CN101956014B - Kit for detecting 7 genetic markers of peripheral blood in early diagnosis of nasopharyngeal darcinoma - Google Patents
Kit for detecting 7 genetic markers of peripheral blood in early diagnosis of nasopharyngeal darcinoma Download PDFInfo
- Publication number
- CN101956014B CN101956014B CN201010502553.9A CN201010502553A CN101956014B CN 101956014 B CN101956014 B CN 101956014B CN 201010502553 A CN201010502553 A CN 201010502553A CN 101956014 B CN101956014 B CN 101956014B
- Authority
- CN
- China
- Prior art keywords
- peripheral blood
- kit
- gene
- fluorescence quantitative
- diagnosis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kit for detecting 7 genetic markers of peripheral blood in early diagnosis of nasopharyngeal darcinoma. The kit comprises a peripheral blood total RNA extracting reagent, RT-PCR reaction liquid, time fluorescence quantitative RT-PCR reaction liquid and an SVM nasopharyngeal darcinoma diagnosis model, wherein the time fluorescence quantitative RT-PCR reaction liquid comprises primers of which the sequences are shown as SEQ IDNO:1-16; the primer sequences are SYBR Green fluorescence quantitative RT-PCR detection primers of the 7 genetic markers and reference gene GAPD; and the 7 genetic markers are HERC5, DLG7, PPARG, PLK1, KIF15, KLHL25 and MYST4. The invention also provides a using method for the kit. The kit has the advantages of high sensitivity, specificity and convenience, and can be used as aided diagnosis and early diagnosis technology for the nasopharyngeal darcinoma.
Description
Technical field
The present invention relates to biology field, relate in particular to a kind of detection kit of 7 gene markers of peripheral blood for nasopharyngeal carcinoma early diagnosis.
Background technology
Nasopharyngeal carcinoma (Nasopharyngeal carcinoma, NPC) is a kind of in the common malignant tumour of south China and south east asia, its progressivity development, and normal generation shifted and spread a little later.At present nasopharyngeal carcinoma mainly relies on radiation treatment, and the prognosis of middle and advanced stage tumour patient is still very poor, and after I phase Patients Treated by Radiotherapy, 5 years survival rates can reach 5 years survival rates of 90%, IV phase patient only 30%, and therefore early discovery is the key that improves curative ratio.It is the important channel of finding early stage nasopharyngeal carcinoma that herbal medicine therapy is carried out to serological screening.Because the change of serological index is conventionally prior to the appearance of clinical symptom, sign.Conventional serological index is VCA-IgA, EA-IgA at present, clinical labororatory often applies the titre of indirect enzyme dyeing process mensuration serum VCA-IgA, EA-IgA antibody nasopharyngeal carcinoma is carried out to auxiliary diagnosis, but still have some patients were EBV serology indices all negative, this type of patient can not be by EBV serological screening out.Simultaneously because VCA-IgA false positive also can cause psychological pressure to Epstein-Barr virus carrier.And imaging examination is mainly used in assisting diagnosis, determining extent of disease at present, accurately by stages, correctly formulate therapy area, design radiation is wild, observe after radiotherapy tumor regression situation and with examining inspection.Therefore,, for examining rate the morning of improving nasopharyngeal carcinoma, be necessary to research and develop new diagnostic method.
The appearance of genome-based technologies makes people can more fully understand the change of gene level in tumour generating process.Chip of expression spectrum technology is applied at first to disease this field of classifying.First Golub research group is applied to this technology in the thin leukemia of acute marrow and the thin leukemic discriminating of acute grain, finds the difference of two kinds of disease express spectras.This method is widely used among the research of mammary cancer, diffuse large B cell lymphoma, colorectal carcinoma, lung cancer, ovarian cancer and malignant melanoma subsequently, and a large amount of significant tumour molecular markers is provided.The express spectra that wherein van ' t Veer etc. has identified 70 genes can be predicted patient's prognosis, and this achievement in research is in conjunction with clinical stages, and histological type has been applied to clinical.Simultaneously share and can effectively predict that the possibility shifting occurs in 5 years patient with other clinical indices, this is the Typical Representative of chip of expression spectrum in clinical diagnosis and predicting function.But these samples are mainly derived from tumor tissues, and the nucleic acid of tumor tissues is difficult for obtaining, utilize Noninvasive detection means to find that the new molecular marker of tumour has become the focus that people are more and more concerned about.The scholars such as Liew propose so-called outpost's principle (Sentinel Principle), be that peripheral blood cells exists unique genetic expression spectral pattern, can reflect the variation of (heredity) and dynamic (impact of environment and disease) that tissue is stable, they are by comparing the gene expression profile of 9 kinds of histoorgans such as peripheral blood cells and heart, liver, kidney, brain, proof peripheral blood can be expressed more than 80% gene of human genome, wherein comprises tissue-specific gene.This just points out us by detecting chip of expression spectrum in peripheral blood, can filter out the gene with diagnostic value, and to use real-time fluorescence quantitative RT-PCR diagnosis of nasopharyngeal carcinoma.
Summary of the invention
In order to overcome above-mentioned technological deficiency, the invention provides a kind of detection kit of 7 gene markers of peripheral blood for nasopharyngeal carcinoma early diagnosis.
