CN103695428A - Small interfering RNA (Ribonucleic Acid) and recombinant vector for knocking down Syntaxin8 and application of small interfering RNA and recombinant vector - Google Patents

Abstract

The invention provides a small interfering RNA, an shRNA (Short Hairpin Ribonucleic Acid), an shRNA encoded DNA (Deoxyribonucleic acid), a recombinant vector, a recombinant slow virus and a host cell for knocking down Syntaxin8, as well as application of the small interfering RNA, the shRNA (Short Hairpin Ribonucleic Acid), the shRNA encoded DNA (Deoxyribonucleic acid), the recombinant vector, the recombinant slow virus and the host cell. The small interfering RNA has a nucleotide sequence with the length of 19-27 bp. The nucleotide sequence is complementary with a messenger RNA for translating the Syntaxin8. The recombinant slow virus carrier can be transcribed to obtain Syntaxin8-shRNA. The Syntaxin8-shRNA can be processed by the host cell to generate the small interfering RNA capable of silencing Syntaxin8 expression. The small interfering RNA can target the mRNA of the Syntaxin8, induce mRNA degradation, generate the gene silence effect, and reduce the expression level of Syntaxin8.

Description

For small molecules interference RNA, recombinant vectors and the application thereof of striking low Syntaxin8

Technical field

The present invention relates to molecular biology, genetic engineering technique and biomedicine field, be specifically related to a kind of for striking small molecules interference RNA, recombinant vectors and the application thereof of low Syntaxin8.

Background technology

Syntaxin8 belongs to SNARE family, SNARE plays an important role in cell vesicle transportation, cell vesicle transportation is again in cell and one of the main path of intercellular matter transportation, so it is all significant to studying every cell, tissue, organ and organism vital movement how research SNARE family protein controls Vesicle fusion, and the effect of research Syntaxin6 in signal path is necessary to provide a kind of method and stable clone of striking the expression level of low Syntaxin8 of striking the expression level of low Syntaxin8.

The gene silencing that RNA disturbs (RNA interference, RNAi) to bring out.While importing the double-stranded RNA with endogenous mRNA coding region homology in cell, there is degraded and cause genetic expression reticent in this mRNA, is a kind of effective way that reduces target protein expression level.

Therefore, be necessary to provide a kind of RNA of employing perturbation technique Syntaxin8 to be carried out to method and a kind of stable clone of striking the expression level of low Syntaxin8 of gene silencing.

Summary of the invention

For addressing the above problem, the invention provides a kind of for striking the small molecules interference RNA of low Syntaxin8, coding DNA, recombinant vectors, recombinant slow virus and host cell and the application of shRNA, shRNA.

The mRNA of the direct selectively targeted Syntaxin8 of small molecules interference RNA energy provided by the invention also causes mRNA degraded, produces gene silencing effect; The coding DNA of shRNA provided by the invention, shRNA, recombinant vectors, recombinant slow virus can, by impelling the mRNA degraded expression of reticent Syntaxin8 indirectly of Syntaxin8 in host cell, reduce the expression level of Syntaxin8.

The english abbreviation the present invention relates to and Chinese lexical or textual analysis thereof are as follows:

Syntaxin8: syntaxin 8, the Genebank accession number of described syntaxin 8 is NM_004853.2;

MRNA: messenger RNA(mRNA); SiRNA: small molecules interference RNA; ShRNA: short hairpin RNA;

Syntaxin8-shRNA: the short hairpin RNA with the messenger RNA(mRNA) of target syntaxin 8;

First aspect, the invention provides a kind of small molecules interference RNA, and described small molecules interference RNA has and the nucleotide sequence of translating the messenger RNA(mRNA) complementation of syntaxin Syntaxin8, and length is 19～27bp.

Preferably, the length of described small molecules interference RNA is 21～27bp.

Preferably, the nucleotide sequence of described small molecules interference RNA is as shown in SEQ ID NO:1 or SEQ ID NO:2.

Second aspect, the invention provides a kind of shRNA, and described shRNA has the positive-sense strand of the small molecules interference RNA as described in first aspect or the nucleotide sequence of antisense strand.

Preferably, a kind of shRNA that second aspect present invention provides, for thering is the single stranded RNA of loop-stem structure, described shRNA has the positive-sense strand of small molecules interference RNA or the nucleotide sequence of antisense strand, wherein, described small molecules interference RNA has and the nucleotide sequence of translating the messenger RNA(mRNA) complementation of syntaxin Syntaxin8, and length is 19～27bp.

Preferably, the length of described small molecules interference RNA is 21～27bp.

Preferably, the nucleotide sequence of described small molecules interference RNA is as shown in SEQ ID NO:1 or SEQ ID NO:2.

The third aspect, the invention provides the coding DNA of a kind of shRNA, and described shRNA has the positive-sense strand of the small molecules interference RNA as described in first aspect or the nucleotide sequence of antisense strand.

Preferably, the coding DNA of a kind of shRNA that third aspect present invention provides, described shRNA has the positive-sense strand of small molecules interference RNA or the nucleotide sequence of antisense strand, wherein, described small molecules interference RNA has and the nucleotide sequence of translating the messenger RNA(mRNA) complementation of syntaxin Syntaxin8, and length is 19～27bp.

Preferably, the length of described small molecules interference RNA is 21～27bp.

Preferably, the nucleotide sequence of described small molecules interference RNA is as shown in SEQ ID NO:1 or SEQ ID NO:2.

Preferably, the DNA's of described coding shRNA contains the nucleotide sequence shown in SEQ ID NO:3 or 4.

Particularly, under this optimum condition, described SEQ ID NO:3(5 '-3 ') be:

CCTCTATCATAAGTCGCCAAACTCGAGTTTGGCGACTTATGATAGAGGT?TTTT；

Described SEQ ID NO:4(5 '-3 ') be:

AAAAACCTCTATCATAAGTCGCCAAACTCGAGTTTGGCGACTTATGAT?AGAGG。

Further preferably, 5 ' of the nucleotide sequence shown in described SEQ ID NO:3 and 4 end or 3 ' end have restriction enzyme site.

Still more preferably, the restriction enzyme site of 5 ' of the nucleotide sequence shown in described SEQ ID NO:3 and 4 end is respectively Age I and EcoR I.

Under this optimum condition, the DNA of described coding shRNA has the nucleotide sequence as shown in SEQ ID NO:5 or 6.

Particularly, be described SEQ ID NO:5(5 '-3 '):

CTCGAG TTTGGCGACTTATGATAGAG GTTTTT

Described SEQ ID NO:6(5 '-3 ') be:

AAAAA

CTCGAG TTTGGCGACTTATG ATAGAGG。

Wherein, the base place that two line identify is restriction enzyme site, the positive-sense strand that the sequence that wavy line represents is siRNA, and the antisense strand that the sequence of single line sign is siRNA, the sequence of italic sign is the ring region sequence while forming shRNA hair fastener.

Preferably, the DNA of described coding shRNA also comprises rna plymerase iii promotor.

Further preferably, the U6 promotor in described rna plymerase iii promotor behaviour source or the H1 promotor in people source.

Further preferably, the U6 promotor that described rna plymerase iii promotor is mouse source or the H1 promotor in mouse source.

Fourth aspect, the invention provides a kind of recombinant vectors, the recombinant vectors that the DNA that described recombinant vectors is is the coding shRNA of the recombination site insertion at the multiple clone site of pLKO.1 plasmid, the multiple clone site of pEN-hH1c plasmid or pDSL-hpUGIP plasmid as described in the third aspect at described recombinant vectors obtains.

Preferably, a kind of recombinant vectors that fourth aspect present invention provides, the recombinant vectors that the DNA that described recombinant vectors is the shRNA that encodes for the recombination site at the multiple clone site of pLKO.1 plasmid, the multiple clone site of pEN-hH1c plasmid or pDSL-hpUGIP plasmid inserts at described recombinant vectors obtains, wherein, described shRNA has the positive-sense strand of small molecules interference RNA or the nucleotide sequence of antisense strand, wherein, described small molecules interference RNA has and the nucleotide sequence of translating the messenger RNA(mRNA) complementation of syntaxin Syntaxin8, and length is 19～27bp.

Preferably, the multiple clone site of described pLKO.1 plasmid is Age I and EcoR I restriction enzyme site.

Preferably, the multiple clone site of described pEN-hH1c plasmid is BamHI and XhoI restriction enzyme site.

Preferably, the recombination site of described pDSL-hpUGIP plasmid is attR1 and attR2, and wherein, attR1 is positioned at 2614～2738bp site of pDSL-hpUGIP plasmid, and attR2 is positioned at 4194～4318bp site of pDSL-hpUGIP plasmid.

Preferably, the length of described small molecules interference RNA is 21～27bp.

Preferably, the nucleotide sequence of described small molecules interference RNA is as shown in SEQ ID NO:1 or SEQ ID NO:2.

Preferably, the DNA's of described coding shRNA contains the nucleotide sequence shown in SEQ ID NO:3 or 4.

Particularly, under this optimum condition, described SEQ ID NO:3(5 '-3 ') be:

CCTCTATCATAAGTCGCCAAACTCGAGTTTGGCGACTTATGATAGAGGT?TTTT；

Described SEQ ID NO:4(5 '-3 ') be:

AAAAACCTCTATCATAAGTCGCCAAACTCGAGTTTGGCGACTTATGATAGAGG。

Further preferably, 5 ' of the nucleotide sequence shown in described SEQ ID NO:3 and 4 end or 3 ' end have restriction enzyme site.

Still more preferably, the restriction enzyme site of 5 ' of the nucleotide sequence shown in described SEQ ID NO:3 and 4 end is respectively Age I and EcoR I.

Under this optimum condition, the DNA of described coding shRNA has the nucleotide sequence as shown in SEQ ID NO:5 or 6.

Particularly, be described SEQ ID NO:5(5 '-3 '):

CCGGCCTCTATCATAAGTCGCCAAACTCGAGTTTGGCGACTTATGATAG?AGGTTTTTG；

Described SEQ ID NO:6(5 '-3 ') be:

AATTCAAAAACCTCTATCATAAGTCGCCAAACTCGAGTTTGGCGACTT?ATGATAGAGG。

Under this optimum condition, Age I and EcoR I site that goal gene Syntaxin8-shRNA is inserted into slow virus pLKO.1 plasmid, obtain pLKO.1-Syntaxin8-shRNA carrier.

Preferably, the DNA of described coding shRNA also comprises rna plymerase iii promotor.

Further preferably, the U6 promotor in described rna plymerase iii promotor behaviour source or the H1 promotor in people source.

Further preferably, the U6 promotor that described rna plymerase iii promotor is mouse source or the H1 promotor in mouse source.

The pLKO.1-Syntaxin8-shRNA lentiviral vectors that the present invention builds has very high efficiency of infection and transcribes efficiency, the DNA gene fragment of shRNA of encoding on carrier can be inserted host genome by recombination, thereby continues, the stably expression of reticent Syntaxin8.

The 5th aspect, the invention provides a kind of recombinant slow virus, is the recombinant slow virus that recombinant vectors and envelope vector psPAX2 and package carrier pMD2.G cotransfection mammalian cell obtain as described in fourth aspect.

Preferably, a kind of recombinant slow virus that fifth aspect present invention provides, it is the recombinant slow virus that recombinant vectors and envelope vector psPAX2 and package carrier pMD2.G cotransfection mammalian cell obtain, wherein, the recombinant vectors that the DNA that described recombinant vectors is the multiple clone site insertion coding shRNA at pLKO.1 plasmid obtains, wherein, described shRNA has the positive-sense strand of small molecules interference RNA or the nucleotide sequence of antisense strand, described small molecules interference RNA has and the nucleotide sequence of translating the messenger RNA(mRNA) complementation of syntaxin Syntaxin8, length is 19～27bp.

Preferably, the multiple clone site of described pLKO.1 plasmid is Age I and EcoR I restriction enzyme site.

Preferably, the multiple clone site of described pEN-hH1c plasmid is BamHI and XhoI restriction enzyme site.

Preferably, the recombination site of described pDSL-hpUGIP plasmid is for being attR1 and attR2, and wherein, attR1 is positioned at 2614～2738bp site of pDSL-hpUGIP plasmid, and attR2 is positioned at 4194～4318bp site of pDSL-hpUGIP plasmid.

Preferably, the length of described small molecules interference RNA is 21～27bp.

Preferably, the nucleotide sequence of described small molecules interference RNA is as shown in SEQ ID NO:1 or SEQ ID NO:2.

Preferably, the DNA's of described coding shRNA contains the nucleotide sequence shown in SEQ ID NO:3 or 4.

Particularly, under this optimum condition, described SEQ ID NO:3(5 '-3 ') be:

CCTCTATCATAAGTCGCCAAACTCGAGTTTGGCGACTTATGATAGAGGT?TTTT；

Described SEQ ID NO:4(5 '-3 ') be:

AAAAACCTCTATCATAAGTCGCCAAACTCGAGTTTGGCGACTTATGAT?AGAGG。

Further preferably, 5 ' of the nucleotide sequence shown in described SEQ ID NO:3 and 4 end or 3 ' end have restriction enzyme site.

Still more preferably, the restriction enzyme site of 5 ' of the nucleotide sequence shown in described SEQ ID NO:3 and 4 end is respectively Age I and EcoR I.

Under this optimum condition, the DNA of described coding shRNA has the nucleotide sequence as shown in SEQ ID NO:5 or 6.

Particularly, be described SEQ ID NO:5(5 '-3 '):

CCGGCCTCTATCATAAGTCGCCAAACTCGAGTTTGGCGACTTATGATAG?AGGTTTTTG；

Described SEQ ID NO:6(5 '-3 ') be:

AATTCAAAAACCTCTATCATAAGTCGCCAAACTCGAGTTTGGCGACTT?ATGATAGAGG。

Under this optimum condition, Age I and EcoR I site that goal gene Syntaxin8-shRNA is inserted into slow virus pLKO.1 plasmid, obtain pLKO.1-Syntaxin8-shRNA carrier.

Preferably, the DNA of described coding shRNA also comprises rna plymerase iii promotor.

Further preferably, the U6 promotor in described rna plymerase iii promotor behaviour source or the H1 promotor in people source.

Further preferably, the U6 promotor that described rna plymerase iii promotor is mouse source or the H1 promotor in mouse source.

Preferably, pLKO.1-Syntaxin8-shRNA Lentiviral provided by the invention and package carrier psPAX2 and envelope vector pMD2.G transfection 293T cell are carried out to slow virus packing, can obtain described recombinant slow virus.

The present invention is by being building up to the DNA of coding Syntaxin8-shRNA between the multiple clone site of lentiviral vectors or between recombination site, obtain between multiple clone site that DNA after recombinant slow virus expression vector is building up to lentiviral vectors or between recombination site, obtain after recombinant slow virus expression vector, by transfectional cell, screening stable expression cell line, can build the clone that obtains stably express, realize stable, the long-term expression of goal gene, be very suitable for the RNA the Study of Interference to Syntaxin8.

In addition, lentiviral vectors provided by the invention also can infect after host cell together with slow virus packaging plasmid, obtains the activated recombinant slow virus that can transcribe Syntaxin8-shRNA.Described recombinant slow virus infects after host cell, can be by the gene integration of coding Syntaxin8-shRNA to host cell gene group, contribute to encode Syntaxin8-shRNA stable gene, in host cell, transcribe chronically, thereby obtain small molecules interference RNA, mRNA to Syntaxin8 degrades, and cause gene silencing effect, reduce the expression level of Syntaxin8.

Recombinant slow virus provided by the invention not only has very high efficiency of infection, also there is host range widely, can infect polytype cells such as neurone, myocyte, liver cell, tumour cell, endotheliocyte, seldom cause again the immune response of body, range of application is very extensive.

The 6th aspect, the invention provides a kind of host cell, comprise at least one in DNA, the recombinant vectors as described in fourth aspect and the recombinant slow virus as described in the 5th aspect of small molecules interference RNA as described in first aspect, the shRNA as described in second aspect, the coding shRNA as described in the third aspect.

Preferably, described host cell is 293T cell or Hela cell.

Preferably, described host cell is stable clone of striking the expression level of low Syntaxin8.

Further preferably, described host cell is stable Hela clone of striking the expression level of low Syntaxin8.

The 7th aspect, DNA, the recombinant vectors as described in fourth aspect or the recombinant slow virus as described in the 5th aspect that the invention provides a kind of small molecules interference RNA as described in first aspect, the shRNA as described in second aspect, the coding shRNA as described in the third aspect suppresses the application in the medicine of syntaxin Syntaxin8 genetic expression in preparation.

Coding DNA, recombinant vectors, recombinant slow virus or host cell and the application thereof of described small molecules interference RNA provided by the invention, shRNA, shRNA have following beneficial effect:

The DNA of coding provided by the invention shRNA is building up between the polyclone sequence site of lentiviral vectors or can obtains recombined lentivirus vector between recombination site, after this recombined lentivirus vector transfection host cell, or infect after host cell together with slow virus packaging plasmid, can, by the gene integration of coding Syntaxin8-shRNA to host cell gene group, the stable gene of Syntaxin8-shRNA that contributes to encode, in host cell, transcribe and obtain Syntaxin8-shRN chronically;

Syntaxin8-shRNA provided by the invention can generate the small molecules interference RNA that the reticent Syntaxin8 of energy expresses after host cell processing;

The mRNA of small molecules interference RNA energy target syntaxin Syntaxin8 provided by the invention, and cause described mRNA degraded, and cause gene silencing effect, reduce the expression level of Syntaxin8.

To sum up, the present invention provides a kind of effective RNA jamming program for reducing the expression level of Syntaxin8, and this scheme is preferably and adopts coding DNA, recombinant vectors, recombinant slow virus or the host cell of small molecules interference RNA provided by the invention, shRNA, shRNA to carry out RNA interference.

Accompanying drawing explanation

Fig. 1 be the embodiment of the present invention adopt the plasmid map of pLKO.1 carrier;

The RT-PCR of the mRNA of the Hela cell Syntaxin8 that Fig. 2 provides for the embodiment of the present invention 4 detects knot

Really; The western blot of the Hela cell Syntaxin8 expression amount that Fig. 3 provides for the embodiment of the present invention 4 detects

Result.

Embodiment

The following stated is the preferred embodiment of the present invention; it should be pointed out that for those skilled in the art, under the premise without departing from the principles of the invention; can also make some improvements and modifications, these improvements and modifications are also considered as protection scope of the present invention.

Method used in following embodiment is ordinary method if no special instructions, concrete steps can be referring to: < < Molecular Cloning:A Laboratory Manual > > (Sambrook, J., Russell, David W., Molecular Cloning:A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor).The primer and DNA sequence dna are synthetic by the English Weihe River prompt base (Shanghai) trade Co., Ltd.

The pLKO.1 carrier that the present invention adopts is purchased from Open Biosystems company, and the plasmid map of pLKO.1 carrier respectively as shown in Figure 1; Oligo dT, various restriction enzyme and Taq enzyme are all purchased from TaKaRa company, and T4DNA ligase enzyme is purchased from NEB company, and glue recovery test kit and a small amount of extraction agent box of plasmid are purchased from OMEGA company, and a large amount of extraction agent boxes of plasmid are purchased from Nucleo Bond company; DMEM high glucose medium, foetal calf serum are all purchased from HyClone company; Transfection reagent Magetran is purchased from Origene company; Inverted microscope is Olympus product, and fluorescence inverted microscope is Nikon company product.

The Hela cell culture medium of the embodiment of the present invention is the DMEM high glucose medium containing 10% foetal calf serum.

Unless otherwise noted, other reagent that the present invention adopts are commercial goods.

Embodiment 1

A method of preparing the DNA of the Syntaxin8-shRNA that encodes, comprises the steps:

According to existing people Syntaxin8 sequence and shRNA principle of design in GeneBank sequence library, utilize the online design tool of siRNA (http://www.sirnawizard.com/index.php) to design the coding DNA of people Syntaxin8 sequence (interference fragment), and in NCBI website, the fragment of design is carried out to BLAST checking, the homologous sequence that there is no this fragment in other gene (except Syntaxin8) of underwriter, obtains following sequence:

Syntaxin8-shRNA（SEQ?ID?NO:3）（5’-3’）：

CCTCTATCATAAGTCGCCAAACTCGAGTTTGGCGACTTATGATAGAGG?TTTTT；

Syntaxin8-shRNA（SEQ?ID?NO:4）（5’-3’）：

AAAAACCAGAGGATCTCTTCTAACATCTCGAGATGTTAGAAGAGATCCTCT?GG；

And introduce respectively the restriction enzyme site of restriction enzyme A ge I and EcoR I, synthetic obtain as follows

The primer sequence of Syntaxin8-shRNA:

Syntaxin8-shRNA-F（SEQ?ID?NO:5）（5’-3’）：

CCTCTATCATAAGTCGCCAAACTCGAGTTTGGCGACTTATGATA?GAGGTTTTT

Syntaxin8-shRNA-R（SEQ?ID?NO:6）（5’-3’）：

AAAAACCTCTATCATAAGTCGCCAAACTCGAGTTTGGCGACTTATG?ATAGAGG；

In described SEQ ID NO:5 and SEQ ID NO:6, underscore is partly respectively the restriction enzyme site of Age I and EcoR I.

Embodiment 2

The construction process of a kind of slow virus recombinant vectors pLKO.1-Syntaxin8-shRNA, by the mode of application DNA Subcloned technology, after synthetic interference fragment Syntaxin8-shRNA-F and Syntaxin8-shRNA-R are mixed and annealing, by sticky end, be connected to Age I and the micro-point of EcoR I polyclone of carrier pLKO.1, obtain pLKO.1-Syntaxin8-shRNA slow virus recombinant vectors, will obtain the slow virus recombinant vectors pLKO.1-Syntaxin8-shRNA evaluation of checking order.

Specifically comprise the following steps:

1, interfere fragment annealing

Newly synthetic paired interference fragment is dissolved as to 50uM solution, after drawing respectively 10uL and mixing, puts into 95 ℃ of water-bath 10min in PCR pipe, close immediately waters and be naturally cooled to room temperature.

Reaction system is as follows:

Total system	20μl
		Syntaxin8-shRNA-F	10μl
Syntaxin8-shRNA-R	10μl

2, empty carrier pLKO.1 double digestion and glue reclaim

1) empty carrier pLKO.1 double digestion

PLKO.1 empty carrier is carried out to double digestion by restriction enzyme A ge I and EcoR I, and reaction system is as follows:

Total system	20μl
		10xdisgestion?Buffer	2μl
PLKO.1 empty carrier	5μl
		Age I and EcoR I	1μl
MiliQ-H2O	12μl

Prepare after fully mixing and put into 37 ℃ of water-baths 3 hours, electrophoresis detection.

2) enzyme is cut to product and carried out glue recovery

Adopt the pillar DNA glue recovery test kit purifying enzyme of biological (Beijing) company limited of day root to cut product.Method is as follows:

Column equilibration step: add 500ul balance liquid BL in adsorption column CA2, the centrifugal 1min of 12,000rpm, outwells the waste liquid in collection tube, relays adsorption column to reclaim in collector;

Single target DNA band is cut and puts into clean centrifuge tube from sepharose, take weight;

In blob of viscose, add 3 times of volume sol solutions PN;

10min is placed in 50 ℃ of water-baths, constantly leniently spins upside down centrifuge tube therebetween, to guarantee that blob of viscose fully dissolves;

Previous step gained solution is added in an adsorption column CA2, and room temperature is placed 2min, and the centrifugal 30-60sec of 12,000rpm, outwells the waste liquid in collection tube, and adsorption column CA2 is put into collection tube;

In adsorption column CA2, add 600ul rinsing liquid PW, the centrifugal 30-60sec of 12,000rpm, outwells the waste liquid in collection tube, and adsorption column CA2 is put into collection tube.Repetitive operation step 5;

Adsorption column CA2 is put back in collection tube, and the centrifugal 2min of 12,000rpm eliminates rinsing liquid as far as possible.Adsorption column CA2 is placed in to room temperature and places several minutes, dry up hill and dale;

Adsorption column CA2 is put in a clean centrifuge tube, to the appropriate sterilized water of the unsettled dropping in adsorption film mid-way, (elution buffer E B should be placed in 65-70 ℃ of water-bath preheating), room temperature is placed 2min.The centrifugal 2min of 12,000rpm collects DNA solution.

3, interfere connection and the conversion of fragment and empty carrier pLKO.1

With the resulting annealing fragment of previous step and pLKO.1 carrier enzyme, cut back to close product and be connected (ratio control of object fragment and carrier is at 3:1-6:1), reaction system is prepared as follows:

Total system	20μl
		10×Ligation?Buffer	2μl
Annealing product	5μl
		PLKO.1 carrier	8μl
T4DNA ligase enzyme	1.5μl
		MiliQ-H2O	3.5

Prepare and be put in 16 ℃ after fully mixing and connect 12 hours.

Connection product is transformed.Step of converting is as follows: 1. get in 100 μ l competent cell ice baths and melt; 2. rapidly connection product is added in competent cell, mix gently rear ice bath 30 minutes; 3. 42 ℃, heat shock 30 seconds, cooling 2 minutes of ice bath; 4. add SOC substratum 1000 μ l, be put in 37 ℃ of thermostat containers and cultivate 1 hour; 5. get and be applied in right amount LB culture plate (amicillin resistance) above, be inverted in incubated overnight in 37 ℃ of thermostat containers.

4, the extraction of recombinant plasmid pLKO.1-Syntaxin8-shRNA and evaluation

The single bacterium colony of picking carries out the extraction of plasmid, and chooses suitable restriction endonuclease and carry out enzyme and cut detection, take and guarantees that the Insert Fragment of carrier is goal gene.Concrete operation step carries out according to sky root test kit specification sheets.

1) in adsorption column CP3, (adsorption column is put into collection tube) adds the balance liquid BL of 500ul, and the centrifugal 1min of 12000rpm, outwells the waste liquid in collection tube, and adsorption column is relay and reclaimed in collector.

2) get the bacterium liquid of 1-5ml incubated overnight, add in centrifuge tube, use conventional desk centrifuge, the centrifugal 1min of 12000rpm absorbs supernatant as far as possible.

3) to leaving in the centrifuge tube of bacterial sediment, add 250ul solution P1, use pipettor or the vortex vibrator bacterial precipitation that thoroughly suspends.

4) in centrifuge tube, add 250ul solution P2, leniently spin upside down and make the abundant cracking of thalline for 6-8 time.

5) in centrifuge tube, add 350ul solution P3, leniently spin upside down 6-8 time immediately, fully mix, now will occur white flocks.The centrifugal 10min of 12000rpm.

6) supernatant liquor of previous step being collected is transferred in adsorption column CP3 with pipettor, the sucking-off precipitation of noting trying not.The centrifugal 30-60sec of 12000rpm, outwells the waste liquid in collection tube, and adsorption column CP3 is put into collection tube.

7) in adsorption column CP3, add 600ul rinsing liquid PW, the centrifugal 30-60sec of 12000rpm, outwells the waste liquid in collection tube, and adsorption column CP3 is put into collection tube.

8) repetitive operation step 7.

9) adsorption column CP3 is put into collection tube, the centrifugal 2min of 12000rpm.

10) adsorption column CP3 is placed in to a clean centrifuge tube, to the middle part dropping 50-100ul MlliQ-H2O of adsorption film, room temperature is placed 2min, and 12000rpm is centrifugal, and 2min collects plasmid solution in centrifuge tube.

After plasmid extraction completes, carry out Age I and EcoR I double digestion and identify.

After electrophoresis detection, the plasmid that is tentatively defined as positive colony is delivered to the English Weihe River prompt base (Shanghai) trade Co., Ltd and checked order, choose positive colony called after pLKO.1-Syntaxin8-shRNA.

Embodiment 3

PLKO.1-Syntaxin8-shRNA slow virus packing and a method of producing, comprise the following steps:

1) 293T cell bed board (during bed board with common pH7.4 DMEM perfect medium), the 293T cell of the normal about 85-95% of density cultivating in 6cm flat board, one-to-two is (about 6*10 in two new 6cm flat boards ⁵individual cell), after bed board, 12-18h is the best transfection time;

2) transfection: change liquid with the DMEM perfect medium of pH7.4 before transfection.Get two 1.5ml EP pipes, add respectively 300ul DMEM perfect medium, plasmid pLKO.1-Syntaxin8-shRNA4ug, envelope vector psPAX23ug and package carrier pMD2.G1ug are dissolved in EP pipe, 24ul polyjet transfection reagent is dissolved in another EP pipe, tentatively mix in the EP pipe that rear immigration contains plasmid, further soft piping and druming mixes for several times, after standing 15min, dropwise evenly adds in the flat board for the treatment of transfection;

3), after transfection 13-18h, with the DMEM perfect medium 3ml of common pH7.4, change liquid.48h after transfection respectively, 72h, 96h, at fluorescence microscopy Microscopic observation, takes pictures, and connects simultaneously and receives 3 virus stock solution useds, and first the virus stock solution used of results can be kept in 4 ℃ of refrigerators, obtains pLKO.1-Syntaxin8-shRNA slow virus;

4) virus is concentrated: the virus of three results is concentrated with 0.45um membrane filtration and removed cell debris, virus stock solution used after getting 15ml and filtering is in 100kD ultrafiltration post collecting tank, 4 ℃, the centrifugal 25-30min of 4000g, the about 200ul virus of residue concentrated solution in collecting tank, carry out virus titer mensuration, 50ul/ pipe is sub-packed in 1.5ml EP pipe, puts-80 ℃ and can preserve for a long time.

For absolutely proving beneficial effect of the present invention, the present invention also provides a kind of and has adopted the pLKO.1-Syntaxin8-shRNA slow virus that the present embodiment provides to prepare the clone that steady decrease Syntaxin8 expresses, comprise the steps: to get pLKO.1-Syntaxin8-shRNA slow virus infection (infect) Hela cell prepared by the present embodiment, cell by puromycin screening-gene group stable integration shRNA sequence, obtain stable clone of striking low Syntaxin8 gene, the clone of can steady decrease Syntaxin8 expressing.

Embodiment 4

A preparation method for the clone that steady decrease Syntaxin8 expresses, comprises the steps:

(1) determine the G418 concentration of suitable concn in screening culture medium

The preparation of G418: preparation 1M HEPES:23.8g HEPES powder is dissolved in 100ml ddH2O, and 10NNaOH regulates pH to 7.3, filtration sterilization, 4 ℃ of preservations, final concentration is 1mol/L;

Preparation screening culture medium: be 0 μ g/ml, 200 μ g/ml, 300 μ g/ml, 400 μ g/ml, 500 μ g/ml, 600 μ g/ml, 700 μ g/ml, 800 μ g/ml, 900 μ g/ml, 1000 μ g/ml, 1100 μ g/ml, 1200 μ g/ml24 orifice plates by G418 dilution with substratum, every hole 1ml substratum (perfect medium that contains G418), 4 repetitions of each concentration, change liquid at every turn and need each concentration substratum 4ml, matching while using;

(2) frozen cell recovery is cultivated, gone down to posterity and make cell reach good growth conditions 3 to 4 times, paving 24 orifice plates (20000/ hole), 12h changes liquid, adds screening culture medium and cultivates;

Determine the best screening concentration of G418: substratum in culture hole is absorbed, and PBS washs once, and every hole adds different concns screening culture medium, changes every other day primary screening substratum, cultivates 10-14 days, and the whole dead concentration of the minimum cell of take is benchmark; The best screening concentration that the present embodiment obtains is 1200 μ g/ml;

(3) Magetran reagent transfection attached cell and resistant cell clone's screening

Inoculation Hela cell to 6 orifice plate, is cultured to and when density is about 70%～80%, can be used for transfection with the DMEM high glucose medium containing 10% foetal calf serum;

By Magetran reagent and pLKO.1-Syntaxin8-shRNA plasmid solution balance to room temperature, in centrifuge tube, prepare following mixed solution: 200 μ l opti-DMEM, 2 μ gpLKO.1-Syntaxin8-shRNA plasmids, 6 μ l Magetran transfection reagents, concussion mixes rear standing incubated at room 15min;

After the substratum of more renewing to cell, mixed solution is added in culture plate, shake up, then being placed in 37 ℃, 5%CO2 incubator cultivates, cultivate 12 and as a child removed substratum, being replaced by the fresh DMEM high glucose medium containing 10% foetal calf serum continues to cultivate, transfection adds best screening concentration substratum after 24 hours, change every other day liquid; Changing liquid 1 after twice (overnight incubation after changing liquid), when cell reaches 50%-80%, all nutrient solutions of sucking-off, centrifugal 3000-4000rpm, sucts 0.22 μ m clearly and filters, and adds the fresh best screening concentration nutrient solution of 2 times of volumes, mix 4 ℃ standby; While cultivating left and right cell mortality in 6 days, can use adaptability substratum instead, or can increase serum-concentration and cultivate, for example, originally use 10% serum, now can adopt 20% serum; Cultivate and after 10 days, G418 concentration is reduced by half, maintain screening pressure; Screen and within approximately 14 days, have as seen afterwards resistance clone to occur, choose mono-clonal, mark positive colony under high power lens, adopts cover around-France or scrape division and be combined with limit dilution method screening positive clone, is proceeded to porous plate and cultivates.

The present embodiment passes through after pLKO.1-Syntaxin8-shRNA recombinant vectors transfection Hela cell, use the DMEM high glucose medium (G418 concentration is 1200 μ g/ml) containing 10% foetal calf serum to screen, obtain resistance clone, wherein, in containing the nutrient solution of G418, the necrocytosis of untransfected plasmid; Again the resistant cell of acquisition being mixed to clone carries out obtaining the strain of monoclonal anti sexual cell after serial dilution, evaluation, selection with G418 again, stablely strike low Syntaxin8(Syntaxin8knock-down) Hela clone, this stable Hela clone of striking low Syntaxin8 continues cultivation with the DMEM high glucose medium of 10% foetal calf serum.

In order to absolutely prove beneficial effect of the present invention, the clone mono-clonal that the present embodiment is also expressed gained steady decrease Syntaxin8 is identified: comprise the expression of RT-PCR testing goal gene; And the genetic expression of western testing goal, step is as follows:

1, the expression of real-time-PCR testing goal gene

The cell that gained steady decrease Syntaxin8 is expressed carries out the extraction of total RNA, meanwhile, the Hela cell of untransfected pLKO.1-Syntaxin8-shRNA is set as blank.Then reverse transcription becomes cDNA template, and whether the mRNA that detects Syntaxin8 with the specific primer designing transcribes:

Upstream primer (SEQ ID NO:7): 5 '-AAACTTCGCAATGAAACCAGG-3 '

Downstream primer (SEQ ID NO:8): 5 '-ACAACCACGATAGCCACAAG-3 ';

The key step that total RNA extracts is:

1) substratum in sucking-off Tissue Culture Dish, softly cleans after cell with PBS, sucks PBS;

2) every 10cm ²the culture dish of area adds the Trizol of 1mL;

3) directly in culture dish, with rifle piping and druming cell, make for several times lysis, mixed solution is proceeded in a clean centrifuge tube without RNA enzyme;

4) the standing 5min of room temperature makes the complete cracking of nucleoprotein complex;

5) Trizol of every 1mL adds the chloroform of 0.2mL, carefully builds centrifuge tube lid;

6) violent vortex vibration 15s;

7) the standing 2～3min of room temperature;

8) 4 ℃, the centrifugal 15min of 12000 * g;

9) by 45 ° of the careful inclinations of centrifuge tube, carefully upper strata aqueous phase solution is transferred in another centrifuge tube;

10) add and the Virahol (contributing to reject the interference of small segment) of upper water equal volume or the dehydrated alcohol of 2～3 times of volumes, mix;

11) the standing 10min of room temperature;

12) 4 ℃, the centrifugal 10min of 12000 * g; (RNA can be attached on the pipe end or tube wall by formation gelatinous precipitate after centrifugal.）

13) abandon supernatant, 80% ethanol that the Trizol of every 1mL adds distilled water that 1mL was processed by DEPC now to join.Of short duration vortex sample, then 4 ℃, the centrifugal 5min of 7500 * g; Carefully outwell elutant, and suck the unnecessary liquid in the pipe end with 20 μ L liquid-transfering guns, rifle head is not met RNA; And in clean environment, place and within several minutes, make that RNA precipitation is dry (does not allow RNA complete drying, because can make like this solubility of RNA reduce; Being partly dissolved of RNA makes A260/280<1.6);

14) with appropriate (20-50 μ L), be warmed to the DEPC water dissolution RNA precipitation of 55 ℃, then place several minutes (hydrotropy) for 55～60 ℃, quantitatively;

15) proceed follow-up test, or RNA solution is positioned over to-80 ℃ of preservations.

Reverse transcription step: the total RNA extracting is carried out to concentration determination, add the total RNA of 2 μ g, 1 μ l oligo (dT), adds DEPC water to 12 μ l, hatches 5 minutes at 68 ℃.After taking out product, place immediately 2-5 minute on ice, add respectively 4 μ l Reaction Buffer, 2 μ l10mM dNTP Mix, 1 μ l Reverse Transcriptase, MMLV-Reverse and 1 μ l RNase Inhibitor.At 42 ℃, hatch 60 minutes, after the product of acquisition is diluted, obtain cDNA template.With our Auele Specific Primer of design, carry out pcr amplification, the reaction conditions of amplification is: 94 ℃ of denaturations 2 minutes, and with 98 ℃ of sex change 10 seconds, 59 ℃ of annealing 30 seconds, 68 ℃ are extended 1 minute 30 seconds, 35 circulations of increase, then with 72 ℃ of fully extensions 10 minutes.System is 10ul, is formulated as follows:

The real-time PCR detected result of the present embodiment as shown in Figure 2.In Fig. 2, as shown in Figure 2, compare control group (the Hela groups of cells of the unloaded transfection of pLKO.1), via the mRNA of Syntaxin8 in the Hela groups of cells (experimental group) of pLKO.1-Syntaxin8-shRNA transfection, obviously reduce.

2, western blot testing goal genetic expression

The stable Hela clone of striking low Syntaxin8 that normal Hela cell and the present embodiment are provided is received sample simultaneously and is done Protein Detection: first, after removing substratum, add 4 ℃ of PBS that cell is scraped off and puts into 15ml centrifuge tube with cell, 2000 to turn 5min centrifugal, remove supernatant, more every pipe adds 1ml4 ℃ of PBS that cell precipitation is blown and transfers in 1.5ml EP pipe recentrifuge after even and remove supernatant; Then start lysing cell, by RAPA fine melt liquid and proteinase inhibitor, the ratio of 100:1 is added in cell precipitation after mixing, and 4 ℃ are rocked after cracking 1h, and 4 ℃ 14000 leaves the heart, and getting supernatant is sample; Last test sample product protein concentration, and add Loading buffer to boil 8min, then leveling applied sample amount runs glue with SDS-polyacrylate hydrogel electrophoresis; Electrophoresis 3 hours, transferring film 2 hours, antibody incubation afterwards, primary antibodie 2 hours, two anti-1 hour, colour developing exposure, wherein, primary antibodie is the Syntaxin8 antibody (poly Ab rabbit) of Sigma company, article No.: S8945).

As shown in Figure 3, actin is internal reference to western blot result, and STX8 represents Syntaxin8 albumen, and pLKO-ctrl swimming lane and pLKO-STX8 swimming lane represent respectively the result of control group and experimental group; As shown in Figure 3, the expressing quantity of Syntaxin8 is than the obvious reduction of normal cell, illustration purpose gene (DNA of the Syntaxin8-shRNA that encodes) can stable continue to transcribe in striking low Syntaxin8 clone provided by the invention, and produce siRNA, mRNA to Syntaxin8 degrades, thereby reduces the expression level of Syntaxin8.

The foregoing is only preferred embodiment of the present invention, not in order to limit the present invention, all any modifications of doing within the spirit and principles in the present invention, be equal to and replace and improvement etc., within all should being included in protection scope of the present invention.

Claims (10)

1. a small molecules interference RNA, is characterized in that: described small molecules interference RNA has and the nucleotide sequence of translating the messenger RNA(mRNA) complementation of syntaxin Syntaxin8, and length is 19～27bp.

2. small molecules interference RNA as claimed in claim 1, is characterized in that, the nucleotide sequence of described small molecules interference RNA is as shown in SEQ ID NO:1 or SEQ ID NO:2.

3. a shRNA, for having the single stranded RNA of loop-stem structure, is characterized in that, described shRNA has as the nucleotide sequence of the positive-sense strand of claim 1 or small molecules interference RNA claimed in claim 2 or antisense strand.

4. an encode DNA of shRNA, is characterized in that, described shRNA has as the nucleotide sequence of the positive-sense strand of claim 1 or small molecules interference RNA claimed in claim 2 or antisense strand.

5. the DNA of coding as claimed in claim 4 shRNA, is characterized in that, the DNA's of described coding shRNA contains the nucleotide sequence shown in SEQ ID NO:3 or SEQ ID NO:4.

6. the DNA of coding shRNA as claimed in claim 4, is characterized in that, the DNA of described coding shRNA also comprises rna plymerase iii promotor.

7. a recombinant vectors, it is characterized in that the recombinant vectors that described recombinant vectors obtains for insert the DNA of the coding shRNA as described in as arbitrary in claim 4～6 at the recombination site of the multiple clone site of pLKO.1 plasmid, the multiple clone site of pEN-hH1c plasmid or pDSL-hpUGIP plasmid.

8. a recombinant slow virus, is characterized in that, is b as claimed in claim 7) recombinant slow virus that obtains of described recombinant vectors and envelope vector psPAX2 and package carrier pMD2.G cotransfection mammalian cell.

9. a host cell, it is characterized in that, comprise the DNA of small molecules interference RNA as claimed in claim 1, shRNA as claimed in claim 3, coding shRNA as claimed in claim 4, b as claimed in claim 7) described recombinant vectors and at least one in described recombinant slow virus as claimed in claim 8.

10. the DNA of small molecules interference RNA as claimed in claim 1, shRNA as claimed in claim 3, coding shRNA as claimed in claim 4, b as claimed in claim 7) described recombinant vectors and at least one in described recombinant slow virus as claimed in claim 8 suppress the application in the medicine of syntaxin Syntaxin8 genetic expression in preparation.

Images