CN103725682A

CN103725682A - Small interfering ribonucleic acid (RNA) for knocking down expression of estrogen related receptor (ERR), and recombinant vector and application of RNA

Info

Publication number: CN103725682A
Application number: CN201310746591.2A
Authority: CN
Inventors: 刘庆礼; 雷杨; 管敏; 潘浩波
Original assignee: Shenzhen Institute of Advanced Technology of CAS
Current assignee: Shenzhen Institute of Advanced Technology of CAS
Priority date: 2013-12-30
Filing date: 2013-12-30
Publication date: 2014-04-16

Abstract

The invention provides a small interfering ribonucleic acid (RNA), an shRNA (Short Hairpin Ribonucleic Acid), an encoding DNA (deoxyribonucleic acid) of the shRNA, a recombinant vector, a recombinant lentiviral vector and a pharmaceutical composition for silencing the expression of an estrogen related receptor (ERR) and applications thereof. The small interfering RNA comprises a nucleotide sequence complementary with a messenger RNA of translating estrogen related receptor protein and is 19-27bp in length; the DNA of encoding the shRNA is cloned to a pDSL-hpUGIP vector, so as to obtain the recombinant lentiviral vector; the recombinant lentiviral vector infects the cell together with lentivirus packaging plasmids, so as to obtain a recombinant lentivirus with activity capable of transcribing ERR-shRNA; the ERR-shRNA can generate the small interfering RNA for silencing the ERR expression after being processed by a host cell. The small interfering RNA provided by the invention can target mRNA of the ERR and cause mRNA degradation of the ERR, so as to reduce the expression level of the ERR.

Description

Small molecules interference RNA, recombinant vectors and the application thereof for striking low ERR, expressed

Technical field

The present invention relates to molecular biology, genetic engineering technique and biomedicine field, be specifically related to a kind of small molecules interference RNA, recombinant vectors and application thereof of expressing for striking low ERR.

Background technology

Estrogen-related receptor (ERR) is not combined with oestrogenic hormon, and research shows that it is relevant with the generation of osteoporosis and mammary cancer, also in glycolipid metabolism approach, plays an important role simultaneously.

The gene silencing that RNA disturbs (RNA interference, RNAi) to bring out.When importing with the double-stranded RNA of endogenous mRNA coding region homology in cell, there is degraded and cause genetic expression silence in this mRNA.At present, the messenger RNA(mRNA) of application RNA perturbation technique to ERR(estrogen-related receptor) method of carrying out gene silencing mainly contains construction of eukaryotic expression vector method and adenovirus vector construct method.But construction of eukaryotic expression vector method transfection efficiency is extremely low, and cell category that can only transfection only a few, range of application is very limited.Although utilize, the carrier host of adenovirus vector construct is extensive, efficiency of infection is high, and it can not effectively integrate, its application in ERR transgenic research of having asked the drawbacks limit such as short during destination gene expression.

Therefore, be necessary to provide a kind of RNA of employing perturbation technique ERR to be carried out to the method for gene silencing.

Summary of the invention

For addressing the above problem, the invention provides a kind of small molecules interference RNA of the expression for reticent ERR, coding DNA, recombinant vectors, recombinant slow virus and the application of shRNA, shRNA.

The mRNA of the direct selectively targeted ERR of small molecules interference RNA energy provided by the invention, and cause the mRNA of ERR to degrade, produce gene silencing effect; The expression of reticent ERR indirectly of coding DNA, recombinant vectors, recombinant slow virus or the pharmaceutical composition of shRNA provided by the invention, shRNA.

The english abbreviation the present invention relates to and Chinese lexical or textual analysis thereof are as follows:

ERR: estrogen-related receptor;

ERR-shRNA: the short hairpin RNA with target estrogen-related receptor messenger RNA(mRNA);

MRNA: messenger RNA(mRNA); SiRNA: small molecules interference RNA; ShRNA: short hairpin RNA;

First aspect, the invention provides a kind of small molecules interference RNA, and described small molecules interference RNA has the nucleotide sequence with the messenger RNA(mRNA) complementation of translation estrogen-related receptor albumen, and length is 19～29bp.

Preferably, a kind of small molecules interference RNA that first aspect present invention provides, described small molecules interference RNA has the nucleotide sequence with the messenger RNA(mRNA) complementation of translation estrogen-related receptor albumen, and length is 19～29bp.

