CN106480098A - Targeting VEGFA gene RNA interference recombinant lentivirus vector and its construction method - Google Patents

Abstract

The present invention relates to the structure of targeting VEGFA gene RNA interference recombinant lentivirus vector, screening and application thereof.The present invention utilizes RNA perturbation technique, different target sequences for VEGFA gene, construct four slow viruss carrier for expression of eukaryon that can express siRNA in 293 cells, interference slow viruss are to be obtained by pLv VEGFAshRNA, pMD2.G and pSPAX2 carrier cotransfection 293T cell culture.Targeting VEGFA gene RNA interference recombinant lentivirus vector of the present invention can efficiently specific suppression VEGFA gene expression, can be used for preparing curing oncoma related genes medicine.

Description

Targeted VEGFA gene RNA interference recombinant lentiviral vector and construction method thereof

Technical Field

The invention relates to an RNA interference recombinant lentiviral vector targeting a Vascular Endothelial Growth Factor A (VEGFA) gene and construction thereof, belonging to the technical field of biological medicines.

Background

Tumor blood vessels are a necessary condition for tumor growth and metastasis, there is no angiogenesis, and tumors can only grow to a maximum size of about 1-2mm in diameter. Therefore, the research on tumor angiogenesis has important theoretical significance and clinical application value for understanding the biological characteristics and mechanism of the occurrence, development, invasion and metastasis of malignant tumors and anti-tumor angiogenesis plasmids. Folkman et al, based on a large body of experimental evidence, suggest that tumor growth and metastasis are dependent on the formation of new blood vessels. Subsequently, a plurality of regulatory factors promoting angiogenesis were discovered and isolated in succession. Among them, Vascular Endothelial Growth Factor A (VEGFA) and its receptor can specifically promote cell division, proliferation and migration, and play an important role in the process of tumor angiogenesis. Results have demonstrated that VEGFA is closely associated with proliferation, infiltration and metastasis of lung cancer. Thus, preventing or inhibiting expression of VEGFA in tumor tissue may be an important role in inhibiting tumor growth and metastasis.

RNA interference technology can specifically degrade mRNA, silence target genes, and inhibit the expression of genes at the post-transcriptional level, so that the RNA interference technology can be used for researching gene functions and drug targets. There are two current protocols for inducing RNA interference in mammalian cells by siRNA, namely chemically synthesized siRNA and intracellularly expressed siRNA. Chemical synthesis methods for artificially preparing siRNA generally synthesize sense and antisense strands of 21 bases, respectively, and pair the complementary strands at an appropriate temperature in vitro to form siRNA. Then, siRNA is introduced into cells by conventional transfection methods, such as Lipofectamine transfection, calcium phosphate, electroporation, etc., to induce RNA interference. The method is simple and rapid to operate, but the caused RNA interference effect is often temporary and difficult to persist. Therefore, there is a current trend to express siRNA in mammalian cells to maintain a long-lasting RNA interference effect. The intracellular expression method is to transfect a cell with a vector expressing siRNA and to express siRNA in the cell. The slow virus vector is one of the commonly used virus vectors and is characterized by low immunogenicity, capability of infecting split-phase and non-split-phase cells, capability of integrating self-carried fragments into host cell genomes, stable expression of siRNA in various mammalian cells and long-term inhibition of gene expression.

Disclosure of Invention

The invention provides a construction, screening and application of an RNA interference recombinant virus vector of a targeted VEGFA gene.

The invention mainly adopts RNA interference technology, and aims at different target sequences of VEGFA gene, four lentiviral eukaryotic expression vectors pLv-VEGFAshRNA capable of expressing siRNA in 293T cells are constructed, the vectors are self-inactivated lentiviral vectors, the schematic map of the vectors is shown in figure 1, and the expression of VEGFA gene can be specifically inhibited.

