value of 64.97 DEG C

Eder-P was modified 5 'with FAM and 3' with BHQ 1.

Ejea-F: caCTTCAAACCGTCCTCTGG (SEQ ID NO:7) has a Tm of 53.39 DEG C

Ejea-R: gtAACCAAGAGATCCGTTGTT (SEQ ID NO:8) has a Tm of 54.06 DEG C

Ejea-P: GCCCGCGCTCGTCGGTGG (SEQ ID NO:9) has a Tm of 63.67 DEG C

Ejea-P was modified 5 'with FAM and 3' with BHQ 1.

PV-F: gaCTGCATGTTGCTTTGGC (SEQ ID NO:10) has a Tm of 52.98 deg.C

PV-R: GTTGGCTATCGGCGGAC (SEQ ID NO:11) has a Tm of 52.70 DEG C

PV-P: GGACCCGTCTCACGACCGCC (SEQ ID NO:12) has a Tm of 62.28 deg.C

PV-P was modified 5 'with FAM and 3' with BHQ 1.

Competitive internal controls (i.e., internal control primers identical to those of the target gene) were set to ensure reliability of negative results, and the internal control template information was as follows:

Panblack-IAC：(SEQ ID NO:13)

CTGATCTGTCCTCCTAATCGagctGACTTGAACTGACTGGACCTGCcatgATTAGAGTGTTCAAAGCAGGC

Eder-IAC：(SEQ ID NO:14)

GTGTTGGACGGTCTGGTCagctGACTTGAACTGACTGGACCTGCcatgCTTCTTCACTGAGCACGTAT

Ejea-IAC：(SEQ ID NO:15)

GCCTTCAAACCGTCCTCTGGagctGACTTGAACTGACTGGACCTGCcatgAACCAAGAGATCCGTTGTT

PV-IAC：(SEQ ID NO:16)

CTTGCTGCATGTTGCTTTGGCagctGACTTGAACTGACTGGACCTGCcatgGTCCGCCGATAGCCAACCTA

the internal reference probe is as follows:

IACP: ACTTGAACTGACTGGACCTG (SEQ ID NO:17), probe 5 'was modified with TAMRA and 3' was modified with BHQ 1.

The designed internal reference system is competitive internal reference, and the primers of the internal reference system and the detection system are completely the same, but the probes are different. Because the same primer is used in the internal reference system and the detection system, the dominant amplification of the primer does not exist (the condition that the system with weaker amplification capability is inhibited because the amplification capability of the internal reference primer is greatly different from that of the detection primer is avoided). Meanwhile, the detection system is not influenced by adding the internal reference template through adding high-concentration internal reference.

Example 2 kit for real-time fluorescent quantitative PCR detection of Trichosporon fuliginosum pathogen

The kit (20 human portions) comprises:

1) DNA extraction tube (20)

The extraction tube is a 2ml centrifuge tube, each tube contains 800 mul of digestive juice, and the digestive juice comprises the following components:

100mM Tris-HCl pH 8.5

20mM EDTA pH 8.0

0.5％ SDS

2) proteinase K (20mg/ml) in one tube, 1 ml; 5G acid-washed glass beads (diameter 710-

3) The formula of the DNA lysate is 2ml, and the components are as follows:

4) PCR mix A (2X premix, 300. mu.l) was formulated as follows:

5) PCR mix B (260. mu.l) with the following formulation:

6) PCR mix C (260. mu.l) with the following formulation:

7) PCR mix D (260. mu.l) with the following formulation:

8) PCR mix E (260. mu.l) with the following formulation:

9) positive control (40. mu.l) was 1 ng/. mu.l of genomic DNA of Exophiala dermatitidis, Exophiala jeansii and Chlamydomonas verrucosa.

The use method of the kit comprises the following steps:

1) DNA extraction:

① the obtained skin lesion sample (200 mg) was placed in 800. mu.l of the digestion solution, and 50. mu.l of proteinase K (20mg/ml) was added thereto, and incubated at 58 ℃ for 1 hour

② 8000g, centrifuging for 10min, and discarding the supernatant;

③ mu.l of DNA lysate is added;

④ adding 100mg acid-washed glass beads (diameter 800 μm), and shaking at 30Hz for 10 min;

⑤ 95 deg.C incubation for 10min, 10000g centrifugation, supernatant.

2) Dark fungus detection:

mixing 15 μ l of PCR mixture A and 13 μ l of PCR mixture B, adding 2 μ l of the DNA template obtained in the previous step, mixing, and operating on a machine.

3) And (3) detecting exopleuropneumoniae dermatitis:

mixing 15 μ l of PCR mixture A and 13 μ l of PCR mixture C, adding 2 μ l of the DNA template obtained in the previous step, mixing, and operating on a machine.