Preferably, the length of described small molecules interference RNA is 21～27bp.

Preferably, the nucleotide sequence of described small molecules interference RNA is as shown in SEQ ID NO:1 or SEQ ID NO:2.

Preferably, described estrogen-related receptor protein gene is mouse estrogen-related receptor α gene.

Second aspect, the invention provides a kind of shRNA, and described shRNA has the positive-sense strand of the small molecules interference RNA as described in first aspect or the nucleotide sequence of antisense strand.

Preferably, a kind of shRNA that second aspect present invention provides, for thering is the single stranded RNA of loop-stem structure, described shRNA has the positive-sense strand of small molecules interference RNA or the nucleotide sequence of antisense strand, wherein, described small molecules interference RNA has the nucleotide sequence with the messenger RNA(mRNA) complementation of translation estrogen-related receptor albumen, and length is 19～27bp.

Preferably, described estrogen-related receptor protein gene is mouse estrogen-related receptor α gene, and the Genebank accession number of described mouse estrogen-related receptor α gene is 26379; .

The third aspect, the invention provides the coding DNA of a kind of shRNA, and described shRNA has the positive-sense strand of the small molecules interference RNA as described in first aspect or the nucleotide sequence of antisense strand.

Preferably, the coding DNA of a kind of shRNA that third aspect present invention provides, described shRNA has the positive-sense strand of small molecules interference RNA or the nucleotide sequence of antisense strand, wherein, described small molecules interference RNA has the nucleotide sequence with the messenger RNA(mRNA) complementation of translation estrogen-related receptor albumen, and length is 19～27bp.

Preferably, the DNA's of described coding shRNA contains the nucleotide sequence shown in SEQ ID NO:3 or SEQ ID NO:4.

Particularly, under this optimum condition, described SEQ ID NO:3(5 '-3 ') be:

CCGCTAGTGCTCAGCTCTCTACCCAATTC?AAGAGATTGGGTAGAGAGCTGAGCACTAGCTTTTTT；

Described SEQ ID NO:4(5 '-3 ') be:

AAAAAAGCTAGTGCTCAGCTCTCTACCCAATCTCTTGAATTGGGTAGAGAGCTGAGCACTAGCGG

Further preferably, 5 ' of the nucleotide sequence shown in described SEQ ID NO:3 or 4 end has restriction enzyme site.

Still more preferably, the restriction enzyme site of 5 ' of the nucleotide sequence shown in described SEQ ID NO:3 or 4 end is respectively BamH I and Xho I.

Under this optimum condition, the DNA of described coding shRNA has the nucleotide sequence as shown in SEQ ID NO:5 or 6.

Particularly, described SEQ ID NO:5(5 '-3 ') be:

CC

TTCAAGAGA TTGG GTAGAGAGCTGAGCACTAGCTTTTTT

；

Described SEQ ID NO:6(5 '-3 ') be:

AAAAAA

TCTCTTGAA TTGGGTAGAGAGCTGAGCACTAGCGG

。

Wherein, the base place of two line signs is restriction enzyme site, the positive-sense strand that the sequence that wavy line represents is siRNA, and the antisense strand that the sequence of single line sign is siRNA, the sequence of italic sign is the ring region sequence while forming shRNA hair fastener.

Preferably, the DNA of described coding shRNA also comprises rna plymerase iii promotor.

Further preferably, the U6 promotor in described rna plymerase iii promotor behaviour source or the H1 promotor in people source.

Further preferably, the U6 promotor that described rna plymerase iii promotor is mouse source or the H1 promotor in mouse source.

Fourth aspect, the invention provides a kind of recombinant vectors, described recombinant vectors be

A) multiple clone site of pEN-hH1c plasmid or

B) recombination site of pDSL-hpUGIP plasmid

The recombinant vectors that the DNA of the coding shRNA of insertion as described in the third aspect obtains.

Preferably, a kind of recombinant vectors that fourth aspect present invention provides, described recombinant vectors be

A) multiple clone site of pEN-hH1c plasmid or

B) recombination site of pDSL-hpUGIP plasmid

The recombinant vectors that the DNA of insertion coding shRNA obtains, wherein, described shRNA has the positive-sense strand of small molecules interference RNA or the nucleotide sequence of antisense strand, wherein, described small molecules interference RNA has the nucleotide sequence with the messenger RNA(mRNA) complementation of translation estrogen-related receptor albumen, and length is 19～27bp.