The technical scheme of the invention is as follows:

an siRNA recombinant lentivirus expression vector targeting VEGFA gene is used for tumor VEGFA gene related therapeutic substances, and lentivirus is obtained by culturing 293T cells cotransfected by pLv-VEGFAshRNA, pMD2.G and pSPAX2 vectors; wherein, the pLv-VEGFAshRNA recombinant vector is constructed by connecting double-stranded DNA fragments in a multiple cloning site of a plv-shRNA vector, the enzyme cutting site is BamHI and EcoRI, and the double-stranded DNA fragments are one of the following sequences:

(1) VEGFA-homo-U1 oligonucleotide sequence 1:

sense strand:

5’GATCCAGGGCAGAATCATCACGAAGTCTCGAGACTTCGTGATGATTCTGCCCTTTTTTG3’

antisense strand:

5’AATTCAAAAAAGGGCAGAATCATCACGAAGTCTCGAGACTTCGTGATGATTCTGCCCTG3’

(2) VEGFA-homo-U2 oligonucleotide sequence 2:

sense strand:

5’GATCCGCGCAAGAAATCCCGGTATAACTCGAGTTATACCGGGATTTCTTGCGCTTTTTG3’

antisense strand:

5’AATTCAAAAAGCGCAAGAAATCCCGGTATAACTCGAGTTATACCGGGATTTCTTGCGCG3’

(3) VEGFA-homo-U3 oligonucleotide sequence 3:

sense strand:

5’GATCCCGAACGTACTTGCAGATGTGACTCGAGTCACATCTGCAAGTACGTTCGTTTTTG3’

antisense strand:

5’AATTCAAAAACGAACGTACTTGCAGATGTGACTCGAGTCACATCTGCAAGTACGTTCGG3’

(4) VEGFA-homo-U4 oligonucleotide sequence 4:

sense strand:

5’GATCCGATAGAGCAAGACAAGAAACTCGAGTTTCTTGTCTTGCTCTATCTTTTTG3’

antisense strand:

5’AATTCAAAAAGATAGAGCAAGACAAGAAACTCGAGTTTCTTGTCTTGCTCTATCG3’

according to the invention, the construction method of the siRNA recombinant lentiviral expression vector targeting VEGFA gene comprises the following steps:

a. designing and synthesizing a double-stranded DNA fragment according to a VEGFA mRNA sequence, wherein the double-stranded DNA fragment is one of the VEGFA-homo-U1, VEGFA-homo-U2, VEGFA-homo-U3 and VEGFA-homo-U4 nucleic acid sequences;

b. then connecting the double-stranded DNA fragment to the multiple cloning site of the plv-shRNA vector to construct a pLv-VEGFAshRNA recombinant vector;

c. and then co-transfecting the pLv-VEGFAshRNA recombinant vector, pMD2.G and pSPAX2 vectors to 293T cells for culturing to obtain the recombinant lentiviral vector system for targeting VEGFA gene RNA interference.

In order to identify the inhibiting effect of the recombinant lentiviral vector with targeted VEGFA gene RNA interference on the VEGFA gene, pLv-VEGFAshRNA and a packaging plasmid are cotransfected with 293T cells, then the fluorescent quantitative PCR is carried out to detect the expression level of a target gene, and an effective interference plasmid is screened out.

Drawings

FIG. 1 is a diagram showing the results of lentiviral expression vector plv-shRNA in examples.

FIG. 2 is a 48h picture (fluorescence, visible light) of transient 293T cells of VEGFA interfering RNA lentiviral vector. Wherein (a) is a common light mirror (100 ×); (b) fluorescent mirror (100X).

Figure 3 VEGFA expression levels under different interference sequences.

Detailed Description

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Further, it should be understood that various changes or modifications of the present invention may be made by those skilled in the art after reading the teaching of the present invention, and such equivalents may fall within the scope of the present invention as defined in the appended claims.