3) Detection of Exophiala jeanserii:

mixing 15 μ l of PCR mixture A and 13 μ l of PCR mixture D, adding 2 μ l of the DNA template obtained in the previous step, mixing, and operating on a machine.

4) And (3) detecting the Vibrio verruciformis:

mixing 15 μ l of PCR mixture A and 13 μ l of PCR mixture E, adding 2 μ l of the DNA template obtained in the previous step, mixing, and operating on a machine.

5) The PCR procedure was:

10min at 95 ℃; {95 ℃ 15sec, 54 ℃ 20sec, 72 ℃ 30sec (data acquisition) }40 cycles.

The kit is suitable for instruments such as ABI 7500/7500Fast/Vii7, Stratagene Mx3000P, Mx3005P, Mx4000, MJ Research chromosome 4, Opticon (II), Corbett rotator Gene 3000 and the like.

Example 3 kit Effect detection

1) Standard curve preparation and sensitivity detection

① construction of plasmid standards

a. A single fragment (finished by Premix TaqTM of TAKARA, the cargo number: R004A) is amplified by four pairs of primers, namely Panblack-F, Panblack-R, Eder-F, Eder-R, Ejea-F, Ejea-R, PV-F and PV-R, and then is connected with a pUC18DNA plasmid vector (TAKARA, the cargo number: 3218), transferred into E.coli DH5 α (TAKARA, the cargo number: 9057) and screened out positive clones by PCR detection, and after the culture of shake bacteria, purified plasmids are extracted by an alkaline lysis method.

b. The plasmid concentration was measured by a Qubit 3.0fluorometer (thermo Fisher scientific) and the copy number of the plasmid was calculated as follows:

c. dilutions were made in different solutions containing the following copy number per microliter: 10⁵、10⁴、10³、10²、10、1。

② construction of a plasmid Standard Curve

The plasmid standard products obtained in the above steps are amplified by four detection systems, the amplification values and amplification curves are shown in table 2, and the standard curve constructed based on the amplification values and amplification curves is shown in fig. 2.

TABLE 2 Ct values of amplified plasmid standards

③ sensitivity determination

From the above data, it can be seen that the detection limit of the four detection systems is 10 copies of plasmid number. Since the target gene to be detected is a multicopy gene (approximately 200 copies per genome). Therefore, theoretically, when a genome exists, it can be effectively identified by the detection system.

2) Stability detection

The same specimen was tested in 96 replicates for the identified clinical specimens, and the results are shown in Table 3.

TABLE 3 stability testing

As can be seen from table 3, four detection systems performed very stably in 96 measurements.

3) And (3) specific detection:

high concentration genomes (5-10 ng/. mu.l) from the following species, for specific detection, in addition to the human genome, were included (11 total species of 32 genus): exophiala (Exophiala dermatitidis, Exophiala echinulata, Exophiala juliensis, Exophiala operbergii, Exophiala alcalophila), Chytridiobolus (Chlamydomonas verrucosa), Achromyces (Fonsecaea monophora, Fonsecaea pelrophora pisoi), Cladosporium (Cladosporium karelini), Trichophyton (Trichophyton rubrum, Trichophyton intertoe, Trichophyton clinorum, Trichophyton purpureum, Trichophyton verruciformis), Microsporum (Microsporum canis, Microsporum gypseum, Microsporum suis, Microsporum ferrugineus, Microsporum persicae, Microsporum tinus, Epidermophyton (Epidermophyton floccosum), Candida (Candida albicans, Candida glabrata, Candida tropicalis, Candida parapsilosis), Aspergillus fumigatus (Aspergillus flavus, Aspergillus terreus, Aspergillus nidus), Penicillium, Nostosporum. Wherein the strains used have previously been characterized by morphological and molecular methods.

The results are as follows:

① Panblack detection system, which can effectively detect Exophiala, Chrysomyiame, Phlomycetes and Cladosporium, but can not detect other fungus species;

② Eder detection system, Ejea detection system and PV detection system, which can effectively detect respective target species, but no product can be amplified by other irrelevant species.

4) Verification of internal reference system

And (3) after a high-concentration internal reference template is added, detecting whether the internal reference influences the target detection. Taking 1-3 clearly known positive clinical specimens, adding high concentration internal reference (10)⁵Copy/system), results are shown in table 4:

TABLE 4 Effect of addition of internal reference on the detection System

As can be seen from Table 4, the Ct value of the internal reference is stabilized at about 24, which proves that the internal reference can be well amplified in the system. Under the premise, the Ct of samples with different concentrations does not show obvious change when the internal reference is added. It can be seen that the internal reference has a substantially negligible effect on the detection.

