CN116173059A - Application of human AURKB gene in preparation of antitumor drugs - Google Patents

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of a human AURKB gene in preparation of antitumor drugs. The invention constructs human AURKB gene small interfering RNA, human AURKB gene interfering nucleic acid construct and human AURKB gene interfering slow virus and discloses the application of the human AURKB gene small interfering RNA and the human AURKB gene interfering slow virus in preparing antitumor drugs. The shRNA or a nucleic acid construct containing the shRNA sequence and the slow virus can specifically inhibit the expression of human genes, especially the slow virus, can efficiently infect target cells, can efficiently inhibit the expression of genes in the target cells, further can inhibit the growth of tumor cells, can promote the apoptosis of the tumor cells, and has important significance in tumor treatment.

Description

Application of human AURKB gene in preparation of antitumor drugs

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of a human AURKB gene in preparation of antitumor drugs.

Background

Esophageal cancers, including Esophageal Adenocarcinoma (EAC) and Esophageal Squamous Cell Carcinoma (ESCC), are malignant tumors that pose a serious threat to human health. Esophageal cancer is the seventh most common cancer worldwide, ESCC accounts for over 90% of esophageal cancers, and advanced stage diagnosis of esophageal cancer has a high mortality rate due to lack of effective diagnostic and therapeutic strategies.

Aurora kinases (AURKs) are protein serine/threonine kinases consisting of three members of the gene family-aurora a (AURKA), aurora B (AURKB) and aurora C (AURKC). AURKA is primarily involved in centrosomal maturation, isolation and bipolar spindle assembly, whereas AURKA is primarily involved in chromosomes during mammalian cell mitosis. AURKB, also known as AIM-1 or Stk-5, forms a chromosomal complex (CPC) with endometrium (INCENP), survivin, borealin/Dasra and other proteins.

At present, no report is found about the application of AURKB gene in preparing anti-esophageal cancer drugs.

Disclosure of Invention

The invention aims to provide an application of human AURKB gene in preparing antitumor drugs.

In order to solve the technical problems, the invention adopts the following technical scheme:

the application of shRNA for inhibiting human AURKB gene in preparing antitumor drugs.

The application of shRNA for inhibiting human AURKB gene in preparing anti-esophageal cancer drugs.

In the above application, the shRNA sequence is:

ShRNA1-F：5’-GATCC GGAGGAGGATCTACTTGATTC TTCAAGAGA GAATCAAGTAGATCCTCCTCC TTTTTG-3’；

ShRNA1-R：5’-AATTCAAAAA GGAGGAGGATCTACTTGATTC TCTCTTGAA GAATCAAGTAGATCCTCCTCC G-3’；

or (b)

ShRNA2-F：5’-GATCC GCAGAAGAGCTGCACATTTGA TTCAAGAGA TCAAATGTGCAGCTCTTCTGC TTTTTG-3’；

ShRNA2-R：5’-AATTCAAAAA GCAGAAGAGCTGCACATTTGA TCTCTTGAATCAAATGTGCAGCTCTTCTGC G-3’；

Or (b)

ShRNA3-F：5’-GATCC GCATTGGAGTGCTTTGCTATG TTCAAGAGA CATAGCAAAGCACTCCAATGC TTTTTG-3’；

ShRNA3-R：5’-AATTCAAAAA GCATTGGAGTGCTTTGCTATG TCTCTTGAA CATAGCAAAGCACTCCAATGC G-3’。

The invention also relates to a preparation method of the anti-esophageal cancer drug, comprising the following steps of preparing a human AURKB gene sequence from Genbank; predicting a plurality of shRNA targets;

screening shRNA targets, and adding a circular sequence into the selected shRNA target sequence to obtain an effective shRNA sequence aiming at AURKB genes;

designing and synthesizing a double-stranded DNA oligonucleotide sequence with enzyme cutting sites at two ends according to the shRNA sequence;

the lentiviral vector is connected with a double-stranded DNA oligonucleotide sequence after double enzyme digestion to construct an RNAi shuttle plasmid for expressing an AURKB gene shRNA sequence;

transforming RNAi shuttle plasmid into competent cells for cloning;

the RNAi shuttle plasmid and helper vector required for lentiviral packaging were co-transfected into human embryonic kidney cells 293T to generate recombinant lentiviral particles.

In the preparation method of the anti-esophageal cancer drug, the lentiviral vector is selected from pLVX-shRNA2-Puro.

