CN108588221B

CN108588221B - Use of STIL gene and related medicine

Info

Publication number: CN108588221B
Application number: CN201810415086.2A
Authority: CN
Inventors: 罗微; 王跃建; 金亚彬; 崔金环; 陈湘萍; 潘英明; 林凯容; 毛小帆
Original assignee: Foshan First Peoples Hospital Foshan Hospital Sun Yat Sen University
Current assignee: Foshan First Peoples Hospital Foshan Hospital Sun Yat Sen University
Priority date: 2018-05-03
Filing date: 2018-05-03
Publication date: 2021-08-24
Anticipated expiration: 2038-05-03
Also published as: CN108588221A

Abstract

The invention provides an application of STIL gene and related drugs thereof. Discloses an application of the STIL gene in the preparation of a reagent or a kit for the auxiliary diagnosis or treatment/prognosis evaluation of nasopharyngeal carcinoma. Further discloses a small interfering RNA target segment of the STIL gene, small interfering RNA of the STIL gene, an RNA interfering nucleic acid construct of the STIL gene, an STIL gene interfering lentivirus, a pharmaceutical composition and a construction method of an RNA interfering lentivirus vector. The siRNA or the nucleic acid construct containing the siRNA sequence and the lentivirus provided by the invention can specifically inhibit the expression of the STIL gene, especially the lentivirus can efficiently infect target cells and efficiently inhibit the expression of the STIL gene in the target cells, so that the growth of tumor cells is inhibited, the apoptosis of the tumor cells is promoted, and the siRNA or the nucleic acid construct containing the siRNA sequence and the lentivirus have important significance in tumor treatment.

Description

Use of STIL gene and related medicine

Technical Field

The invention relates to the technical field of biological medicines.

Background

Nasopharyngeal carcinoma (NPC) is one of the most common malignant tumors in south China, and is also known as "guangdong cancer" in south China, especially in the southern China, where the incidence of diseases is the highest in the Guangdong province and the world is the first. NPC is sensitive to radiation, radiotherapy is the first choice, and the prognosis of the NPC varies greatly due to different stages of the disease. I. The phase II patient has obvious effect of simple radiotherapy, and has high survival rate related to ten years of diseases, no recurrence, no distant metastasis and high survival rate. However, NPC is hidden, and early symptoms lack specificity, and about 75% of patients are diagnosed with stage III and IV. The efficacy of advanced NPC remains quite disappointing, with relapse and distant metastasis, with a 5-year survival rate of only 35%. Therefore, early discovery and early treatment are the key to improve the survival rate of patients with nasopharyngeal carcinoma. The development of nasopharyngeal carcinoma is a dynamic process with multi-factor and multi-gene participation, so that the molecular mechanism of the dynamic development of the nasopharyngeal carcinoma is explored, molecular markers related to the nasopharyngeal carcinoma are searched, the pathogenesis of the nasopharyngeal carcinoma is further determined, a reagent or a product which can be applied to clinical early diagnosis, treatment and prognosis evaluation is developed, and the nasopharyngeal carcinoma dynamic development method has important significance for improving the diagnosis and treatment level of the nasopharyngeal carcinoma and reducing the recurrence and metastasis rate.

RNA interference (RNAi) is a conserved defense mechanism in biological evolution, first discovered in 1998. The essence is the process of inhibiting the expression of the corresponding gene by the specific degradation of mRNA homologous to the double-stranded RNA mediated by the double-stranded RNA. The gene has definite gene inhibition effect, and has the characteristics of cascade amplification effect, high penetrability and the like, so the gene has good application prospect in the research of malignant tumors. Therefore, by producing specific siRNA by an appropriate technique and allowing it to act efficiently on mRNA of a target gene, the objective of gene silencing can be achieved.

The modes of introducing exogenous DNA into eukaryotic cells and performing transcription and expression mainly include cell transfection of non-viral vector systems and cell infection modes using viruses as vectors. The lentivirus vector is a virus vector system which is modified on the basis of human immunodeficiency virus (HIV-I), and can efficiently transfer target genes (or RNAi) into primary cells or cell lines of animals and human beings. Lentiviral-mediated gene expression or RNAi effect is sustained and stable, and the gene of interest can be integrated into the host cell genome, divide with division of the cell genome, and can efficiently infect and integrate into non-dividing cells. In view of the fact that exogenous genes mediated by lentiviral vectors can realize long-term stable expression in animals without causing significant immune response, lentiviral vectors have become powerful tools for studying gene function.