Preferably, the multiple clone site of described pEN-hH1c plasmid is BamHI and XhoI restriction enzyme site.

Preferably, the recombination site of described pDSL-hpUGIP plasmid is attR1 and attR2, and wherein, attR1 is positioned at 2614～2738bp site of pDSL-hpUGIP plasmid, and attR2 is positioned at 4194～4318bp site of pDSL-hpUGIP plasmid.

Preferably, the DNA of described coding shRNA contains the nucleotide sequence shown in SEQ ID NO:3 or SEQ ID NO:4.

Particularly, under this optimum condition, described SEQ ID NO:3(5 '-3 ') be:

CCGCTAGTGCTCAGCTCTCTACCCAATTC?AAGAGATTGGGTAGAGAGCTGAGCACTAGCTTTTTT；

Described SEQ ID NO:4(5 '-3 ') be:

AAAAAAGCTAGTGCTCAGCTCTCTACCCAATCTCTTGAATTGGGTAGAGAGCTGAGCACTAGCGG

Particularly, described SEQ ID NO:5(5 '-3 ') be:

GATCCCCGCTAGTGCTCAGCTCTCTACCCAATTC?AAGAGATTGGGTAGAGAGCTGAGCACTAGCTTTTTTC；

Described SEQ ID NO:6(5 '-3 ') be:

TCGAGAAAAAAGCTAGTGCTCAGCTCTCTACCCAATCTCTTGAATTGGGTAGAGAGCTGAGCACTAGCGGG。

Under this optimum condition, goal gene ERR α-shRNA is inserted into pEN-hH1c entry vector, obtain pEN-ERR α-shRNA carrier, then by the mode of homologous recombination, the recombinant fragment that contains ERR α-shRNA is building up in pDSL-hpUGIP carrier, obtains Lentiviral pDSL-ERR α-shRNA.

PDSL-ERR α-shRNA the lentiviral vectors that the present invention builds has very high efficiency of infection and transcribes efficiency, and the DNA gene fragment of the coding shRNA of insertion can be inserted host genome by recombination, thereby continues, the stably expression of reticent ERR.

The pDSL-hpUGIP carrier that the present invention adopts, with green fluorescence protein gene (Green fluorescent protein, GFP), can be monitored transfection efficiency in cell and the expression thereof of object plasmid under fluorescence microscopy viewing system.

The 5th aspect, the invention provides a kind of recombinant slow virus, be as fourth aspect b) as described in the recombinant slow virus that obtains of recombinant vectors and envelope vector psPAX2 and package carrier pMD2.G cotransfection mammalian cell.

Preferably, a kind of recombinant slow virus that fifth aspect present invention provides, it is the recombinant slow virus that recombinant vectors and envelope vector psPAX2 and package carrier pMD2.G cotransfection mammalian cell obtain, wherein, described recombinant vectors is the recombinant vectors obtaining at the DNA of the recombination site insertion coding shRNA of pDSL-hpUGIP plasmid, wherein, described shRNA has the positive-sense strand of small molecules interference RNA or the nucleotide sequence of antisense strand, wherein, described small molecules interference RNA has the nucleotide sequence with the messenger RNA(mRNA) complementation of translation estrogen-related receptor albumen, length is 19～27bp.

Particularly, under this optimum condition, described SEQ ID NO:3(5 '-3 ') be:

CCGCTAGTGCTCAGCTCTCTACCCAATTC?AAGAGATTGGGTAGAGAGCTGAGCACTAGCTTTTTT；

Described SEQ ID NO:4(5 '-3 ') be:

AAAAAAGCTAGTGCTCAGCTCTCTACCCAATCTCTTGAATTGGGTAGAGAGCTGAGCACTAGCGG

Particularly, described SEQ ID NO:5(5 '-3 ') be:

GATCCCCGCTAGTGCTCAGCTCTCTACCCAATTC?AAGAGATTGGGTAGAGAGCTGAGCACTAGCTTTTTTC；

Described SEQ ID NO:6(5 '-3 ') be:

TCGAGAAAAAAGCTAGTGCTCAGCTCTCTACCCAATCTCTTGAATTGGGTAGAGAGCTGAGCACTAGCGGG。

Preferably, pDSL-ERR α-shRNA Lentiviral provided by the invention and package carrier psPAX2 and envelope vector pMD2.G transfection 293T cell are carried out to slow virus packing, can obtain described recombinant slow virus.