The invention has the beneficial effects that: the invention constructs human AURKB gene small interfering RNA, human AURKB gene interfering nucleic acid construct and human AURKB gene interfering slow virus and discloses the application of the human AURKB gene small interfering RNA and the human AURKB gene interfering slow virus in preparing antitumor drugs. The shRNA or a nucleic acid construct containing the shRNA sequence and the slow virus can specifically inhibit the expression of human genes, especially the slow virus, can efficiently infect target cells, can efficiently inhibit the expression of genes in the target cells, further can inhibit the growth of tumor cells, can promote the apoptosis of the tumor cells, and has important significance in tumor treatment.

Drawings

FIG. 1 is a graph showing changes in AURKB expression levels of human esophageal cancer cells KYSE-150 under the prepared lentiviral infection;

FIG. 2 is a graph showing changes in AURKB expression levels of human esophageal cancer cells TE-1 under the prepared lentiviral infection;

FIG. 3 is a graph showing the change in cell proliferation potency of human esophageal cancer cell KYSE-150 under lentiviral infection;

FIG. 4 is a graph showing the change in the proliferation capacity of human esophageal cancer cells TE-1 under the infection of the prepared lentivirus;

FIG. 5 is a graph showing the change in apoptosis level of human esophageal cancer cell KYSE-150 under lentiviral infection;

FIG. 6 is a graph showing changes in apoptosis levels of human esophageal cancer cells TE-1 under the prepared lentiviral infection.

Detailed Description

In order to describe the technical contents, the achieved objects and effects of the present invention in detail, the following description will be made with reference to the embodiments in conjunction with the accompanying drawings.

Studies have shown that CPC plays a central role in mitosis, mediating correction of chromosome-microtubule attachment errors, spindle assembly activation, and regulation of chromosome segregation and cell division. AURKB localizes on the centromere, transitioning from the early to mid-phase end, mainly involved in G2 cell division to the M phase. Previous studies have shown that AURKB can phosphorylate histone H3 on serine 10 (H3S 10) and serine 28 (H3S 28), which is related to chromosome number stability and chromatin condensation during mitosis.

RNA interference (RNAinterference, RNAi) is a natural process mediated by double-stranded RNA to specifically degrade mRNA in cells, thereby causing the expression of the gene of interest to be inhibited or silenced. RNAi technology mainly includes small interfering RNA (small interfering RNA, siRNA), small hairpin RNA (shRNA) and bifunctional shRNA (bi-functional shRNA). shRNA consists of two complementary 19-22bp RNA sequences and a 4-11nt stem loop (loop) that serves to separate the two sequences. shRNA can integrate genome, after transcription, the shRNA is exported into cytoplasm and recognized by endogenous enzyme Dicer, the shRNA is processed into double-stranded siRNA, and then the siRNA is combined with target gene mRNAs and combined with RNA-induced silencing complex, thereby degrading the target gene mRNAs to exert RNA interference effect.

Lentiviral vectors have become one of the most widely used vectors in basic biology, functional genomics and gene therapy. Compared with other retroviruses, the lentivirus has obvious advantages, has relatively wide hosts, has infectivity for both split and non-split cells, has the advantages of short virus preparation period, high infection efficiency and high exogenous gene integration efficiency, and is a method for efficiently introducing exogenous genes.

In the invention, the AURKB gene carried by the vector is transduced into KYSE150 and TE-1 cells by slow virus, so that the AURKB gene is inserted into the genome of the cells and stably expressed, the cell clone inhibiting the expression of the AURKB gene is obtained through screening puromycin, and the cell clone is continuously cultured and passaged to form a stable cell strain inhibiting the expression of the AURKB.

The invention discloses an application of a human AURKB gene and related medicaments thereof. The invention discloses a new application of human AURKB gene in tumor treatment, tumor diagnosis and medicine preparation. The invention further constructs human AURKB gene small interfering RNA, human AURKB gene interfering nucleic acid construct, human AURKB gene interfering lentivirus and discloses the application thereof. The shRNA or the nucleic acid construct and the slow virus containing the shRNA sequence provided by the invention can specifically inhibit the expression of human AURKB genes, especially slow virus, can efficiently infect target cells, can efficiently inhibit the expression of the AURKB genes in the target cells, further inhibit the growth of tumor cells, promote the apoptosis of the tumor cells, and have important significance in tumor treatment.