The detection kit of 7 gene markers of peripheral blood for nasopharyngeal carcinoma early diagnosis provided by the present invention comprises peripheral blood total RNA extraction reagent, RT-PCR reaction solution, real-time fluorescence quantitative RT-PCR reaction solution and SVM nasopharyngeal carcinoma diagnosis model, described real-time fluorescence quantitative RT-PCR reaction solution comprises primer, the sequence of described primer sequence as shown in SEQ IDNO:1-16, these primer sequences are that the SYBRGreen fluorescence quantitative RT-RCR of 7 gene markers and reference gene GAPDH detects primer, the nucleotide sequence of its upstream primer (sense) and downstream primer (antisense) is composed as follows:
HERC5
Sense：TTTCTTACAGGAACTGACAGACTACAA
Antisense：ATGTCAGTGCTCTTATAGGGTCTCTT
DLG7
Sense：TCCATTTACTCAGCTGGAGAGGA
Antisense：ATCAGGTTACCACCAAAAGAAATGT
PPARG
Sense：GCTTCATGACAAGGGAGTTTCTAA
Antisense：CTGGGCGGTCTCCACTGA
PLK1
Sense：CATCCTCTACAATGATGGTGACAG
Antisense：CGCTCATGTAATTGCGGAAA
KIF15
Sense：GAAAAGTTGCGTGCCGAAAA
Antisense：GCCAGGAGTAGGTCTTACTTGTAAAAG
KLHL25
Sense：GGGCTGTGCACATACCAGTTAC
Antisense：AAGGTCCCACCCCCAAGAG
MYST4
Sense：GAGCCTACCTGTGAGATTGAAGTG
Antisense：AGGGTCAGCATTCTTGAAGCAA
GAPDH
Sense：CTCCTCCTGTTCGACAGTCAGC
Antisense：CCCAATACGACCAAATCCGTT。
Described 7 gene markers are HERC5, DLG7, PPARG, PLK1, KIF15, KLHL25 and MYST4.
PAXgeneTM BloodRNA Kit (QIAGEN, 762174) and the miRNeasy Mini Kit (QIAGEN, 217004) of peripheral blood total RNA extraction reagent in test kit for being provided by QIAGEN company.
The M-MLV reverse transcription test kit (Invitrogen, Carlsbad, CA.C28025-032) that RT-PCR reaction solution in test kit is provided by Invitrogen company.
Real-time fluorescence quantitative RT-PCR reaction solution in test kit comprise ddH2O,
greenqPCR SuperMix with ROX (Invitrogen, Carlsbad, CA) and 7 gene markers and reference gene GAPDH detect and use downstream primer.
The foundation of the SVM nasopharyngeal carcinoma diagnosis model of above-mentioned 7 gene markers composition comprises the following steps:
1) sending the total RNA sample of some routine nasopharyngeal cancer patients and normal people's peripheral blood to carry out the full chip gene expression profile of the mankind detects;
2) filter out the differential gene in nasopharyngeal carcinoma and normal people's peripheral blood with t-testunequal unpaired algorithm;
3) filter out the characterizing gene with discriminating power with SVM feature selection approach;
4) utilize SYBR Green fluorescence quantitative RT-RCR to verify the characterizing gene filtering out;
5) utilize SVM to select suitable kernel function and penalty factor to set up nasopharyngeal carcinoma diagnosis model, and form with canned program can schedule of operation;
Specifically, comprise the steps:
1) serve respectively the routine nasopharyngeal carcinoma of marine life chip companies 20 and the total RNA sample of 20 routine normal people's peripheral blood (dehemoglobinize mRNA) and carry out the full gene oligonucleotide chip of the Agilent mankind (Agilent Whole Human GeneExpression Microarray 4 × 44K array) detection;
2) utilize Quantile method to carry out stdn place a kind of jade to each sample raw data;
3) whether reliably utilize Agilent biochip platform to adopt the variation coefficient (CV) and recall rate to evaluate chip data;
4) utilize GeneSpring 10.0 softwares to adopt t-test unequal unpaired algorithm, by P < 0.05 and difference multiple, the gene more than 1.5 times is defined as differential gene;
5) filter out totally 7 of the characterizing genes with discriminating power by the method for SVM feature selection, and set up the SVM discrimination model being formed by 7 gene markers;
6) whether consistent with chip data with 7 characterizing genes of Real-time PCR checking;
7) utilize SVM to select suitable kernel function and penalty factor to set up nasopharyngeal carcinoma diagnosis model, and with canned program form can schedule of operation.
The using method that the invention allows for mentioned reagent box, comprises the following steps
1) collection of sample blood sample to be detected;
2) the extraction purifying of total RNA in sample blood sample to be detected;
3) RT-PCR: take Olig (dT) as reverse transcriptase primer, total RNA is template, carries out the synthetic cDNA of reverse transcription reaction;
4) SYBR Green fluorescence quantitative RT-RCR detects: utilize cDNA as template, detect primer as primer using the fluorescent quantitation of 7 gene markers claimed in claim 2, carry out real-time fluorescence quantitative PCR reaction, obtain the relative expression quantity of 7 gene markers in peripheral blood sample basis;
5) judgement of sample results to be detected: according to the relative expression quantity of 7 gene markers in sample peripheral blood sample to be detected, utilize SVM nasopharyngeal carcinoma diagnosis model described in claim 3 to draw the diagnostic result of peripheral blood sample.