The present invention, by the DNA of coding ERR-shRNA is building up between the recombination sequence site of pDSL-hpUGIP carrier, then infects 293T cell together with slow virus packaging plasmid, obtains the activated recombinant slow virus that can express ERR-shRNA.Described recombinant slow virus infects after host cell, can be by the gene integration of coding ERR-shRNA to host cell gene group, contribute to encode ERR-shRNA stable gene, in host cell, transcribe chronically, thereby obtain small molecules interference RNA, mRNA to ERR degrades, and causes gene silencing effect.

Recombinant slow virus provided by the invention not only has very high efficiency of infection, also there is host range widely, can infect polytype cells such as neurone, myocyte, liver cell, tumour cell, endotheliocyte, seldom cause again the immune response of body, range of application is very extensive.

In addition, recombinant slow virus provided by the invention can build the clone of stably express, realizes stable, the long-term expression of goal gene, is very suitable for the RNA the Study of Interference to ERR.Also can obtain transgenic animal, be convenient to build model animal, study for a long period of time.

The 6th aspect, the invention provides a kind of pharmaceutical composition, comprise at least one in DNA, the recombinant vectors as described in fourth aspect and the recombinant slow virus as described in the 5th aspect of small molecules interference RNA as described in first aspect, the shRNA as described in second aspect, the coding shRNA as described in the third aspect.

The 7th aspect, the invention provides the application of DNA, the recombinant vectors as described in fourth aspect or the recombinant slow virus as described in the 5th aspect of a kind of small molecules interference RNA as described in first aspect, the shRNA as described in second aspect, the coding shRNA as described in the third aspect.

Coding DNA, recombinant vectors, recombinant slow virus or pharmaceutical composition and the application thereof of described small molecules interference RNA provided by the invention, shRNA, shRNA have following beneficial effect:

The DNA of coding provided by the invention shRNA is building up to available recombinant slow virus between the recombination sequence site of pDSL-hpUGIP carrier, this recombinant slow virus infects 293T cell together with slow virus packaging plasmid, obtains the activated recombinant slow virus that can transcribe ERR-shRNA; Described recombinant slow virus infects after host cell, can be by the gene integration of coding ERR-shRNA to host cell gene group, the stable gene of the ERR-shRNA that contributes to encode, in host cell, transcribe chronically; ERR-shRNA provided by the invention can generate the small molecules interference RNA that the reticent ERR of energy expresses after host cell processing; The mRNA of small molecules interference RNA energy target ERR provided by the invention, and cause the mRNA of ERR to degrade.

To sum up, the expression that the present invention is reticent ERR provides a kind of effective RNA jamming program, and this scheme is preferably coding DNA, recombinant vectors, recombinant slow virus or the pharmaceutical composition of small molecules interference RNA provided by the invention, shRNA, shRNA.

Accompanying drawing explanation

Entry vector pEN-hH1c, expression vector pDSL-hpUGIP, envelope vector psPAX2 and package carrier pMD2.G vector plasmid collection of illustrative plates that Fig. 1～4 provide for the embodiment of the present invention;

PEN-hH1c empty carrier double digestion (BamH I and the Xho I) electrophoretogram that Fig. 5 provides for the embodiment of the present invention;

The recombinant vectors pEN-mERRa-shRNA plasmid extraction electrophoresis detection figure that Fig. 6 provides for the embodiment of the present invention;

Recombinant vectors pEN-mERR α-shRNA, pEN-mERR α-shRNA-ct and pDSL-mERR α-shRNA, pDSL-mERR α-shRNAct and object fragment nucleotide sequence comparison chart that Fig. 7～Figure 10 provides for the embodiment of the present invention;

Recombinant vectors pDSL-mERR α-shRNA, envelope vector psPAX2 and package carrier pMD2.G carrier cotransfection 293T microcytoscope observation figure and recombinant vectors pDSL-mERR α-shRNAct, envelope vector psPAX2 and package carrier pMD2.G carrier cotransfection 293T microcytoscope observation figure that Figure 11 provides for the embodiment of the present invention.

Embodiment

The following stated is the preferred embodiment of the present invention; it should be pointed out that for those skilled in the art, under the premise without departing from the principles of the invention; can also make some improvements and modifications, these improvements and modifications are also considered as protection scope of the present invention.