The invention researches the role of AURKB gene in tumorigenesis and development by taking RNA interference as a means, and discloses a method for inhibiting or reducing the growth, proliferation, differentiation and/or survival of tumor cells, which comprises the following steps: the growth, proliferation, differentiation and/or survival of tumor cells is inhibited by administering to the tumor cells a molecule capable of specifically inhibiting transcription or translation of an AURKB gene, or capable of specifically inhibiting expression or activity of an AURKB protein. The tumor cell is selected from any one of esophagus cancer.

Example 1

The preparation method of the antitumor drug comprises the following steps:

step 1: the human AURKB gene sequence is called from Genbank; predicting a plurality of shRNA targets;

specifically, the nucleotide sequence of human AURKB (NM-004217.4) was queried by logging in the National Center for Biological Information (NCBI) using BLOCK-iT ^TM RNAi Designer software designed 10 pairs of effective shRNA targets for coding sequence regions, as shown in Table 1:

TABLE 1

Step 2: screening shRNA targets, adding a circular sequence, a TTTTT+ enzyme cutting site and the like into the selected shRNA target sequence to obtain an effective shRNA sequence aiming at AURKB genes;

step 3: designing and synthesizing a double-stranded DNA oligonucleotide sequence with enzyme cutting sites at two ends according to the shRNA sequence;

specifically, 3 sequences with the greatest Rank scores (No. 2, no.5, no. 9) are selected from table 1, TTCAAGAGA (circular sequence), ttttttt+ cleavage site is added, and complementary antisense oligonucleotide strand is designed, and double-stranded DNA oligonucleotide sequences containing cleavage site at both ends are annealed and synthesized as shown in table 2;

TABLE 2

/>

Wherein synthesizing a double-stranded DNA oligonucleotide sequence containing cleavage sites at both ends comprises annealing the upstream and downstream fragments of the single-stranded shRNA to form a double-stranded DNA fragment.

The annealing reaction system is shown in table 3:

TABLE 3 Table 3

Annealing reaction procedure: 95 ℃ for 5min; cooling for 1-2h at room temperature.

Step 4: the lentiviral vector is connected with a double-stranded DNA oligonucleotide sequence after double enzyme digestion to construct an RNAi shuttle plasmid for expressing an AURKB gene shRNA sequence;

specifically, the lentiviral vector is selected from the group consisting of pLVX-shRNA2-Puro vector, and the cleavage system of the pLVX-shRNA2-Puro vector is shown in Table 4:

TABLE 4 Table 4

pLVX-shRNA2-Puro vector cleavage conditions: 37 ℃ for 2-3h; identifying by agarose gel, cutting and recovering;

the pLVX-shRNA2-Puro vector is connected with the double-stranded DNA oligonucleotide sequence through an enzyme cutting site, and the shRNA fragment has an adhesive end after enzyme cutting, so that the shRNA fragment can be directly connected with the vector after enzyme cutting.

The vector and gene ligation system after cleavage are shown in Table 5.

TABLE 5

Step 5: transforming RNAi shuttle plasmid into competent cells for cloning;

specifically, the ligated recombinant plasmid was transformed into E.coli competent cell Stbl 3.

The specific operation is as follows:

1) Taking out competent cells Stbl3 (100 μl) from a refrigerator at-80deg.C, rapidly placing on ice, standing for 5min for thawing, and packaging into 2 tubes of 50 μl each;

2) Adding 1 μl of recombinant plasmid (the volume of DNA solution should not exceed 5% of the volume of competent cells, and 50 μl of competent cells can be saturated by 1ng cccDNA), gently shaking and mixing, and placing on ice for 30min;

3) Placing the mixture in a water bath at a temperature of 42 ℃ for 90 seconds for heat shock, rapidly transferring to ice, and starting to time and place for 3 minutes;

4) 900 mu L of non-resistant LB liquid medium is added, the temperature of a constant temperature shaking table is set to 37 ℃, the rotating speed is 200r/min, and the culture is carried out for 1h;

5) Taking 5 culture dishes paved with solid LB-AMP, taking 100 mu L of suspended bacterial liquid, uniformly coating the bacterial liquid by using a glass coating rod burnt by an alcohol lamp, and inversely culturing for 15h and 40 mu L in a constant temperature incubator at 37 ℃;

6) Single colony is selected and inoculated in 15mL (small extract) of LB liquid medium with ampicillin resistance, the temperature of a constant temperature shaking table is set to 37 ℃, the rotating speed is 180r/min, and the culture is carried out overnight;

7) Sequencing bacterial liquid: the sequencing results were aligned using DNAMAN.