Specifically, comprise the following steps:
1) collection of sample peripheral blood sample to be detected: use the BD PAXgeneRNA heparin tube of QIAGEN company to collect patient's peripheral blood sample;
2) the extraction purifying of total RNA in sample peripheral blood sample to be detected: use the PAXgene Blood RNA Kit of QIAGEN company and miRNeasy Mini Kit to extract the total RNA in purifying peripheral blood simultaneously, and identify by 1% agarose electrophoresis the total RNA extracting;
3) reverse transcription reaction: use the M-MLV reverse transcription test kit of Invitrigen company, use total RNA for template, take Olig (dT) as reverse transcriptase primer, carry out the synthetic cDNA of reverse transcription reaction;
4) SYBR Green fluorescence quantitative RT-RCR PCR detects: 7 gene markers that provide according to GenBank and the correlated series of reference gene GAPDH, application Primer 5 software designs, select specificity fine through the analysis of BLAST software homology, and can successfully detect the relative expression quantity of 7 gene markers in sample peripheral blood to be detected through experimental identification primer, detect upstream and downstream primer as primer using these 7 gene marker fluorescent quantitations, utilize cDNA as template, carry out real-time fluorescence quantitative RT-PCR reaction, obtain the mRNA relative content of 7 gene markers in peripheral blood sample basis,
5) diagnosis of sample donor result to be detected: according to 7 gene markers in SYBR Green fluorescence quantitative RT-RCR in peripheral blood sample the mRNA relative content in this, utilize us to draw diagnostic result by the SVM nasopharyngeal carcinoma diagnosis prototype software of establishment of laboratory.
Test kit of the present invention has very high susceptibility and specificity; The peripheral blood that this test kit utilization the most easily gathers clinically detects, and is a kind of Noninvasive means; More convenient for detection of comparing with respect to obtaining tumor tissues by operation or conchoscope biopsy; The detected result of this test kit is not affected by EBV yin and yang attribute, can form complementation with existing screening indexes serum VCA-IgA and EA-IgA, can be used as auxiliary diagnosis and the early diagnosis technology of nasopharyngeal carcinoma.
Accompanying drawing explanation
Fig. 1 is SYBR Green quantitative fluorescent PCR proofing chip result;
Fig. 2 is the ROC curve of SVM nasopharyngeal carcinoma discrimination model;
Fig. 3 is the total RNA agarose gel electrophoresis of sample segment figure.
Embodiment
The present invention is based upon in the full chip gene expression profile technical foundation of the mankind, picked out 7 gene markers and set up the SVM nasopharyngeal carcinoma diagnosis model being made up of these 7 gene markers by the method for SVM feature selection, the foundation of this model comprises the following aspects:
The full gene oligonucleotide chip of the 1.Agilent mankind detects
Serve respectively the routine nasopharyngeal carcinoma of marine life chip companies 20 and the 20 total RNA samples of routine normal people's peripheral blood (dehemoglobinize) and carry out the full gene oligonucleotide chip of the Agilent mankind (Agilent Whole Human Gene ExpressionMicroarray 4 × 44K array) detection.
2. the Quantile stdn of chip data
Utilize Quantile method to carry out standardization (Biochip company completes by Shanghai) to each sample raw data, obtain the P value of each gene in each gene normal people/rhinitis carninomatosis people's difference multiple and these two groups of samples.
3. chip data fail-safe analysis
Utilize Agilent biochip platform to adopt the variation coefficient (CV) and recall rate to evaluate the reliability of chip data, judgement criteria be CV be less than 15% and recall rate be greater than 65% for reliable, evaluation result is chip detection reliable results.
4. differential gene screening
Utilize GeneSpring 10.0 softwares to adopt t-test unequal unpaired algorithm, by P < 0.05 and difference multiple, the gene more than 1.5 times is defined as differential gene, filter out altogether 1257 probes (raise 687, lower 570).
5. characterizing gene screening and SVM discrimination model are set up
From above-mentioned differential gene, filter out totally 7 of the characterizing genes with discriminating power by the method for SVM feature selection, with 100 routine modelings and 60 routine samples checkings, wherein get penalty coefficient C=1000 and nuclear parameter=9, concrete steps are as follows:
1) select suitable kernel function (being generally gaussian radial basis function kernel function RBF), set the parameter of penalty factor and kernel function;
2) training sample set is mapped to from lower dimensional space to higher dimensional space, by kernel function skill, the sample of Nonlinear separability is transformed into and in higher dimensional space, makes its linear separability;
3) still can not linear separability learning sample to be sorted if be mapped to after higher dimensional space lineoid, can adopt the method at soft interval that learning sample is separated as much as possible.This method has been introduced slack variable ξ
i, can regulate slack variable ξ
isize make training set sample meet classification lineoid constraint condition;
4) adopt Lagrange (Lagrange) multiplier method can obtain Lagrangian the optimization problem that solves optimum lineoid, and then convert former optimization problem to its Wolfe dual form;
5) solve the solution of above-mentioned optimization problem, draw corresponding support vector and classification lineoid decision function threshold value b °;
6) utilize classification lineoid decision function to differentiate the checking sample of unknown label, draw the prediction label of sample to be sorted, predictor is greater than 0 and is judged to be normal people, is less than 0 and is judged to be rhinitis carninomatosis people.