The main materials are as follows:

293T cells were purchased from Shanghai institute of cell biology, Chinese academy of sciences; escherichia coli competence DH5 α was purchased from Beijing Quanjin Biotechnology Ltd; lentiviral vector plv-shRNA was purchased from Clontech, and contains the human U6 promoter encoding the green fluorescent protein reporter gene; various restriction endonucleases, T4DNA ligase and Taq DNA polymerase are all products of the American NEB company; SYBR Green Iq RT-PCR mix purchased from Shanghai Biotechnology engineering service company; fetal bovine serum and DMEM medium were purchased from Gibico, USA.

Example 1

Construction of lentiviral vectors targeting VEGFA Gene

1. Design and synthesis of oligonucleic acids

Design 4 interfering sequences targeting the VEGFA gene (NM-001025366.2) (Table 1) and synthesize the corresponding single-stranded DNA

TABLE 1 Targeted VEGFA Gene RNA interference sequences

Sequence name	Sequence information	Starting position
			U1	AGGGCAGAATCATCACGAAGT	639
U2	GCGCAAGAAATCCCGGTATAA	1002
			U3	CGAACGTACTTGCAGATGTGA	1203
U4	GATAGAGCAAGACAAGAAA	943

The 3 ' end of the shRNA oligonucleotide is TTTTT which is used as a termination signal of RNA polymerase III type promoter U6, the 5 ' end and the 3 ' end are restriction sites of BamHI and EcoRI respectively, and CTCGAG is selected as a loop structure in the plv-shRNA template. The respective single-stranded DNA synthesis fragments were as follows:

(1) VEGFA-homo-U1 oligonucleotide sequence 1:

sense strand:

5’GATCCAGGGCAGAATCATCACGAAGTCTCGAGACTTCGTGATGATTCTGCCCTTTTTTG3’

antisense strand:

5’AATTCAAAAAAGGGCAGAATCATCACGAAGTCTCGAGACTTCGTGATGATTCTGCCCTG3’

(2) VEGFA-homo-U2 oligonucleotide sequence 2:

sense strand:

5’GATCCGCGCAAGAAATCCCGGTATAACTCGAGTTATACCGGGATTTCTTGCGCTTTTTG3’

antisense strand:

5’AATTCAAAAAGCGCAAGAAATCCCGGTATAACTCGAGTTATACCGGGATTTCTTGCGCG3’

(3) VEGFA-homo-U3 oligonucleotide sequence 3:

sense strand:

5’GATCCCGAACGTACTTGCAGATGTGACTCGAGTCACATCTGCAAGTACGTTCGTTTTTG3’

antisense strand:

5’AATTCAAAAACGAACGTACTTGCAGATGTGACTCGAGTCACATCTGCAAGTACGTTCGG3’

(4) VEGFA-homo-U4 oligonucleotide sequence 4:

sense strand:

5’GATCCGATAGAGCAAGACAAGAAACTCGAGTTTCTTGTCTTGCTCTATCTTTTTG3’

antisense strand:

5’AATTCAAAAAGATAGAGCAAGACAAGAAACTCGAGTTTCTTGTCTTGCTCTATCG3’

2. annealing of oligonucleic acids

The synthesized oligo-nucleic acids were dissolved in non-enzymatic water at a concentration of 20. mu.M, respectively. Taking corresponding sense strand and antisense strand solutions, and preparing an annealing reaction system according to the following proportion

Components	Volume (μ L)
		Annealing buffer	5
Sense strand (20. mu.M)	5
		Antisense strand (20. mu.M)	5
Water to final volume	50

Annealing treatment was performed on a PCR instrument according to the following procedure: 5min at 95 deg.C, 5min at 85 deg.C, 5min at 75 deg.C, 5min at 70 deg.C, and 4 deg.C.

Linearization of pl-shRNA vectors

Mu.g of plv-shRNA vector was digested according to the following system:

components	Volume (μ L)
		10 × buffer solution	5
BamHI	1
		EcoRI	1
Water to final volume	50

The enzyme was digested at 37 ℃ for 1 hour, subjected to 1.5% agarose electrophoresis, recovered using a DNA purification kit, and the recovery quality was measured with a nucleic acid protein concentration measuring instrument.