Method used in following embodiment is ordinary method if no special instructions, concrete steps can be referring to: < < Molecular Cloning:A Laboratory Manual > > (Sambrook, J., Russell, David W., Molecular Cloning:A Laboratory Manual, 3 ^rdedition, 2001, NY, Cold Spring Harbor).The primer and DNA sequence dna are synthetic by the English Weihe River prompt base (Shanghai) trade Co., Ltd.

Unless otherwise noted, the reagent that the embodiment of the present invention adopts is all commercial goods, and the plasmid map of pEN-hH1c, pDSL-hpUGIP, psPAX2 and pMD2.G carrier that the present invention adopts is respectively as shown in Fig. 1～4.

Embodiment 1

A method of preparing the DNA of coding mERR α-shRNA, comprises the steps:

According to existing mouse ERR α sequence and shRNA principle of design in GeneBank sequence library, utilize the coding DNA (interference fragment) of the online design tool of siRNA (http://www.sirnawizard.com/index.php) to mouse ERR α sequence to design (comprising experimental group and control group), and in NCBI website, the fragment of design is carried out to BLAST checking, the homologous sequence that there is no this fragment in other gene (except ERR α) of assurance mouse, obtains following sequence:

1) experimental group

ERRα-shRNA（SEQ?ID?NO:3）（5’-3’）：

CCGCTAGTGCTCAGCTCTCTACCCAATTC?AAGAGATTGGGTAGAGAGCTGAGCACTAGCTTTTTT；

ERR α-shRNA(SEQ ID NO:4) (5 '-3 '): AAAAAAGCTAGTGCTCAGCTCTCTACCCAATCTCTTGAATTGGGTAGAGAGCTGAG CACTAGCGG; And introduce respectively the restriction enzyme site of restriction enzyme BamH I and Xho I, the synthetic primer sequence that obtains following ERR α-shRNA:

ERRα-shRNA-F（SEQ?ID?NO:5）（5’-3’）：

GATCCCCGCTAGTGCTCAGCTCTCTACCCAATTC?AAGAGATTGGGTAGAGAGCTGAGCACTAGCTTTTTTC；

ERRα-shRNA-R（SEQ?ID?NO:6）（5’-3’）：CGAGAAAAAAGCTAGTGCTCAGCTCTCTACCCAATCTCTTGAATTGGGTAGAGAGCTGAGCACTAGCGGG；

In described SEQ ID NO:5 and SEQ ID NO:6, underscore part is respectively the restriction enzyme site of BamH I and Xho I.

2) control group

ERRα-shRNAct-F（SEQ?ID?NO:7）（5’-3’）：

GATCCCCGCACCCAGTGTTACCGTCTCATCATTCAAGAGATGATGAGACGGTAACACTGGGTGCTTTTTTC；

ERRα-shRNAct-R（SEQ?ID?NO:8）（5’-3’）：TCGAGAAAAAAGCACC?CAGTGTTACCGTCTCATCATCTCTTGAATGATGAGACGGTAACACTGGGTGCGGG；

And introduce respectively the restriction enzyme site of restriction enzyme BamH I and Xho I.

Embodiment 2

The Construction and identification method of Lentiviral pDSL-mERR α-shRNA a kind of, by the mode of application DNA Subcloned technology and Gateway homologous recombination, after synthetic interference fragment mERR α-shRNA-F and mERR α-shRNA-R and mERR α-shRNAct-F and mERR α-shRNAct-R are annealed respectively, by sticky end, be connected to entry vector pEN-hH1c, obtain pEN-mERR α-shRNA and pEN-mERR α-shRNAct carrier, then by the mode of pEN-mERR α-shRNAct and pDSL-hpUGIP carrier homologous recombination, the recombinant fragment that contains mERR α-shRNAct is building up in pDSL-hpUGIP carrier, obtain Lentiviral pDSL-mERR α-shRNAct, and the evaluation of checking order.

Specifically comprise the following steps:

1, interfere fragment annealing

Newly synthetic paired interference fragment is dissolved as to 50uM solution, after drawing respectively 10uL and mixing, puts into 95 ℃ of water-bath 10min in PCR pipe, close immediately waters and be naturally cooled to room temperature.