7 gene markers of 6.SYBR Green fluorescence quantitative RT-RCR checking
While utilizing chip detection, the total RNA of 40 Patients with Peripheral blood samples used in this carries out SYBR Green fluorescence quantitative PCR detection, and Fig. 1 is SYBR Green quantitative fluorescent PCR proofing chip result.As seen from Figure 1, the Real-time PCR the result of these 7 gene markers is consistent with chip results, can be used for building nasopharyngeal carcinoma diagnosis model.
7. identify the discriminating power of SVM nasopharyngeal carcinoma diagnosis model
In the training set of 128 routine sample compositions, utilize SVM nasopharyngeal carcinoma diagnosis model draw the predictor of each detection sample and draw diagnostic result, and diagnostic result and the pathological diagnosis result of the SVM diagnostic model that we are set up compare, obtain susceptibility, specificity, positive predictive value and the negative predictive value of SVM model, the results are shown in Table 1, table 1 is 7 gene marker diagnostic kits diagnostic result in 60 routine samples in the peripheral blood of real-time fluorescence quantitative RT-PCR diagnosis of nasopharyngeal carcinoma; Obtain the ROC curve of this model simultaneously, see Fig. 2.As seen from Figure 2, the AUC of this model ROC curve is 0.82111, and this model has higher classification accuracy rate.
Table 1
Susceptibility: 83.3% specificity: 76.6%
Positive predictive value: 78.1% negative predictive value: 82.1%
ROC Area：82.1％
Youden index: 0.599 LR+:3.56
Introduce respectively mentioned reagent box and specifically use step by specific embodiment below.
One. experimental technique
1. 7 gene markers that provide according to GenBank and the correlated series of reference gene GAPDH, application Primer 5 software designs, selected the good SYBR Green of specificity fluorescent quantitation to detect primer through the analysis of BLAST software homology, its nucleotide sequence is composed as follows:
HERC5
Sense：TTTCTTACAGGAACTGACAGACTACAA
Antisense：ATGTCAGTGCTCTTATAGGGTCTCTT
DLG7
Sense：TCCATTTACTCAGCTGGAGAGGA
Antisense：ATCAGGTTACCACCAAAAGAAATGT
PPARG
Sense：GCTTCATGACAAGGGAGTTTCTAA
Antisense：CTGGGCGGTCTCCACTGA
PLK1
Sense：CATCCTCTACAATGATGGTGACAG
Antisense：CGCTCATGTAATTGCGGAAA
KIF15
Sense：GAAAAGTTGCGTGCCGAAAA
Antisense：GCCAGGAGTAGGTCTTACTTGTAAAAG
KLHL25
Sense：GGGCTGTGCACATACCAGTTAC
Antisense：AAGGTCCCACCCCCAAGAG
MYST4
Sense：GAGCCTACCTGTGAGATTGAAGTG
Antisense：AGGGTCAGCATTCTTGAAGCAA
GAPDH
Sense：CTCCTCCTGTTCGACAGTCAGC
Antisense：CCCAATACGACCAAATCCGTT
2. the collection of peripheral blood sample to be detected
Use BD PAXgene RNA heparin tube (BD, 762165) to collect peripheral blood sample 193 examples to be detected, the concrete steps that this experiment blood sample is collected comprise:
1) BD PAXgene RNA heparin tube being placed to room temperature (18 ℃-25 ℃) preserves;
2) prepare blood taking needle and BD PAXgene RNA heparin tube;
3) gather 2.5ml blood with BD PAXgene RNA heparin tube;
4) while blood sampling, to prevent the refluence of BD PAXgene RNA blood sampling liquid in pipe;
Patient's arm is placed and is applicable to position, when blood sampling, BD PAXgene RNA heparin tube is vertically placed, lower than patient's arm plane, unclamp blood sampling band, allow blood automatically flow in BD PAXgene RNA heparin tube, note BD PAXgene RNA blood sampling liquid in pipe not being blowed back in patient body;
5) when blood stopped flowing out after 10 seconds, BD PAXgene RNA heparin tube is taken off.BD PAXgene RNA heparin tube is negative-pressure design, can automatic sucking 2.5ml blood.After finishing, blood sampling immediately BD PAXgene RNA heparin tube is turned upside down 8-10 time;
6), by the upright placement of BD PAXgene RNA heparin tube, room temperature (18 ℃-25 ℃) is placed 2 hours.
7) put into 4 ℃ of Refrigerator stores, in transportation, will be kept in the middle of 4 ℃ of ice chests;
8), if not needing to transport room temperature places after 2 hours and can carry out the extraction of RNA, first BDPAXgene RNA heparin tube is placed in to-20 ℃ of refrigerators and preserves and after 24 hours, proceed to-80 ℃ of Refrigerator stores if need to preserve.