8) Plasmid smash: the bacterial liquid with correct sequence is transferred into 10ml LB liquid culture medium containing corresponding antibiotics, cultured overnight at 37 ℃, plasmid extraction is carried out by using a small-extraction medium quantity kit of the day root endotoxin-free plasmid, and the plasmid which is qualified in extraction enters the downstream flow.

Step 6: the RNAi shuttle plasmid and helper vector required for lentiviral packaging were co-transfected into human embryonic kidney cells 293T to generate recombinant lentiviral particles.

Specifically, the AURKB-shRNA interference lentivirus packaging program is as follows:

293T cells were seeded in 10cm-dish at a plating density of about 80% of the cell density before the next day of transfection and cultured in an incubator at 37℃with 5% CO 2. Lentivirus packaging was performed using a third generation lentivirus packaging system (helper plasmid: MDLg/pRRE, pRSV-Rev, pMD2. G), and the following plasmid mix was added to 293T cell dishes for 48 hours and 72 hours, respectively, to collect lentivirus-containing cell supernatants, following Lipofectamine3000 instructions. The plasmid cotranslations are shown in Table 6:

TABLE 6

The cell supernatants collected twice were mixed and centrifuged at 3000g for 25min at 4℃to pellet cell debris, and the supernatant was filtered through a 0.45 μm microporous filter in an ultracentrifuge tube, centrifuged at 100000g for 120min. Pouring out the supernatant, fully dissolving the tube bottom virus by using 1ml of PBS solution, blowing the gun head for a plurality of times, and rapidly storing in a refrigerator at-80 ℃ for a long time after split charging, thereby being used for preparing the anti-tumor medicament, in particular to the use for preparing the anti-esophageal cancer medicament.

Experimental example 1

Q-PCR detection of human esophageal cancer cell AURKB gene interference efficiency;

establishment of stable low-expression cell lines: KYSE-150 and TE-1 human esophageal cancer cells were seeded in 6-well plates. When the cell density reaches 60%, carrying out formal infection experiment by using lentivirus infection MOI and optimal infection condition determined by the pre-experiment, extracting total RNA of cells by using NucleoZol reagent 3-4 days after cell infection, reversely transcribing 1 mug RNA into cDNA by using Promega reverse transcription kit, and carrying out the following steps

The qPCR Mastermix instruction manual detects the relative expression quantity of AURKB, and uses beta-actin as an internal reference to screen stable transformation interference cell lines. AURKB primers were as follows: an upstream primer: 5'-GTGCATCACACAACGAGACC-3', downstream primer: 5'-GCCTGAGCAGTTTGGAGATG-3'; beta-actin primer: an upstream primer: 5'-TGACGTGGACATCCGCAAAG-3', downstream primer: 5'-CTGGAAGGTGGACAGCGAGG-3'. The relative quantitative analysis of the data was performed according to the 2- ΔΔct method, and the calculation formula was as follows (x represents any sample): the relative quantitative analysis of the data was performed according to the 2- ΔΔct method, and the calculation formula was as follows (x represents any sample): ΔΔct= (C _t.Target –C _t.β-actin )X–(C _t.Target –C _t.β-actin ) _Control 。

The reverse transcription system involved above is as follows:

the first stage: denaturing and melting the total RNA; the system is shown in Table 7:

TABLE 7

Adding the reagent according to the above, micro-centrifuging for 10s, mixing, water-bathing at 70deg.C for 5min, and immediately ice-bathing for 5min;

and a second stage: reverse transcription reaction; the system is shown in Table 8;

TABLE 8

Adding the reagent according to the above, and micro-centrifuging for 10s, mixing well, 5min at 25 ℃ and 60min at 42 ℃; and at 70 ℃ for 15min.

The real-time PCR reaction system is shown in Table 9;

TABLE 9

qPCR program settings are shown in table 10;

table 10

Referring to FIGS. 1 and 2, experimental results show that AURKB expression levels in KYSE-150 and TE-1 human esophageal cancer cells were down-regulated, respectively, in comparison with the negative interference group.