Reaction system is as follows:

2, empty carrier pEN-hH1c double digestion and glue reclaim

1) empty carrier pEN-hH1c double digestion

PEN-hH1c empty carrier is carried out to double digestion with restriction enzyme BamH I and Xho I respectively, and reaction system is as follows:

Total system

20μl

10xdisgestion?Buffer	2μl
		PEN-hH1c empty carrier	5μl
BamH I and Xho I	1μl
		MiliQ-H2O	12μl

Prepare after fully mixing and put into 37 ℃ of water-baths 3 hours, electrophoresis detection, enzyme is cut result as shown in Figure 5.Wherein, DL5K represents DNA Maker DL5000, and the swimming lane of pEN-hH1c has respectively 1 band at 3500bp and 500bp left and right.

2) enzyme is cut to product and carried out glue recovery

Adopt the pillar DNA glue recovery test kit purifying enzyme of day root biology (Beijing) company limited to cut product.Method is as follows:

Column equilibration step: add 500ul balance liquid BL in adsorption column CA2, the centrifugal 1min of 12,000rpm, outwells the waste liquid in collection tube, relays adsorption column to reclaim in collector;

Single target DNA band is cut and puts into clean centrifuge tube from sepharose, take weight;

In blob of viscose, add 3 times of volume sol solutions PN;

10min is placed in 50 ℃ of water-baths, constantly leniently spins upside down centrifuge tube therebetween, to guarantee that blob of viscose fully dissolves;

Previous step gained solution is added in an adsorption column CA2, and room temperature is placed 2min, and the centrifugal 30-60sec of 12,000rpm, outwells the waste liquid in collection tube, and adsorption column CA2 is put into collection tube;

In adsorption column CA2, add 600ul rinsing liquid PW, the centrifugal 30-60sec of 12,000rpm, outwells the waste liquid in collection tube, and adsorption column CA2 is put into collection tube.Repetitive operation step 5;

Adsorption column CA2 is put back in collection tube, and the centrifugal 2min of 12,000rpm eliminates rinsing liquid as far as possible.Adsorption column CA2 is placed in to room temperature and places several minutes, dry up hill and dale;

Adsorption column CA2 is put in a clean centrifuge tube, to the appropriate sterilized water of the unsettled dropping in adsorption film mid-way, (elution buffer E B should be placed in 65-70 ℃ of water-bath preheating), room temperature is placed 2min.The centrifugal 2min of 12,000rpm collects DNA solution.

3, interfere connection and the conversion of fragment and empty carrier pEN-hH1c

The annealing fragment obtaining by previous step cuts back to close product with pEN-hH1c carrier enzyme and is connected (ratio control of object fragment and carrier is at 3:1-6:1), and reaction system is prepared as follows:

Total system	20μl
		10×Ligation?Buffer	2μl
Annealing product	5μl
		PEN-hH1c carrier	8μl
T4DNA ligase enzyme	1.5μl
		MiliQ-H2O	3.5

Prepare and be put in 16 ℃ after fully mixing and connect 12 hours.

Connection product is transformed.Step of converting is as follows: 1. get in 100 μ l competent cell ice baths and melt; 2. rapidly connection product is added in competent cell, mix gently rear ice bath 30 minutes; 3. 42 ℃, heat shock 30 seconds, cooling 2 minutes of ice bath; 4. add SOC substratum 1000 μ l, be put in 37 ℃ of thermostat containers and cultivate 1 hour; 5. get and be applied in right amount LB culture plate (gentamicin resistance) above, be inverted in incubated overnight in 37 ℃ of thermostat containers.

4, extraction and the evaluation of recombinant plasmid pEN-mERR α-shRNA and pEN-mERR α-shRNAct

The single bacterium colony of picking carries out the extraction of plasmid, and chooses suitable restriction endonuclease and carry out enzyme and cut detection, take the Insert Fragment of guaranteeing carrier as goal gene.Concrete operation step carries out according to sky root test kit specification sheets.

1) in adsorption column CP3, (adsorption column is put into collection tube) adds the balance liquid BL of 500ul, and the centrifugal 1min of 12000rpm, outwells the waste liquid in collection tube, and adsorption column is relay and reclaimed in collector.

2) get the bacterium liquid of 1-5ml incubated overnight, add in centrifuge tube, use conventional desk centrifuge, the centrifugal 1min of 12000rpm absorbs supernatant as far as possible.

3) to leaving in the centrifuge tube of bacterial sediment, add 250ul solution P1, use pipettor or the vortex vibrator bacterial precipitation that thoroughly suspends.