3. the extraction purifying of the total RNA of peripheral blood sample to be detected
This experiment is used the PAXgene of QIAGEN company simultaneously
tMblood RNAKit (QIAGEN, 762174) and miRNeasy Mini Kit (QIAGEN, 217004) extract the total RNA of peripheral blood, and concrete steps comprise;
1) the centrifugal PAXgene RNA of room temperature 5000rpm heparin tube 10 minutes;
2) careful supernatant discarded, adds the water of 4ml without RNA enzyme, covers tightly Jiao Gai;
3) on vortex vibrator, again will precipitate and hang, centrifugal 10 minutes of room temperature 5000rpm, careful supernatant discarded;
4) add the resuspended buffer of 350 μ l (BR1), hanged precipitation with pipettor, mix until without visible precipitate;
5) resuspended liquid is moved in 1.5mlEP pipe, adds 300 μ l binding buffer liquid (BR2) and 40 μ l Proteinase Ks, on vortex vibrator, shook for 5 seconds, EP pipe is placed in to 55 ℃ of shaking baths among 400-1400rpm hatch 10 minutes;
6) aforesaid liquid is moved to PAXgene Shredder spin column (PSC), centrifugal 3 minutes of room temperature 12000rpm;
7) carefully with pipettor, supernatant is moved in new 1.5EP pipe, be not drawn onto the precipitation at the bottom of centrifuge tube;
8) liquid in EP pipe is on average divided in 2 EP pipes, adds 875 μ l dehydrated alcohols (96-100%, analytical pure) in every pipe, fastening lid turns upside down 8-10 time, briefly centrifugal, makes liquid all be collected in the pipe end;
9) first 700 μ l liquid are moved in RNeasy mini spin column post, centrifugal 1 minute of room temperature 12000rpm, discard the filter liquide in collection tube, in RNeasy mini spin column post, continue to add 700 μ l liquid room temperature 12000rpm centrifugal 1 minute;
10) by liquid all centrifugal complete after, discard collection tube and liquid wherein;
11) add in 350 μ l Buffer RWT to RNeasy spin column posts, cover lid gently, centrifugal 15 seconds of room temperature 12000rpm, discards the liquid after centrifugal;
12) 10 μ l are added DNA enzyme (DNase I stock solution) add in 70 μ l RDD, turn upside down 8-10 time gently, briefly centrifugal;
13) above-mentioned 80 μ l liquid are directly splashed into the central authorities of RNasy spin column post, room temperature is placed 15 minutes to remove DNA;
14) add in 350 μ l Buffer RWT to RNeasy spin column posts, cover lid gently, centrifugal 15 seconds of room temperature 12000rpm, discards the liquid after centrifugal;
15) add in 500 μ l Buffer RPE to RNeasy spin column posts, cover lid gently, centrifugal 15 seconds of room temperature 12000rpm, discards the liquid after centrifugal;
16) add in 500 μ l Buffer RPE to RNeasy spin column posts, cover lid gently, centrifugal 2 minutes of room temperature 12000rpm, discards the liquid after centrifugal;
17) RNeasy spin column post is moved in a new collection tube to centrifugal 1 minute of room temperature 12000rpm;
18) RNeasy spin column post is moved in the new EP pipe without RNA enzyme, add 30 μ l to remove the water of RNA enzyme to the central authorities of film, leave standstill after 1 minute room temperature 12000rpm centrifugal 1 minute;
19) 30 μ l after centrifugal are splashed into the central authorities of film again containing RNA solution, repeating step 18 once;
20) RNA that extracting is good analyzes RNA concentration by ultraviolet spectrophotometer, 260 and 280nm measure absorbancy and determine concentration and the purity of sample, A260/A280 should approach 2.0 for purer RNA (ratio 1.9-2.1 also can), pass through agarose electrophoresis, detect RNA28S, 18S, the integrity of detection RNA.A260/A280 be greater than 1.90 and the ratio of the electrophoretic band of 28S and the electrophoretic band of 18S think that 2: 1 left and right RNA quality inspection is qualified, if the electrophoretic band of 28S and the ratio of the electrophoretic band of 18S are less than 1 and exist a large amount of 5S bands to think that degraded or Partial digestion appear in RNA, RNA quality inspection is defective.
4. reverse transcription reaction
Use the M-MLV reverse transcription test kit (Invitrogen of Invitrigen company, Carlsbad, CA.C28025-032), Oligo for by specification (dT) is reverse transcriptase primer, get the total RNA of 0.5 μ g and carry out reverse transcription, reverse transcription system totally 20 μ l operates on ice, and configuration scheme is as follows:
Totally 10 μ l systems complete denaturation process in PCR instrument, 65 ℃ of 5min, 4 ℃ of 1min at least; Take out reaction system and be placed in immediately on ice, configure immediately following reaction system:
Add each 10 μ l in the EP pipe that mark is good, in PCR instrument, complete following steps:
37 ℃ of extension 50min of 25 ℃ of annealing 10min; 70 ℃ of termination reaction 15min; The cDNA packing that 4 ℃ of forever record above-mentioned reverse preserve-20 ℃ for subsequent use.
5. real-time fluorescence quantitative PCR (Real-time PCR) reaction
The cDNA that gets 10ng with
green qPCR SuperMix with ROX (Invitrogen, Carlsbad, CA) carries out real-time fluorescence quantitative PCR reaction, and 10 μ l reaction systems are as follows:
In real-time fluorescence quantitative PCR instrument (7900HT Fast Real-Time PCR System, Applied Biosystems, USA), complete following PCR process: the first step, 50 ℃ of 2min; Second step, 95 ℃ of denaturation 10min; The 3rd step, 95 ℃ of sex change 15sec, 60 ℃ of annealing with extend 1min, inferior step repeats 40 circulations.Solubility curve elementary reaction process: 95 ℃ of 15sec, 60 ℃ of 15sec, 95 ℃ of 15sec.Utilize solubility curve to observe to have or not dimer to occur and primer whether special, utilize amplification curve to observe the situation of product amplification.