Construction of plv-VEGFA-shRNA vector

The vector ligation reaction was performed using T4DNA ligase according to the following system:

components	Volume (μ L)
		10 × T4 ligation buffer	2
Carrier recovery	2
		shDNA	2
T4DNA ligase	1
		Water to final volume	20

The ligation was performed overnight at 20 ℃ and the transformant H5. alpha. was infected with H.coli, and positive clones were selected for sequencing. The product obtained in this step was plv-VEGFA-shRNA.

Example 2

Transient transformation of RNA interference lentivirus plasmid into 293T cell

Transfecting 293T cells by 4 interfering slow virus plasmids by a transient transfection method, culturing the 293T cells in a high-sugar DMEM medium containing 10% FBS at 37 ℃ in a 5% CO2 culture box, digesting the 293T cells 1 day before transfection, counting, inoculating the cells into 35mm culture dishes, and inoculating 6 × 10 to each culture dish⁵(ii) individual cells; respectively preparing a calcium transfer reagent and RNA interference plasmids by using a DMEM culture medium without FBS the next day, adding 16 mu l of the calcium transfer reagent into each 84 mu l of the culture medium, adding 4 mu g of plasmids into each 100 mu l of the culture medium, respectively mixing uniformly, then slightly mixing the calcium transfer solution and the plasmid solution uniformly, standing at room temperature for 10 minutes, dropwise adding into a culture dish, culturing for 24 hours at 37 ℃ in a 5% CO2 culture box, replacing a fresh high-sugar DMEM culture medium containing 10% FBS, continuously culturing for 48 hours, collecting cells, and extracting cell RNA.

Example 3

1. Extraction of total RNA, cDNA synthesis and RT-PCR detection of RNA interference effect

Respectively taking 1 mu g of RNA reverse transcription cDNA, adopting a fluorescence quantitative PCR method to detect the expression level of VEGFA, taking beta-actin as an internal reference, and adopting a primer sequence adopted by the fluorescence quantitative PCR as shown in table 2 and 2^-△△CTThe expression level of VEGFA of different RNA interference sequence samples is calculated by a relative quantitative method. And selecting the RNA interference sequence with the lowest expression level. The detection result (see fig. 3) shows that the expression level of the VEGFA gene of the U4 sequence is lowest, which indicates that the RNA interference effect of the U4 sequence is best.

Primer probe design for VEGFA and beta-actin

Primer name	Sequence of
		F-VEGFA	CTGGAGCGTGTACGTTGGTGC
R-VEGFA	GTTCGTTTAACTCAAGCTGCCTC
		F-actinb	TATCGCCGCGCTCGTCGTC
R-actinb	TCTTGCTCTGGGCCTCGTC

SEQUENCE LISTING

<110> Suzhou research institute of Tongji university

<120> targeting VEGFA gene RNA interference recombinant lentiviral vector and construction method thereof