5) Clinical specimen validation

A total of 7 culture positive clinical specimens were collected clinically, and the test results are shown in table 5 and fig. 3 and 4):

TABLE 5 test results of cultured positive clinical specimens

Wherein Ejea refers to Exophiala jeanselmei, Eder refers to Exophiala dermatitidis, and PV refers to Exophiala verruciformis. The results show that the invention can effectively detect positive clinical specimens, and is suitable for clinical molecular detection of dark fungi.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> infectious disease prevention and control institute of China center for disease prevention and control

Primer, probe combination and kit for detecting hyphomycete disease pathogenic bacteria RT-PCR (reverse transcription-polymerase chain reaction)

<130>KHP171110609.6TQ

<160>17

<170>PatentIn version 3.3

<210>1

<211>20

<212>DNA

<213> Artificial sequence

<400>1

ctgatctgtc ctcctaatcg 20

<210>2

<211>21

<212>DNA

<213> Artificial sequence

<400>2

gcctgctttg aacactctaa t 21

<210>3

<211>18

<212>DNA

<213> Artificial sequence

<400>3

atgcccttc[a][c][t]gggtgt 18

<210>4

<211>18

<212>DNA

<213> Artificial sequence

<400>4

gtgttggacg gtctggtc 18

<210>5

<211>20

<212>DNA

<213> Artificial sequence

<400>5

atacgtgctc agtgaagaag 20

<210>6

<211>22

<212>DNA

<213> Artificial sequence

<400>6

aatgacggcg gcctggttgg ac 22

<210>7

<211>18

<212>DNA

<213> Artificial sequence

<400>7

cttcaaaccg tcctctgg 18

<210>8

<211>19

<212>DNA

<213> Artificial sequence

<400>8

aacaacggat ctcttggtt 19

<210>9

<211>18

<212>DNA

<213> Artificial sequence

<400>9

gcccgcgctc gtcggtgg 18

<210>10

<211>21

<212>DNA

<213> Artificial sequence

<400>10

cttgctgcat gttgctttgg c 21

<210>11

<211>20

<212>DNA

<213> Artificial sequence

<400>11

taggttggct atcggcggac 20

<210>12

<211>20

<212>DNA

<213> Artificial sequence

<400>12

ggacccgtct cacgaccgcc 20

<210>13

<211>71

<212>DNA

<213> Artificial sequence

<400>13

ctgatctgtc ctcctaatcg agctgacttg aactgactgg acctgccatg attagagtgt 60

tcaaagcagg c 71

<210>14

<211>68

<212>DNA

<213> Artificial sequence

<400>14

gtgttggacg gtctggtcag ctgacttgaa ctgactggac ctgccatgct tcttcactga 60

gcacgtat 68

<210>15

<211>69

<212>DNA

<213> Artificial sequence

<400>15

gccttcaaac cgtcctctggagctgacttg aactgactgg acctgccatg aaccaagaga 60

tccgttgtt 69

<210>16

<211>71

<212>DNA

<213> Artificial sequence

<400>16

cttgctgcat gttgctttgg cagctgactt gaactgactg gacctgccat ggtccgccga 60

tagccaacct a 71

<210>17

<211>20

<212>DNA

<213> Artificial sequence

<400>17

acttgaactg actggacctg 20

Claims (10)

1. The real-time fluorescent quantitative PCR detection primer and probe combination for the hyphomycete mildew pathogenic bacteria is characterized by comprising the following components in parts by weight:

(I) universal primers and probes for the detection of darkcoloured fungi of the genera phialomyces, exophialomyces, cladosporium and chromomyces:

Panblack-F：5′-CTGATCTGTCCTCCTAATCG-3′，

Panblack-R：5′-GCCTGCTTTGAACACTCTAAT-3′，

Panblack-P：5′-FAM-ATGCCCTTC[A][C][T]GGGTGT-BHQ1-3′；

wherein [ A ], [ C ] and [ T ] represent locked nucleic acids;

(II) specific primers and probes for the detection of Exophiala dermatitidis:

Eder-F：5′-GTGTTGGACGGTCTGGTC-3′，

Eder-R：5′-ATACGTGCTCAGTGAAGAAG-3′，

Eder-P：5′-FAM-AATGACGGCGGCCTGGTTGGAC-BHQ1-3′；

(III) specific primers and probes for the detection of Exophiala jeanselmei:

Ejea-F：5′-CTTCAAACCGTCCTCTGG-3′，

Ejea-R：5′-AACAACGGATCTCTTGGTT-3′，

Ejea-P: 5 '-FAM-GCCCGCGCTCGTCGGTGG-BHQ 1-3'; and

(IV) specific primers and probes for detecting Chytridiobolus verruciformis

PV-F：5′-CTTGCTGCATGTTGCTTTGGC-3′，

PV-R：5′-TAGGTTGGCTATCGGCGGAC-3′，

PV-P：5′-FAM-GGACCCGTCTCACGACCGCC-BHQ1-3′。

2. A kit for real-time fluorescent quantitative PCR detection of hyphomycete mildew pathogenic bacteria, comprising the primer and probe combination of claim 1.