6.Real-time PCR interpretation of result
Genetic expression value is calculated by the method for Delta Ct, hypothesis goal and reference gene amplification efficiency all approach 100% and relative deviation be no more than 1Ct; Δ Ct=goal gene CT mean-reference gene GAPDH CT mean; The relative expression quantity of goal gene is=2
-Δ Ct
7. result diagnosis
The relative expression quantity of 7 gene markers in sample peripheral blood to be detected is imported in the SVM model that we set up, draw predictor, wherein predictor is greater than 0 and is judged to be Nasopharyngeal Carcinoma Patients, is less than 0 and is judged to be normal people
Two. result
1. peripheral blood sample to be detected extracts concentration and the quality inspection result of total RNA
Extract respectively the total RNA of purifying with the peripheral blood method for extracting total RNA to be detected in above-mentioned steps 3, measure concentration and adopt 1% sepharose to carry out electrophoresis detection to the total RNA extracting by ultraviolet spectrophotometer, representational electrophoresis result as shown in Figure 3, in the 193 routine blood samples that Fig. 3 result shows altogether to collect at us, there are 160 routine quality inspections qualified.
2. real-time fluorescence quantitative RT-PCR detected result
Adopt step 1,4,5 testing conditions, utilize real-time fluorescence quantitative PCR to detect the relative expression quantity of 7 gene markers in 128 Patients with Peripheral blood samples bases, the relative expression quantity of 7 gene markers of part peripheral blood sample to be detected is in table 2.Table 2 is that 7 gene markers utilize the relative expression quantity of real-time fluorescence quantitative RT-PCR in 21 routine samples.
Table 2
sample ID DLG7 HERC5 KIF15 KLHL25 MYST4 PLK1 PPARG
245N -9.63275 -6.14797 -12.9488 -8.73773 -6.2762 -7.8321 -11.424
246N -10.5411 -3.84481 -10.6825 -8.40598 -6.02662 -7.51958 -13.6739
249N -8.84851 -2.28473 -10.0054 -8.74988 -5.92592 -7.30188 -11.8067
250N -6.89907 -2.88941 -8.8747 -7.91521 -5.15156 -8.62095 -11.3441
251N -7.96687 -2.9414 -10.3947 -7.91141 -5.20621 -8.5137 -11.8386
253N -8.61895 -2.76431 -14.0459 -8.2471 -5.49629 -8.00587 -11.1182
253N -9.75357 -4.51152 -12.1569 -7.77648 -5.14216 -7.36495 -7.1607
254N -10.246 -4.33283 -9.60099 -7.19688 -5.6933 -7.26334 -11.7167
255N -6.98285 -2.4603 -13.0917 -8.21804 -3.81378 -8.33888 -12.9491
286A -10.4316 -4.01077 -9.59847 -9.16007 -6.34879 -8.27269 -13.4484
292A -10.8484 -2.71021 -10.4234 -9.11477 -6.51336 -8.29897 -12.351
X315A -10.261 -2.40335 -9.17933 -8.72617 -5.86805 -7.85801 -11.9828
290A -8.50984 -4.61881 -13.9344 -9.12934 -4.63738 -8.26637 -12.8307
295A -5.7753 -2.42522 -11.8134 -9.45148 -3.93666 -8.21373 -10.8093
Q2149A -9.05609 -3.60027 -11.9244 -8.05503 -5.18967 -7.93216 -11.4298
Q2304A -8.64905 -1.79376 -12.4209 -8.80572 -5.91699 -6.97031 -10.2746
W1317A -9.28648 -1.59159 -13.2774 -8.0039 -5.32719 -7.45794 -9.95548
244A -9.91415 -4.12282 -12.4789 -8.58479 -6.23197 -7.79324 -10.6035
C305A -9.30214 -1.70409 -12.7773 -8.9345 -5.75611 -7.51454 -11.3477
T2325A -9.42673 -3.70955 -12.5497 -8.47398 -5.96041 -7.69738 -11.4079
291A -9.98792 -1.47794 -14.1254 -8.09047 -5.47992 -7.61917 -8.02616
3. real-time fluorescence quantitative RT-PCR nasopharyngeal carcinoma diagnosis test kit diagnostic result is analyzed
The relative expression quantity of 7 gene markers of sample to be detected every example is imported in the SVM model of our foundation, draw the predictor of each detection sample and draw diagnostic result (part diagnostic result is in table 3, and table 3 is SVM nasopharyngeal carcinoma diagnosis model diagnostic results in 15 routine nasopharyngeal carcinoma samples); Diagnostic result and the pathological diagnosis result of the SVM diagnostic model of simultaneously this laboratory being set up compare, and show that the accuracy of this SVM discrimination model diagnosis of nasopharyngeal carcinoma reaches 80%.