4) in centrifuge tube, add 250ul solution P2, leniently spin upside down and make the abundant cracking of thalline for 6-8 time.

5) in centrifuge tube, add 350ul solution P3, leniently spin upside down 6-8 time immediately, fully mix, now will occur white flocks.The centrifugal 10min of 12000rpm.

6) supernatant liquor of previous step being collected is transferred in adsorption column CP3 with pipettor, the sucking-off precipitation of noting trying not.The centrifugal 30-60sec of 12000rpm, outwells the waste liquid in collection tube, and adsorption column CP3 is put into collection tube.

7) in adsorption column CP3, add 600ul rinsing liquid PW, the centrifugal 30-60sec of 12000rpm, outwells the waste liquid in collection tube, and adsorption column CP3 is put into collection tube.

8) repetitive operation step 7.

9) adsorption column CP3 is put into collection tube, the centrifugal 2min of 12000rpm.

10) adsorption column CP3 is placed in to a clean centrifuge tube, to the middle part of adsorption film, drips 50-100ul MlliQ-H2O, room temperature is placed 2min, and 12000rpm is centrifugal, and 2min collects plasmid solution in centrifuge tube.

After plasmid extraction completes, according to selecting specific restriction enzyme to carry out enzyme, cut.In recombinant plasmid, not containing Kpn I restriction enzyme site, therefore select this enzyme to carry out enzyme and cut, the plasmid of cutting not open is object plasmid.

Enzyme is cut system:

Cumulative volume	10ul
		10×Buffer?M	1ul
Kpn?I	0.5ul
		Recombinant plasmid	1ul
H2O	7.5ul

Endonuclease reaction condition: 37 ℃ of water-bath 2h.

After electrophoresis detection, the plasmid that is tentatively defined as positive colony being delivered to the English Weihe River prompt base (Shanghai) trade Co., Ltd checks order, choose positive colony called after pEN-mERR α-shRNA and the pEN-mERR α-shRNAct respectively of experimental group and control group, wherein, as shown in Figure 6, DL5K represents DNA Maker DL5000 to the electrophoresis result of pEN-mERR α-shRNA.

5, extraction and the evaluation of homologous recombination and pDSL-mERR α-shRNAct plasmid

Recombinant plasmid pEN-mERR α-shRNA and pEN-mERR α-shRNAct and pDSL-hpUGIP are carried out to homologous recombination.Concrete reaction system is as follows:

25 ℃ of restructuring are spent the night.Add next day Proteinase K1ul in 37 ℃ of effect 10min.Transform DH5 α competence.Get and be applied in right amount on LB culture plate (amicillin resistance).The single bacterium colony of picking carries out the extraction of plasmid, and chooses suitable restriction endonuclease and carry out enzyme and cut detection, take the Insert Fragment of guaranteeing carrier as goal gene.After electrophoresis detection, by being tentatively defined as positive clone, delivering to the English Weihe River prompt base (Shanghai) trade Co., Ltd and check order, by experimental group correct order-checking and control group plasmid called after pDSL-mERR α-shRNA and pDSL-mERR α-shRNA ct plasmid respectively.

For further illustrating beneficial effect of the present invention, the present embodiment also provides recombinant vectors pEN-mERR α-shRNA, pEN-mERR α-shRNA-ct and pDSL-mERR α-shRNA, pDSL-mERR α-shRNAct and object fragment nucleotide sequence comparison chart, respectively as shown in Fig. 7～Figure 10, wherein, the sequence that the object fragment of Fig. 7 and Fig. 9 contains code book invention mERR α-siRNA, the object fragment of Fig. 8 and Figure 10 is contrast fragment.

Embodiment 3

PDSL-mERR α-shRNA and pEN-mERR α-shRNAct slow virus packing and a method of producing, comprise the following steps:

1) 293T cell bed board (during bed board with common pH7.4 DMEM perfect medium), the 293T cell of the normal about 85-95% of density cultivating in 6cm flat board, one-to-two is (an about 6*105 cell) in two new 6cm flat boards, and after bed board, 12-18h is the best transfection time;