Experimental example 2

Detecting proliferation conditions of human esophageal cancer cells in a control group and a sh-AURKB interference group by a CCK-8 method;

KYSE-150 and TE-1 human esophageal cancer cells of different groups were cultured for 24h and then harvested by pancreatin digestion at 4X 10 ⁴ cells/The ml cell concentration was seeded in 96-well plates, and 10. Mu.L of 10% CCK-8 solution was added to each well of cells at four time points of 24, 48, 72 and 96 hours, respectively, and the culture was continued for 2 hours. The absorbance of each well was measured at OD450 nm using an ELISA.

Referring to FIGS. 3 and 4, the experimental results showed that the proliferation ability of KYSE-150 and TE-1 human esophageal cancer cells was reduced in the interference group compared with the control group.

Experimental example 3

Detecting apoptosis of human esophageal cancer cells in a control group and a sh-AURKB interference group by flow cytometry;

KYSE-150 and TE-1 human esophageal cancer cells from different groups were digested with pancreatin, the cells were collected, washed twice with PBS pre-cooled at 4℃and resuspended in 250. Mu.L of binding buffer to a concentration of 1X 10 ⁶ /ml; mu.L of the cell suspension was taken in a 5ml flow tube and 5. Mu.LAnnexinV/Alexa Fluor 647 and 10. Mu.L of a 20. Mu.g/ml propidium iodide solution were added. After mixing, incubation was carried out at room temperature for 15 minutes in the absence of light, 400. Mu.l PBS was added to the reaction tube, and the apoptosis of SGC-7901 was detected by flow cytometry (FACS).

Referring to FIGS. 5-6, experimental results show that the apoptosis levels of KYSE-150 and TE-1 human esophageal cancer cells in the interference group are significantly higher than those in the control group.

The foregoing description is only illustrative of the present invention and is not intended to limit the scope of the invention, and all equivalent changes made by the specification and drawings of the present invention, or direct or indirect application in the relevant art, are included in the scope of the present invention.

Claims (5)

1. The application of shRNA for inhibiting human AURKB gene in preparing antitumor drugs.

2. The application of shRNA for inhibiting human AURKB gene in preparing anti-esophageal cancer drugs.

3. The use of any one of claims 1-2, wherein the shRNA sequence is:

ShRNA1-F：5’-GATCC GGAGGAGGATCTACTTGATTC TTCAAGAGA GAATCAAGTAGATCCTCCTCC TTTTTG-3’；

ShRNA1-R：5’-AATTCAAAAA GGAGGAGGATCTACTTGATTC TCTCTTGAA GAATCAAGTAGATCCTCCTCC G-3’；

or (b)

ShRNA2-F：5’-GATCC GCAGAAGAGCTGCACATTTGATTCAAGAGA TCAAATGTGCAGCTCTTCTGC TTTTTG-3’；

ShRNA2-R：5’-AATTCAAAAA GCAGAAGAGCTGCACATTTGA TCTCTTGAATCAAATGTGCAGCTCTTCTGC G-3’；

Or (b)

ShRNA3-F：5’-GATCC GCATTGGAGTGCTTTGCTATG TTCAAGAGA CATAGCAAAGCACTCCAATGC TTTTTG-3’；

ShRNA3-R：5’-AATTCAAAAA GCATTGGAGTGCTTTGCTATG TCTCTTGAA CATAGCAAAGCACTCCAATGC G-3’。

4. The preparation method of the anti-esophageal cancer drug is characterized by comprising the following steps of preparing a human AURKB gene sequence from Genbank; predicting a plurality of shRNA targets;

screening shRNA targets, and adding a circular sequence into the selected shRNA target sequence to obtain an effective shRNA sequence aiming at AURKB genes;

designing and synthesizing a double-stranded DNA oligonucleotide sequence with enzyme cutting sites at two ends according to the shRNA sequence;

the lentiviral vector is connected with a double-stranded DNA oligonucleotide sequence after double enzyme digestion to construct an RNAi shuttle plasmid for expressing an AURKB gene shRNA sequence;

transforming RNAi shuttle plasmid into competent cells for cloning;

the RNAi shuttle plasmid and helper vector required for lentiviral packaging were co-transfected into human embryonic kidney cells 293T to generate recombinant lentiviral particles.

5. The method for preparing an anti-esophageal cancer drug according to claim 4, wherein the lentiviral vector is selected from the group consisting of pLVX-shRNA2-Puro.

Images