Disclosure of Invention

In order to solve the defects in the prior art, the invention aims to provide the application of the STIL gene in preparing a reagent or a kit for auxiliary diagnosis of nasopharyngeal carcinoma or treatment/prognosis evaluation of nasopharyngeal carcinoma.

The invention also aims to provide a small interfering RNA target fragment of the STIL gene, the sequence of which is shown in SEQ ID No. 1.

The technical scheme adopted by the invention is as follows:

the small interfering RNA of the STIL gene can specifically silence the expression of the STIL gene, takes SEQ ID No. 1 as a target sequence for specifically silencing the expression of the STIL gene, is shRNA and comprises a positive-strand RNA segment and a reverse-strand RNA segment, wherein the positive-strand RNA segment is complementary with the reverse-strand RNA segment, and the positive-strand RNA segment contains RNA coded by SEQ ID No. 1.

Furthermore, the sequence of the small interfering RNA of the STIL gene is RNA encoded by SEQ ID No. 2.

Another objective of the invention is to provide an RNA interference nucleic acid construct of the STIL gene, which comprises the sequence segment of the small interfering RNA of the STIL gene.

Further, the RNA interference nucleic acid construct of the STIL gene is a STIL gene interference lentiviral vector.

The STIL gene interference lentivirus is prepared by carrying out virus packaging on the RNA interference nucleic acid construct of the STIL gene under the assistance of lentivirus packaging plasmids and cell lines.

A pharmaceutical composition comprises a therapeutically effective amount of small interfering RNA of STIL gene or a slow interfering virus of STIL gene, and a pharmaceutically acceptable carrier, diluent or excipient.

The invention also discloses a construction method of the RNA interference lentiviral vector, which comprises the following steps:

1) DNA oligo sequence Synthesis: designing an interference sequence according to a target sequence shown in SEQ ID No. 1, adding AgeI and EcoRI enzyme cutting sites at two ends of the interference sequence, adding a termination signal at the ends, and respectively synthesizing single-stranded DNA oligos shown in SEQ ID No. 2 and SEQ ID No. 3;

2) dissolving the synthesized single-stranded DNA oligo dry powder in an annealing buffer solution with the final concentration of 100M, carrying out water bath at 90 ℃ for 15min, and then naturally cooling to room temperature to form a double chain with a sticky end;

3) ligating the double-stranded DNA oligo to the linearized TM4 phage, the ligation product designated psc 24186;

4) the psc24186 was transformed into E.coli competent cells.

The invention has the beneficial effects that: the invention designs 20 RNAi target sequences aiming at the STIL gene and constructs a corresponding STIL RNAi vector, wherein the RNAi vector psc24186 with a coding sequence SEQ ID No. 1 can obviously reduce the expression of the STIL gene at the mRNA level and the protein level. Lentivirus (Lv) is used as a gene manipulation tool to reduce the expression level of the STIL gene and obviously inhibit the proliferation capacity of nasopharyngeal carcinoma tumor cells.

The siRNA or the nucleic acid construct containing the siRNA sequence and the lentivirus provided by the invention can specifically inhibit the expression of the STIL gene, particularly the lentivirus can efficiently infect target cells and efficiently inhibit the expression of the STIL gene in the target cells, so that the growth of tumor cells is inhibited, the apoptosis of the tumor cells is promoted, and the siRNA or the nucleic acid construct containing the siRNA sequence and the lentivirus have important significance in tumor treatment.

Drawings

FIG. 1 shows a GV115 plasmid DNA map;

FIG. 2 shows an electrophoresis chart for identifying positive clones of RNA interference vectors;

FIG. 3 shows the inhibition of proliferation of nasopharyngeal carcinoma cell line CNE2 after STIL gene interference, wherein a) is the result of absolute number, and b) is the result of fold change;

FIG. 4 is a graph comparing the mRNA expression levels before and after STIL knock-out;

FIG. 5 is a graph showing a comparison result of Western blotting;

FIG. 6 shows the results of Celigo detection of STIL gene depletion on cell proliferation, a) is a graph showing the result of absolute log, and b) is a graph showing the result of fold change;

FIG. 7 shows the results of detecting the decrease of STIL gene on cell proliferation by MTT colorimetry, wherein a) is an absolute number result chart, and b) is a fold-change result chart;

FIG. 8 is a graph showing the results of flow cytofluorescent sorting techniques to detect the effect of STIL gene depletion on a) apoptosis and b) cell cycle;

FIG. 9 is a graph showing the results of animal tumors, in which a) is a graph showing the change in tumor volume and b) is a graph showing the change in tumor weight.