3. The kit of claim 2, further comprising competitive internal reference templates Panblack-IAC, Eder-IAC, Ejea-IAC, PV-IAC and internal reference probe IACP, the sequence information of which is as follows:

Panblack-IAC：5′-CTGATCTGTCCTCCTAATCGAGCTGACTTGAACTGACTGGACCTGCCATGATTAGAGTGTTCAAAGCAGGC-3′，

Eder-IAC：5′-GTGTTGGACGGTCTGGTCAGCTGACTTGAACTGACTGGACCTGCCATGCTTCTTCACTGAGCACGTAT-3′，

Ejea-IAC：5′-GCCTTCAAACCGTCCTCTGGAGCTGACTTGAACTGACTGGACCTGCCATGAACCAAGAGATCCGTTGTT-3′，

PV-IAC：5′-CTTGCTGCATGTTGCTTTGGCAGCTGACTTGAACTGACTGGACCTGCCATGGTCCGCCGATAGCCAACCTA-3′，

IACP：5′-TAMRA-ACTTGAACTGACTGGACCTG-BHQ1-3′。

4. the kit of claim 2 or 3, further comprising at least one of a digestive fluid, a protease K, DNA lysate, glass beads;

wherein, the formula of the digestive juice is as follows:

100mM Tris-HCl pH 8.5

20mM EDTA pH 8.0

0.5％ SDS

the formula of the DNA lysate is as follows:

the diameter of the glass beads is 710-1180 mu m.

5. The kit according to claim 4, wherein the glass beads are acid-washed glass beads having a diameter of 800 μm.

6. A method for detecting fusarium solani pathogens for non-disease diagnostic purposes comprising the steps of:

1) extracting DNA of a sample to be detected;

2) performing real-time fluorescent quantitative PCR amplification by using the extracted DNA as a template and the kit of any one of claims 2 to 5;

3) analyzing the PCR amplification product.

7. The method as claimed in claim 6, wherein the real-time fluorescent quantitative PCR amplification reaction system in step 2) is prepared as follows:

(1) the following reagents were prepared in sequence

① PCR mix A, recipe:

② PCR mix B, recipe:

③ PCR mix C, recipe:

④ PCR mix D, formulation:

⑤ PCR mix E, recipe:

(2) preparation of dark fungus detection system

Mixing 15 μ l of PCR mixture A and 13 μ l of PCR mixture B, and adding 2 μ l of DNA template to obtain;

(3) preparation of ectodermic phialide detection system

Mixing 15 μ l of PCR mixture A and 13 μ l of PCR mixture C, and adding 2 μ l of DNA template to obtain;

(4) preparation of detection system for Aureobasidium

Mixing 15 μ l of PCR mixture A and 13 μ l of PCR mixture D, and adding 2 μ l of DNA template to obtain;

(5) preparation of pseudolypocladium verrucosum detection system

Mixing 15. mu.l of PCR mixture A and 13. mu.l of PCR mixture E, and adding 2. mu.l of DNA template.

8. The method of claim 7, wherein the real-time fluorescent quantitative PCR amplification reaction procedure in step 2) is as follows: 10min at 95 ℃; data were collected at 95 ℃ for 15s, 54 ℃ for 20s, and 72 ℃ for 30s for 40 cycles.

9. The method according to any one of claims 6 to 8, wherein step 3) is performed by analyzing whether the corresponding trichosporon darkcoloured pathogen is contained in the sample to be tested according to whether the amplification curve is generated; the corresponding amplification curve can appear in the sample to be detected containing pathogenic bacteria, and the sample to be detected shows a positive result; the sample to be detected which does not contain pathogenic bacteria does not have an amplification curve or the signal of the amplification curve is always lower than a threshold value, and the result is represented as a negative result.

10. The method according to any one of claims 6 to 8, wherein step 1) is specifically operated as follows:

s1, collecting 100-500mg of skin lesion samples, placing the samples in 800 mu l of digestive juice, adding 50 mu l of 20mg/ml proteinase K, and incubating for 1h at 58 ℃;

s2, 8000g centrifuging for 10min, discarding the supernatant;

s3, adding 700 mu l of DNA lysate into the precipitate;

s4, adding 100mg of acid-washed glass beads, and oscillating for 10min at 30 Hz;

s5, incubation at 95 ℃ for 10min, centrifugation at 10000g, and taking the supernatant as a DNA template.

Images