<130>2016

<160>8

<170>PatentIn version 3.5

<210>1

<211>59

<212>DNA

<213> Artificial Synthesis

<400>1

gatccagggc agaatcatca cgaagtctcg agacttcgtg atgattctgc ccttttttg 59

<210>2

<211>59

<212>DNA

<213> Artificial Synthesis

<400>2

aattcaaaaa agggcagaat catcacgaag tctcgagact tcgtgatgat tctgccctg 59

<210>3

<211>59

<212>DNA

<213> Artificial Synthesis

<400>3

gatccgcgca agaaatcccg gtataactcg agttataccg ggatttcttg cgctttttg 59

<210>4

<211>59

<212>DNA

<213> Artificial Synthesis

<400>4

aattcaaaaa gcgcaagaaa tcccggtata actcgagtta taccgggatt tcttgcgcg 59

<210>5

<211>59

<212>DNA

<213> Artificial Synthesis

<400>5

gatcccgaac gtacttgcag atgtgactcg agtcacatct gcaagtacgt tcgtttttg 59

<210>6

<211>59

<212>DNA

<213> Artificial Synthesis

<400>6

aattcaaaaa cgaacgtact tgcagatgtg actcgagtca catctgcaag tacgttcgg 59

<210>7

<211>55

<212>DNA

<213> Artificial Synthesis

<400>7

gatccgatag agcaagacaa gaaactcgag tttcttgtct tgctctatct ttttg 55

<210>8

<211>55

<212>DNA

<213> Artificial Synthesis

<400>8

aattcaaaaa gatagagcaa gacaagaaac tcgagtttct tgtcttgctc tatcg 55

Claims (3)

1. An siRNA recombinant lentivirus expression vector targeting VEGFA gene is used for tumor VEGFA gene related therapeutic substances, and interfering lentivirus is obtained by culturing 293T cells cotransfected by pLv-VEGFAshRNA, pMD2.G and pSPAX2 vectors; wherein,

the pLv-VEGFAshRNA recombinant vector is constructed by connecting double-stranded DNA fragments in a multiple cloning site of a pLv-shRNA vector, wherein the enzyme cutting sites are BamHI and EcoRI; the double-stranded DNA fragment is one of the following sequences:

(1) VEGFA-homo-U1 oligonucleotide sequence 1:

sense strand:

5’GATCCAGGGCAGAATCATCACGAAGTCTCGAGACTTCGTGATGATTCTGCCCTTTTTTG3’

antisense strand:

5’AATTCAAAAAAGGGCAGAATCATCACGAAGTCTCGAGACTTCGTGATGATTCTGCCCTG3’

(2) VEGFA-homo-U2 oligonucleotide sequence 2:

sense strand:

5’GATCCGCGCAAGAAATCCCGGTATAACTCGAGTTATACCGGGATTTCTTGCGCTTTTTG3’

antisense strand:

5’AATTCAAAAAGCGCAAGAAATCCCGGTATAACTCGAGTTATACCGGGATTTCTTGCGCG3’

(3) VEGFA-homo-U3 oligonucleotide sequence 3:

sense strand:

5’GATCCCGAACGTACTTGCAGATGTGACTCGAGTCACATCTGCAAGTACGTTCGTTTTTG3’

antisense strand:

5’AATTCAAAAACGAACGTACTTGCAGATGTGACTCGAGTCACATCTGCAAGTACGTTCGG3’

(4) VEGFA-homo-U4 oligonucleotide sequence 4:

sense strand:

5’GATCCGATAGAGCAAGACAAGAAACTCGAGTTTCTTGTCTTGCTCTATCTTTTTG3’

antisense strand:

5’AATTCAAAAAGATAGAGCAAGACAAGAAACTCGAGTTTCTTGTCTTGCTCTATCG3’。

2. the method for constructing siRNA recombinant lentiviral expression vector targeting VEGFA gene according to claim 1,

the method comprises the following steps:

a. designing and synthesizing a double-stranded DNA fragment according to a VEGFA mRNA sequence, wherein the double-stranded DNA fragment is one of the VEGFA-homo-U1, VEGFA-homo-U2, VEGFA-homo-U3 and VEGFA-homo-U4 nucleic acid sequences;

b. then connecting the double-stranded DNA fragment to the multiple cloning site of the plv-shRNA vector to construct a pLv-VEGFAshRNA recombinant vector;

c. and then co-transfecting the pLv-VEGFAshRNA recombinant vector, pMD2.G and pSPAX2 vectors to 293T cells for culturing to obtain the recombinant lentiviral vector system for targeting VEGFA gene RNA interference.

3. The use of the siRNA recombinant lentiviral expression vector targeting a VEGFA gene of claim 1 in the preparation of a medicament for the treatment of a tumor-associated gene.