2) transfection: change liquid with the DMEM perfect medium of pH7.4 before transfection.Get two 1.5ml EP pipes, add respectively 300ul DMEM perfect medium, plasmid pDSL-mERR α-shRNA (pDSL-mERR α-shRNAct) 4ug, envelope vector psPAX23ug and package carrier pMD2.G1ug are dissolved in EP pipe, 24ul polyjet transfection reagent is dissolved in another EP pipe, tentatively mix in the EP pipe that rear immigration contains plasmid, further soft piping and druming mixes for several times, after standing 15min, dropwise evenly adds in the flat board for the treatment of transfection;

3), after transfection 13-18h, change liquid with the DMEM perfect medium 3ml of common pH7.4.48h after transfection respectively, 72h, 96h, at fluorescence microscopy Microscopic observation, takes pictures, and connects simultaneously and receives 3 virus stock solution useds, and first the virus stock solution used of results can be kept in 4 ℃ of refrigerators;

4) virus is concentrated: the virus of three results is concentrated and used 0.45um membrane filtration to remove cell debris, get 15ml filter after virus stock solution used in 100kD ultrafiltration post collecting tank, 4 ℃, the centrifugal 25-30min of 4000g, the about 200ul virus of residue concentrated solution in collecting tank, carry out virus titer mensuration, 50ul/ pipe is sub-packed in 1.5ml EP pipe, puts-80 ℃ and can preserve for a long time.

For further illustrating beneficial effect of the present invention, the present embodiment also provides recombinant vectors pDSL-mERR α-shRNA, envelope vector psPAX2 and package carrier pMD2.G carrier cotransfection 293T microcytoscope observation figure, and recombinant vectors pDSL-mERR α-shRNAct, envelope vector psPAX2 and package carrier pMD2.G carrier transfection 293T microcytoscope observation figure, respectively as shown in A in Figure 11 and B.

As shown in Figure 11, pDSL-mERR α-shRNA and control group pDSL-mERR α-shRNAct and packaging plasmid are carried in restructuring provided by the invention can infect 293T cell, and expresses.

The foregoing is only preferred embodiment of the present invention, not in order to limit the present invention, all any modifications of doing within the spirit and principles in the present invention, be equal to and replace and improvement etc., within all should being included in protection scope of the present invention.

Claims

1. a small molecules interference RNA, is characterized in that: described small molecules interference RNA has the nucleotide sequence with the messenger RNA(mRNA) complementation of translation estrogen-related receptor albumen, and length is 19～29bp.

2. small molecules interference RNA as claimed in claim 1, is characterized in that, the nucleotide sequence of described small molecules interference RNA is as shown in SEQ ID NO:1 or SEQ ID NO:2.

3. a shRNA, for having the single stranded RNA of loop-stem structure, is characterized in that, described shRNA has as the nucleotide sequence of the positive-sense strand of claim 1 or small molecules interference RNA claimed in claim 2 or antisense strand.

4. an encode DNA of shRNA, is characterized in that, described shRNA has as the nucleotide sequence of the positive-sense strand of claim 1 or small molecules interference RNA claimed in claim 2 or antisense strand.

5. the DNA of coding shRNA as claimed in claim 4, is characterized in that, the DNA of described coding shRNA contains just like the nucleotide sequence shown in SEQ ID NO:3 or SEQ ID NO:4.

6. the DNA of coding shRNA as claimed in claim 4, is characterized in that, the DNA of described coding shRNA also comprises rna plymerase iii promotor.

7. a recombinant vectors, is characterized in that, described recombinant vectors be

A) multiple clone site of pEN-hH1c plasmid or

B) recombination site of pDSL-hpUGIP plasmid

The recombinant vectors that the DNA of coding shRNA as described in insertion is as arbitrary in claim 4～6 obtains.

8. a recombinant slow virus, is characterized in that, is the recombinant slow virus that as claimed in claim 7 b) described recombinant vectors and envelope vector psPAX2 and package carrier pMD2.G cotransfection mammalian cell obtain.

9. a pharmaceutical composition, it is characterized in that, comprise at least one in the DNA of small molecules interference RNA as claimed in claim 1, shRNA as claimed in claim 3, coding shRNA as claimed in claim 4, as claimed in claim 7 b) described recombinant vectors and described recombinant slow virus as claimed in claim 8.

10. the application of at least one in the DNA of small molecules interference RNA as claimed in claim 1, shRNA as claimed in claim 3, coding shRNA as claimed in claim 4, as claimed in claim 7 b) described recombinant vectors and described recombinant slow virus as claimed in claim 8 in the medicine of preparation inhibition estrogen-related receptor protein gene expression.