Detailed Description

The present invention will be further illustrated by the following examples, but is not limited thereto. The molecular biology experimental techniques used in the following examples include PCR amplification, plasmid extraction, plasmid transformation, DNA fragment ligation, enzyme digestion, gel electrophoresis, etc., and are usually performed according to conventional methods unless otherwise specified, specifically, see molecular cloning instruction (third edition) (Sambrook J, Russell DW, Janssen K, Argentine J. Huang Peyer et al, 2002, Beijing: science Press), or according to the conditions recommended by the manufacturers.

Example 1: RNA interference target design and double-stranded DNA oligo preparation.

1) Designing an RNA interference target:

according to the design principle of RNA interference sequences, a plurality of 19-21nt RNA interference target sequences are designed by taking the STIL gene as a template. After evaluation and determination by design software, a sequence GATTAAACTGCATGTCATT (SEQ ID No. 1) is selected as an interference target;

2) DNA oligo sequence Synthesis

And designing shRNA interference sequences according to the selected target sequences, and adding appropriate restriction enzyme cutting sites at two ends to complete vector construction. In addition, TTTTT termination signal is added at the 3 'end of the plus strand, and a termination signal complementary sequence is added at the 5' end of the minus strand, and the plus strand is sent to the Czech company to synthesize single-stranded DNA oligo after the design is completed;

CCGG: an AgeI enzyme cleavage site; AATTC: EcoRI enzyme cutting sites; g: EcoRI cleavage site complementary sequence.

3) Preparation of double-stranded DNA oligo:

the synthesized single-stranded DNA oligo dry powder was dissolved in annealing buffer (final concentration 100M) and water-bathed at 90 ℃ for 15 min. After natural cooling to room temperature, a double strand with a sticky end was formed.

Example 2: RNA interference lentivirus vector construction.

1. Connecting:

a20. mu.l reaction was prepared according to Fermentas T4DNA Ligase instructions and the double stranded DNA oligo was ligated to a linearized vector (GV 115 as shown in FIG. 1).

The reaction was carried out at 16 ℃ for 1h-3h, the ligation product was named psc24186, after which the transformation was carried out.

2. And (3) transformation: the ligation product was transformed into E.coli competent cells, the procedure was as follows:

1) add 10. mu.l of ligation product psc24186 to 100. mu.l of E.coli competent cells and ice-wash for 30 min;

2) heat shock at 42 deg.C for 90sec, ice bath for 2 min;

3) adding 500 μ L LB liquid culture medium without antibiotics, shaking and culturing at 200rpm and 37 deg.C for 1 hr;

4) 150 μ l of the bacterial solution was applied evenly to LB solid medium containing Amp and cultured overnight in an incubator at 37 ℃.

3. PCR identification of positive clones:

3.1 primer:

3.2 PCR amplification:

preparing a 20-mu-l PCR reaction system according to the following table, picking a single colony as a template by using a sterile gun head, and carrying out PCR amplification under the reaction conditions that: 3min at 94 ℃; 30s at 94 ℃, 30s at 55 ℃, 30s at 72 ℃ and 22 times of circulation; 5min at 72 ℃. After the PCR was completed, 5. mu.l of the product was taken and subjected to 1% agarose gel electrophoresis to detect bands, and the results of electrophoresis are shown in FIG. 2.

4. Analyzing a positive clone sequencing result:

and (3) carrying out positive clone sequencing by using the identification primer-F, and selecting a clone with a sequencing result completely consistent with a target sequence for the next experiment.

psc24186 sequencing results:

TAGAGAGaTaATTGGAaTTAATTTGACTGTAAACACAAAGAT ATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGT AGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGC TTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTT GTGGAAAGGACGAAACACCGGTGGATTAAACTGCATGTC ATTCTCGAGAATGACATGCAGTTTAATCCATTTTTAATTCTCGACCTCG AGACAAATGGCAGTATTCATCCACGAATTCGGATCCATTAGGCG GCCGCGTGGATAACCGTATTACCGCCATGCATTAGTTATTAATAG TAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTC CGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCC CAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCA TAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAG TATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCAT ATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCC CGCCTGGCATTATGCCCAGTACATGACCTTATG(SEQ ID№7)。

the insert of the shRNA interference sequence is marked with underlined font in which the AgeI cleavage site is disrupted.

Example 3: HCS cell proliferation screening after perturbation.

And (3) primarily screening genes with obvious proliferation inhibition phenotype from the target genes to be detected by comparing the influence of gene knockdown on the cell proliferation speed by using a high content screening method.

Name of cell	Culture medium	Number of HCS 96 wells
			CNE-2Z	1640+10％FBS	2000cell/well

In order to ensure the gene interference efficiency, 3 RNA interference targets are designed for each gene in the experiment, and 3 plasmids carrying different targets are mixed in equal proportion for lentivirus packaging, so that the target gene knockdown efficiency in the subsequent HCS experiment after the virus infects cells is ensured. The list of viruses is as follows:

gene	Virus numbering
		Ctrl	Negative control (Non-targeting shRNA)
PC	Protooncogene X specific-targeting shRNA
		STIL	Psc24185mix
HES6	Psc37542mix
		HIST1H3D	Psc14202mix
RAD51AP1	Psc34535mix
		YBX3	Psc19827mix
CENPN	Psc32095mix
		ARHGAP11A	Psc30053mix
ZWINT	Psc13975mix
		DLGAP5	Psc24130mix
UBE2T	Psc14025mix
		NCAPG	Psc29896mix
CDCA3	Psc14193mix
		YEATS4	Psc27070mix
MND1	Psc24156mix
		MTFR2	Psc24144mix
TRIP13	psc24144mix
		PBK	Psc23271mix
DSCC1	Psc29887mix
		KIFC1	Psc2253mix

PC is a positive target virus, and has over 70 percent of knockdown efficiency on target genes. The gene product of interest plays an important role in the transcription process in mammalian cells. Silencing the target gene can cause remarkable inhibition of cell proliferation in multiple tumor cells, so that the target gene can be used as a positive reference for cell proliferation related experiments to prove the stability of a detection system.

Cell growth curve

According to the fluorescent protein signal expressed after the cells are infected, the cells can be photographed and counted, and the proliferation condition can be observed according to the curve drawn by the cell number.

Fold proliferation change (Ctrl/experimental group):

on the 5 th day of proliferation detection, the Fold change value of the number of times of the Ctrl group (negative control group) cell count compared with the number of times of the test group cell count is used as the judgment basis. When the Fold change is more than or equal to 2.0, the cell proliferation of the experimental group of cells is obviously slowed compared with that of Ctrl group of cells, so that the target genes targeted by the RNAi lentiviruses of the experimental group are inferred to be positive genes related to proliferation.

Summary of HCS screening results

The results of shCtrl, shPC and positive proliferation inhibition group cells are summarized:

1) the HCS screening results show: the proliferation of cells in the Ctrl group is normal, and the proliferation multiple of the cells on the fifth day is 5.29 times that of the cells on the first day; the cell proliferation of the PC group (proliferation inhibition positive control cell group) is obviously slowed down, the proliferation multiple of the fifth day is only 0.82 times compared with that of the first day, and the Fold change of Ctrl is 6.46 compared with that of the fifth day.

2) Of the 19 experimental groups to be tested, the experimental group with the proliferation fold change of 2 or more (proliferation inhibition positive cell group), i.e. the experimental group with positive proliferation inhibition, was: STIL (as shown in FIG. 3).

Example 4: and (5) verifying the gene expression of the tissues beside the cancer.

Selecting 13 pairs of cancer and cancer parasamples, carrying out QPCR detection by using reported 5 genes (CASP3, EGFR, CDK4, JUN and PCNA) as Marker genes, and when the expression conditions of more than 3 Marker genes in the cancer and cancer parasamples are consistent with the report, considering the samples as strong references, when 2 Marker genes are present, considering the samples as weak references, and when the expression conditions are less than 2 Marker genes, not referring, and finally, 13 pairs of 6 in the samples are weak references, and 7 pairs are used as strong references. Thus, the gene of interest, STIL, appears to be upregulated in the 4 versus strong reference and the 3 versus weak reference.

Example 5: interfering with the post-proliferative apoptotic cell cycle.

Lentivirus interference: after 3 days of shRNA lentivirus infection, the expression level of STIL gene in the CNE-2Z cells in the experimental group at the mRNA level was inhibited, as shown in FIG. 4. From the Western Blot results, it can be seen that the target has a significant knock-down effect on the exogenous expression of STIL gene at the protein level, as shown in FIG. 5.

Celigo assay the effect of stir gene depletion on cell proliferation: after 3 days of shRNA lentivirus infection, the proliferation rate of CNE-2Z cells in the experimental group is significantly inhibited, as shown in FIG. 6. Suggesting that the STIL gene is obviously related to the proliferation capacity of CNE-2Z cells.

MTT detects the influence of STIL gene reduction on cell proliferation, and after shRNA lentivirus infection for 3 days, the proliferation rate of CNE-2Z cells in an experimental group is obviously inhibited, as shown in figure 7. Suggesting that the STIL gene is obviously related to the proliferation capacity of CNE-2Z cells.

FACS detects the influence of the STIL gene reduction on apoptosis, and after shRNA lentivirus infection for 3 days, the CNE-2Z cells subjected to apoptosis in an experimental group are remarkably increased, which indicates that the STIL gene is remarkably related to the apoptosis of the CNE-2Z cells, and is shown in a) of figure 8.

FACS detects the influence of the STIL gene reduction on the cell cycle, 5 days after shRNA lentivirus infection, the cells in the S phase of the experimental group are remarkably increased, and the cells in the G1 phase and the G2/M phase of the experimental group are remarkably reduced, which indicates that the STIL gene is remarkably related to the cycle distribution of CNE-2Z cells, and is shown in b) of FIG. 8.

Example 6: animal tumor formation test.

The tumor was significantly reduced in animals following interference with stll, and the results are shown in figure 9.

SEQUENCE LISTING

<110> first-person hospital in Foshan City

Application of <120> STIL gene and related medicine thereof

<130> 2018

<160> 7

<170> PatentIn version 3.5

<210> 1

<211> 19

<212> DNA

<213> unknown

<400> 1

gattaaactg catgtcatt 19

<210> 2

<211> 48

<212> DNA

<213> Artificial sequence

<400> 2

tggattaaac tgcatgtcat tctcgagaat gacatgcagt ttaatcca 48

<210> 3

<211> 58

<212> DNA

<213> Artificial sequence

<400> 3

ccggtggatt aaactgcatg tcattctcga gaatgacatg cagtttaatc catttttg 58

<210> 4

<211> 58

<212> DNA

<213> Artificial sequence

<400> 4

aattcaaaaa tggattaaac tgcatgtcat tctcgagaat gacatgcagt ttaatcca 58

<210> 5

<211> 24

<212> DNA

<213> Artificial sequence

<400> 5

cctatttccc atgattcctt cata 24

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence

<400> 6

gtaatacggt tatccacgcg 20

<210> 7

<211> 653

<212> DNA

<213> Artificial sequence

<400> 7

tagagagata attggaatta atttgactgt aaacacaaag atattagtac aaaatacgtg 60

acgtagaaag taataatttc ttgggtagtt tgcagtttta aaattatgtt ttaaaatgga 120

ctatcatatg cttaccgtaa cttgaaagta tttcgatttc ttggctttat atatcttgtg 180

gaaaggacga aacaccggtg gattaaactg catgtcattc tcgagaatga catgcagttt 240

aatccatttt taattctcga cctcgagaca aatggcagta ttcatccacg aattcggatc 300

cattaggcgg ccgcgtggat aaccgtatta ccgccatgca ttagttatta atagtaatca 360

attacggggt cattagttca tagcccatat atggagttcc gcgttacata acttacggta 420

aatggcccgc ctggctgacc gcccaacgac ccccgcccat tgacgtcaat aatgacgtat 480

gttcccatag taacgccaat agggactttc cattgacgtc aatgggtgga gtatttacgg 540

taaactgccc acttggcagt acatcaagtg tatcatatgc caagtacgcc ccctattgac 600

gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt acatgacctt atg 653

Claims

Application of small interfering RNA of STIL gene in preparation of reagent or kit for treating nasopharyngeal carcinoma.
2. The use of claim 1, wherein the small interfering RNA of STIL gene is RNA encoded by SEQ ID No 2.