Table 3
Sample predicts knot
ID HERC5 KIF15 KLHL25 MYST4 PPARG DLG7P LK1 predictor fruit
868A 0.19927 0.00024 0.0037 0.0258 0.00054 0.00196 0.00555 0.059207 NPC
323A 0.05129 0.00024 0.00174 0.0149 0.0128 0.00119 0.0019 0.114853 NPC
951A 0.08563 0.00027 0.00498 0.0403 0.00075 0.00161 0.00791 0.06154 NPC
899A 0.13348 0 0.00465 0.0238 0.00052 0.00187 0.00254 0.062789 NPC
1677A 0.05427 0.00031 0.00206 0.021 0.0006 0.00095 0.00307 0.012505 NPC
1643A 0.0237 0.00025 0.00333 0.0356 0.00082 0.00169 0.00797 0.063197 NPC
1092A 0.05877 4.7E-05 0.00257 0.0176 0.00023 0.0008 0.00201 -0.04095 Normal
Z1556A 0.28676 0.0003 0.00309 0.0254 0.00051 0.00525 0.00238 0.062997 NPC
Z1878A 0.29429 9.8E-05 0.00224 0.0188 0.00068 0.00068 0.00516 0.057952 NPC
1688A 0.05102 0.00108 0.00201 0.0232 0.00062 0.00075 0.00361 0.062997 NPC
1924A 0.03851 2.7E-05 0.00163 0.0268 0.00071 0.00055 0.00412 0.071208 NPC
1164A 0.03916 0.00022 0.00537 0.0322 0.00545 0.001 0.00358 0.055237 NPC
1776A 0.01842 8.3E-05 0.00164 0.0152 0.00584 0.00087 0.00383 0.112238 NPC
Q2304A 0.28847 0.00019 0.00226 0.0166 0.01581 0.0025 0.00799 0.063384 NPC
1458A 0.05548 0.00011 0.00144 0.0172 0.00039 0.00063 0.00058 0.258697 NPC
In the peripheral blood that utilizes real-time fluorescence quantitative RT-PCR diagnosis of nasopharyngeal carcinoma of the present invention, 7 gene marker diagnostic kits have very hypersensitivity, specificity; With obtain by operation or conchoscope biopsy tumor tissues for detection of compared with more convenient, and be Noninvasive detection means; Diagnostic result is not affected by EBV yin and yang attribute, can form complementation with existing screening indexes serum VCA-IgA and EA-IgA; Can make the patient without obvious clinical symptom obtain early examining.Therefore the present invention has made significant headway in exploration nasopharyngeal carcinoma diagnosis novel method field, can be used as auxiliary diagnosis and the early diagnosis technology of nasopharyngeal carcinoma.
Claims (2)
1. the detection kit for 7 gene markers of peripheral blood of nasopharyngeal carcinoma early diagnosis, it is characterized in that, reaction solution, real-time fluorescence quantitative RT-PCR reaction solution that described test kit comprises peripheral blood total RNA extraction reagent, reverse transcription PCR, the detection primer that described real-time fluorescence quantitative RT-PCR reaction solution comprises 7 gene markers and reference gene GAPDH, the sequence of described primer sequence as shown in SEQ ID NO:1-16.
2. test kit according to claim 1, is characterized in that, described 7 gene markers are HERC5, DLG7, PPARG, PLK1, KIF15, KLHL25 and MYST4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010502553.9A CN101956014B (en) | 2010-09-30 | 2010-09-30 | Kit for detecting 7 genetic markers of peripheral blood in early diagnosis of nasopharyngeal darcinoma |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010502553.9A CN101956014B (en) | 2010-09-30 | 2010-09-30 | Kit for detecting 7 genetic markers of peripheral blood in early diagnosis of nasopharyngeal darcinoma |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101956014A CN101956014A (en) | 2011-01-26 |
| CN101956014B true CN101956014B (en) | 2014-05-28 |
Family
ID=43483599
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201010502553.9A Active CN101956014B (en) | 2010-09-30 | 2010-09-30 | Kit for detecting 7 genetic markers of peripheral blood in early diagnosis of nasopharyngeal darcinoma |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101956014B (en) |
Families Citing this family (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103205482A (en) * | 2012-01-11 | 2013-07-17 | 舍尔辛格 | Plasticizer tracking biomarker, plasticizer tracking genetic chip, and plasticizer tracking biomarker confirmation method |
| SG11201406837TA (en) | 2012-05-04 | 2014-11-27 | Novartis Ag | Biomarkers for iap inhibitor therapy |
| CN105219844B (en) * | 2015-06-08 | 2018-12-14 | 华夏京都医疗投资管理有限公司 | Gene marker combination, kit and the disease risks prediction model of a kind of a kind of disease of screening ten |
| CN105603086B (en) * | 2016-02-01 | 2019-03-05 | 中南大学 | Epstein-Barr virus correlation nasopharyngeal carcinoma diagnosis kit based on CDH6 |
| CN105861705B (en) * | 2016-05-17 | 2019-11-08 | 中南大学 | Evaluate biomarker and the application of Epstein-Barr virus positive nasopharyngeal carcinoma DNA damage repair ability and radiotherapy prognosis |
| CN107328936A (en) * | 2017-06-16 | 2017-11-07 | 中山大学肿瘤防治中心 | Diagnosis marker and application for distinguishing the positive normal persons of VCA IgA and nasopharyngeal carcinoma |
| CN108588221B (en) * | 2018-05-03 | 2021-08-24 | 佛山市第一人民医院（中山大学附属佛山医院） | Use of STIL gene and related medicine |
| CN108949954A (en) * | 2018-07-03 | 2018-12-07 | 张罗 | The application of kit and ALOX15 gene as biomarker for detecting chronic nasosinusitis with nasal polyp hypotype |
| CN108977510A (en) * | 2018-07-03 | 2018-12-11 | 张罗 | Detect the method and application of CLC gene expression amount in nasal cavity cast-off cells |
| CN109657731A (en) * | 2018-12-28 | 2019-04-19 | 长沙理工大学 | A kind of anti-interference classification method of droplet digital pcr instrument |
| CN110004227A (en) * | 2019-03-05 | 2019-07-12 | 江苏省肿瘤医院 | A kind of biomarker of nasopharyngeal carcinoma diagnosis and/or prognosis evaluation |
| CN110819714B (en) * | 2019-11-22 | 2023-01-10 | 南方医科大学深圳医院 | Cancer suppressor gene and application thereof |
| CN112980949B (en) * | 2020-12-17 | 2023-03-28 | 中山大学 | SNP marker for identifying nasopharyngeal carcinoma high-risk group, kit and application thereof |
| CN117737262A (en) * | 2024-02-21 | 2024-03-22 | 山东第一医科大学(山东省医学科学院) | Application of miRNA marker in preparation of body fluid spot identification product |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080206749A1 (en) * | 2007-02-26 | 2008-08-28 | The Chinese University Of Hong Kong | Methods and kits for diagnosis, prognosis or monitoring of Epstein-Barr virus (EBV)-associated cancer |
-
2010
- 2010-09-30 CN CN201010502553.9A patent/CN101956014B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080206749A1 (en) * | 2007-02-26 | 2008-08-28 | The Chinese University Of Hong Kong | Methods and kits for diagnosis, prognosis or monitoring of Epstein-Barr virus (EBV)-associated cancer |
Non-Patent Citations (2)
| Title |
|---|
| 洪明晃.鼻咽癌的筛查问题.《实用肿瘤杂志》.2004,第19卷(第4期),275-275. * |
| 洪明晃等.鼻咽癌外周血淋巴细胞基因表达谱的研究.《癌症》.2002,第21卷(第1期),21-24. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101956014A (en) | 2011-01-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101956014B (en) | Kit for detecting 7 genetic markers of peripheral blood in early diagnosis of nasopharyngeal darcinoma | |
| CN105219844B (en) | Gene marker combination, kit and the disease risks prediction model of a kind of a kind of disease of screening ten | |
| Paradis et al. | Molecular profiling of hepatocellular carcinomas (HCC) using a large-scale real-time RT-PCR approach: determination of a molecular diagnostic index | |
| CN105316341B (en) | A kind of LncRNA and its application in marker or prostate cancer prognosis recurrence marker is detected as prostate cancer | |
| CN105219867B (en) | MiRNA biomarker and detection kit for diagnosing gastric cancer | |
| You et al. | Plasma miR-127 and miR-218 might serve as potential biomarkers for cervical cancer | |
| CN103205495B (en) | Gene for colorectal cancer prognosis and application thereof | |
| CN112662776B (en) | Application of preparation for detecting circular RNA and/or expression quantity of circular RNA in preparation of colorectal cancer auxiliary diagnostic reagent | |
| CN108531597A (en) | A kind of detection kit for oral squamous cell carcinomas early diagnosis | |
| CN109929932A (en) | Application in blood in two kinds of long-chain non-coding RNA Combining diagnosis esophageal squamous cell carcinomas | |
| CN108624691A (en) | A kind of marker and its application for judging prostatic disorders | |
| CN110257514B (en) | Novel esophageal cancer blood miRNA marker and application thereof | |
| CN111518908A (en) | Urine prostate cancer marker combination and application thereof in preparation of accurate diagnostic reagent | |
| CN104450702B (en) | A kind of Serum miRNA biomarker composition and application | |
| CN105779640A (en) | miRNA biomarker and detection kit used for renal cancer diagnosis | |
| CN111808946B (en) | Myelodysplastic syndrome marker and kit thereof | |
| CN103710459A (en) | Kit for early diagnosis of papillary thyroid carcinoma | |
| CN111394470A (en) | Early esophageal squamous cell carcinoma screening marker and application thereof in probe kit | |
| CN109439760B (en) | Application of ARRDC2 in evaluating development process of oral squamous cell carcinoma | |
| CN105779638A (en) | miRNA biomarker for rectal carcinoma diagnosis and detection kit | |
| WO2019095541A1 (en) | Composition and method for diagnosing and predicting breast cancer bone metastases | |
| CN106636450B (en) | It is a kind of for diagnosing the non-invasive marker object and kit of Lung Squamous Carcinoma Patients in non-smoking or slight smoking population | |
| CN111334579A (en) | Detection primer and probe for plasma EBV miR-BART8-3p and application | |
| CN103923971A (en) | Large intestine rectal cancer-related K-ras gene mutation detection method and related detection kit | |
| CN113736879B (en) | System for prognosis of small cell lung cancer patient and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |