CN116121270A - Rice organ development and yield regulation gene and application thereof - Google Patents

Abstract

The invention discloses a rice organ development and yield regulation gene and application thereof, belonging to the field of plant genetic breeding, wherein the gene is formed by adding one base A after the 35 th base of a rice OsHY1 gene, is favorable for analyzing a mechanism of regulating and controlling the growth and development of rice by light, and is capable of cultivating high-yield and high-quality rice varieties, and can be applied to regulating and controlling leaf photosynthesis, regulating and controlling the plant height of rice, regulating and controlling the field yield of rice and regulating and controlling the root development of rice.

Description

Rice organ development and yield regulation gene and application thereof

Technical Field

The invention relates to a rice organ development and yield regulation gene and application thereof, belonging to the technical field of plant genetic breeding.

Background

Rice is one of the main grain crops, and high-yield and high-quality rice is generally determined by a plurality of characters, including flowering period, plant height, tillering, root development and the like. The different external growth environments directly influence the growth and development of crops, thereby influencing the growth period of the crops such as rice and the absorption of the root system to nutrients. The flowering time of crops such as rice and the like and the absorption of nutrient substances by root systems are key indexes for determining the yield and the quality. At present, molecular mechanism research of the external growth environment on plant flowering and root system development is mainly under stress such as high temperature, drought and the like, and research of light signal response genes in regulating flowering phase and root system development is not mature.

The external light environment participates in the whole life cycle process of regulating and controlling the growth of plants, and the plants can sense external light signals in different periods of growth and development. After the seedlings sense the light signals, the plants promote chloroplast development, development of the hypocotyl overhead hooks, cotyledon expansion and the like by inducing related gene expression, and the growth development mode is called photomorphogenesis. Interaction of the Arabidopsis thaliana light receptor CRY1 with GID1 and DELLA proteins regulates gibberellin signaling and photomorphogenesis. After the plants receive the light signals, phytohormone auxin and the like accumulate on the overground part and then are transported to the underground part to promote root system development. The light signal also affects the growth period of the crop and thus the nutrient absorption and yield. When the external environment changes, the plant can quickly change the root system configuration to regulate and control the nutrition absorption. Blue light promotes phosphorus deficiency induced primary root growth inhibition through long-distance signal HY 5. Under the illumination condition, the arabidopsis HY1 maintains the polar transportation of auxin and the accumulation of auxin in a root tip signal oscillation area by inducing the expression of transcription factor HY5 and homologous gene HYH thereof, so as to induce the periodical occurrence of root system biological clock and lateral roots. The high yield and quality of modern crops are very dependent on the absorption efficiency of the root system to nutrients. Therefore, the optical signal is important in regulating and controlling the morphogenesis of plant root systems.

Rice OsHY1 is a homologous gene of arabidopsis thaliana, is an important functional element in the photosynthesis process of plants, and is mainly involved in biosynthesis of photosensitive pigment chromophores. A rice single base insertion mutant hy1 for regulating and controlling flowering phase, plant height, root elongation and yield is constructed and obtained by using the Crispr-cas9 technology, which shows that the OsHY1 gene plays an important role in regulating and controlling the growth phase and root development process of rice. At present, the research on key regulatory factors in the optical signal path in the aspects of rice growth period, root development, yield and the like is obviously insufficient.

Disclosure of Invention

The invention aims to overcome the defects in the prior art, provides a rice organ development and yield regulation gene and application thereof, is favorable for analyzing a mechanism of regulating the growth and development of rice by light, and is favorable for cultivating high-yield and high-quality rice varieties.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

in a first aspect, the invention provides a rice organ development and yield regulation gene, wherein the gene is obtained by adding one base A after the 35 th base of the rice OsHY1 gene.

With reference to the first aspect, further, the nucleotide sequence of the gene is shown in SEQ ID NO. 1.

Further, the gene is expressed in the root tip vascular and lateral root primordia of rice.

Use of a gene for regulating organ development and yield in rice according to any of the preceding claims, or of a biological material containing said gene in plant breeding, enabling the following applications:

regulating and controlling photosynthesis of leaves;

regulating and controlling the plant height of the rice;

regulating and controlling the field yield of the rice;

regulating and controlling the root system development of the rice.

Further, the field yield includes tillering number, individual plant yield and thousand kernel weight.

A method for preparing a plant of a rice organ development and yield regulating gene according to any one of the preceding claims, said method comprising the steps of:

carrying out gene mutation on a target site selected on a first exon of the rice OsHY1 gene to obtain a target gene;

amplifying the target gene, extracting plasmid,

transferring the extracted plasmid into a rice wild type strain by an agrobacterium-mediated method to obtain a target plant.

Compared with the prior art, the invention has the beneficial effects that:

the invention separates and clones the gene OsHY1 related to rice organ development and yield regulation, and obtains the OsHY1 mutant plant by gene knockout technology;

the field test and analysis prove that the OsHY1 mutant plant has the effects of advancing the growth period, yellowing leaves, shortening plant height and promoting root elongation, and the OsHY1 mutant gene is proved to directly regulate and control the heading and flowering of rice, and simultaneously participates in the photosynthesis and root development process of the rice, so that a theoretical foundation is established for the improvement and application of rice varieties in the future.

Drawings

FIG. 1 is a construction process diagram of an OsHY1 knockout mutant and a promoter fusion GUS transgenic plant provided by an embodiment of the invention; wherein A is a CDS pattern diagram of a rice OsHY1 genome DNA and a coding region, gRNA is a CRISPR-Cas9 knockout site of an exon coding region, B is a schematic diagram of a mutant mutation site of a rice OsHY1 knockout mutant, and C is a schematic diagram of construction of a transgenic vector of a rice OsHY1 promoter fusion GUS protein;

FIG. 2 is a graph showing the contrast of the OsHY1 gene regulation rice growth period and plant height provided by the embodiment of the invention; wherein A is a contrast chart of the growth period of wild rice and OsHY1 gene regulated rice; b is a wild type and rice OsHY1 gene mutant strain height comparison chart; c is a histogram of flowering time and plant height statistical analysis of the rice OsHY1 gene mutant in the growth period;

FIG. 3 is a graph showing the phenotype and yield analysis of the OsHY1 gene of rice according to the embodiment of the invention; wherein A is a rice OsHY1 gene mutant mature period field phenotype comparison chart; b is a rice OsHY1 gene mutant single plant yield comparison chart; c is a histogram of statistical analysis of plant height, tillering number, single plant yield and thousand grain weight of the rice OsHY1 gene mutant in the mature period;

FIG. 4 shows root tissue specific expression analysis of the rice OsHY1 gene mutant provided by the embodiment of the invention; wherein a is a chemical staining chart of a lateral root primordium of the rice OsHY1 gene promoter fusion protein GUS transgenic seedling, and b is a histochemical staining chart of root tip tissue;

FIG. 5 is a graph of the generation of lateral roots and elongation of principal roots of an optical signal according to an embodiment of the present invention; wherein A is a root phenotype graph obtained after the wild type and hy1 knockout mutant germinate for 3d and then transfer to a continuous illumination or dark condition for 5d growth, and B is a rice main root length and lateral root number statistical analysis histogram under different illumination conditions;

FIG. 6 is a phenotype chart of the root tip meristem regulated by the optical signal according to HY1 according to the embodiment of the invention; wherein A is a phenotype chart of a root tip meristem of a wild type, hy1 knockout mutant after germination for 3d, and transferred to a condition of continuous illumination or darkness for 3d growth; b is a histogram of statistical analysis of the length and number of the root tip meristematic regions of the rice under different illumination conditions.

Detailed Description

The present invention will be further described with reference to the accompanying drawings, and the following examples are only for more clearly illustrating the technical aspects of the present invention, and are not to be construed as limiting the scope of the present invention.

Example 1

In the embodiment, the cultivation and identification of rice OsHY1 gene mutant plants are carried out, and as shown in the figure 1, the construction process diagram of the OsHY1 knockout mutant and the promoter fusion GUS transgenic plant provided by the embodiment of the invention is shown; wherein A is a CDS mode diagram of genomic DNA and a coding region of the rice OsHY1, gRNA in the diagram is an exon coding region CRISPR-Cas9 knockout site, B is a schematic diagram of a mutant mutation site of the rice OsHY1 knockout mutant, and C is a schematic diagram of construction of a transgenic vector of a rice OsHY1 promoter fusion GUS protein.

Culturing OsHY1 gene mutant plants:

target site selection: according to the rice OsHY1 gene sequence, a CRISPR-Cas9 system is utilized to design a gRNA target site, 2 targets are designed for the target gene to improve mutation efficiency and are respectively positioned on the 1 st exon of the OsHY1, and as shown in A in figure 1, the forward and reverse joint primer sequences of the target site are as follows: osU6aT1F gccgACGTCGCCGCGAGTGCGTTG (SEQ ID NO. 2)

OsU6aT1R:aaacCAACGCACTCGCGGCGACGT(SEQ ID NO.3)

OsU6bT2F:gttgACGTCGTTGCCCTTCTTGCA(SEQ ID NO.4)

OsU6bT2R:aaacTGCAAGAAGGGCAACGACGT(SEQ ID NO.5)

First round PCR amplification: the synthesized target site gRNA adaptor primer sequences were dissolved in water, and 5. Mu.l of each of the upstream and downstream primers was placed in a PCR apparatus, and incubated at 95℃for 30s to anneal to a double-stranded structure.

Ligation of the gRNA expression cassette vector: first, the gRNA expression cassette vector (intermediate vector) pYLgRNA-OsU a/LacZ and pYLgRNA-OsU b were digested with BsaI endonuclease at 37℃for 4h to form a linear structure. The target site adaptor primer duplex was then ligated to the corresponding gRNA expression cassette vectors pYLgRNA-OsU a/LacZ and pYLgRNA-OsU b using T4 ligase for 90min at 16 ℃.

Second round PCR amplification: after the expression cassette vector connection is completed, forward and reverse primers Uctcg-B1'/gRctga-B2 and Uctga-B2'/gRcggt-BL at specific positions on the gRNA expression vector are used for amplifying corresponding U# -T1-gRNA and U# -T2-gRNA respectively; the primer sequences are as follows:

Uctcg-B1’:TTCAGAggtctcTctcgACTAGTGGAATCGGCAGCAAAGG(SEQ ID NO.6)

gRctga-B2:AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC(SEQ ID NO.7)

Uctga-B2’:TTCAGAggtctcTctgaCACTGGAATCGGCAGCAAAGG(SEQ ID NO.8)

gRcggt-BL:AGCGTGggtctcGaccgACGCGTCCATCCACTCCAAGCTC(SEQ ID NO.9)

golden Gate ligation and transformation: and after the amplified product is subjected to gel cutting recovery, adopting a Golden Gate connection method, selecting BsaI endonuclease and T4 ligase to carry out edge cutting connection, connecting the amplified product to a kanamycin-resistant expression vector (final vector) pYLCRISPR/Cas9-MH, converting the amplified product into escherichia coli DH5 alpha, and selecting a monoclonal in a kanamycin-resistant culture medium plate for PCR amplification and sequencing verification. Plasmids were extracted and transformed into Agrobacterium (EH 105), and transformed into rice wild type against the Wuzhuang japonica by Agrobacterium-mediated heritage transformation.

Screening and identifying OsHY1 gene mutant plants: firstly, positive T1 generation transgenic lines are obtained through hygromycin resistance screening, and then, the T1 transgenic lines are subjected to PCR amplification to select lines containing cas9 gene sequences. In addition, the target gene sequence containing the target site is amplified by PCR, and the target gene sequence is sequenced and compared with the wild-type target gene sequence to judge the mutation site. As a result, it was found that the mutant strain hy1 had one single base A inserted in the first exon, as shown by B in FIG. 1.

The nucleotide sequence of the obtained rice OsHY1 gene mutant is shown as SEQ ID NO. 1.

Example two

In the embodiment, the rice gene mutant OsHY1 is used for regulating and controlling the rice growth period and the field yield.

The OsHY1 mutant strain and wild type material with Wuyunjing as background are planted at intervals of 20cm by 15cm in each hole on a white horse experimental base (long sunshine) of Nanjing agricultural university, and nitrogen application level is 250kg/hm in Nanjing.

FIG. 2 is a diagram showing the contrast of the growth period and plant height of wild type and OsHY1 gene regulated rice, wherein A is a diagram showing the contrast of the growth period of wild type and OsHY1 gene regulated rice; b is a wild type and rice OsHY1 gene mutant strain height comparison chart; c is a histogram of flowering time and plant height statistical analysis of the rice OsHY1 gene mutant in the growth period. As can be seen from the analysis of fig. 2: observation of OsHY1 mutant lines and Wuyujing wild type field planting growth period, wherein compared with the wild type, the OsHY1 mutant lines have the advantages of early heading and flowering, short plant height and yellowing leaves.

In addition, whole plant samples of each material were collected at maturity and analyzed for individual yield, effective tillering and thousand kernel weight for each mutant strain and wild type, respectively. As shown in FIG. 3, the rice OsHY1 mutant gene field phenotype and yield analysis chart provided by the embodiment of the invention are shown, wherein A is a rice OsHY1 gene mutant mature period field phenotype comparison chart; b is a rice OsHY1 gene mutant single plant yield comparison chart; c is a statistical analysis histogram of plant height, tillering number, single plant yield and thousand grain weight of the rice OsHY1 gene mutant at the mature period, and the OsHY1 mutant line has lower yield and reduced tillering compared with the wild type strain in a long-day environment.

Example III

The embodiment researches the regulation and control of the rice OsHY1 gene mutant on the morphogenesis of the rice root system, and specifically comprises the following steps:

firstly, culturing and identifying a GUS transgenic line with pHY1, intercepting 2039bp forward of an OsHY1 initial codon as a promoter, wherein the specific nucleotide sequence is shown as SEQ ID NO.10, connecting the full-length promoter sequence of the OsHY1 to clone into a PCAMBIA1381Z vector, and the amplification primer sequence is shown as SEQ ID NO.11 and SEQ ID NO.12, wherein the amplification primer sequence is shown as follows:

pHY1-F: GAATTCCCGGGGATCCCTTACTCCCTCCGTTTG and pHY1-R: GGCCAGTGCCAAGCTTGAGTCCCGCCCACCTCT.

The transgenic line taking the rice martial-transport japonica as the background is obtained through agrobacterium-mediated plant transgenic process. The tissue localization of OsHY1 in root system is detected by utilizing a histochemical staining technology, as shown in FIG. 4, wherein a is a chemical staining chart of a rice OsHY1 gene promoter fusion protein GUS transgenic seedling side root primordium, and b is a tissue histochemical staining chart of root tip, and the result is shown in FIG. 4: the OsHY1 gene is expressed in the root tip vascular and lateral root primordia of rice.

Fig. 5 is a graph of light signal dependence on HY1 regulation and lateral root generation and main root elongation, wherein A is a root phenotype graph of wild type, a HY1 knockout mutant after germination for 3d, the wild type is transferred to a root phenotype graph after growth for 5d under continuous illumination or darkness, B is a histogram of statistical analysis of the length of main roots and the number of lateral roots of rice under different illumination conditions, and OsHY1 mutant lines and wild type of Wuyunjing are observed to have root elongation compared with wild type. As can be seen from fig. 5: light can inhibit the development of main roots and lateral roots of rice, and OsHY1 negatively regulates the development of root systems mediated by light signals.

FIG. 6 is a graph showing the phenotype of the root tip meristematic region regulated by the optical signal according to HY 1. A is a phenotype chart of a root tip meristem after the wild-type hy1 knockout mutant is transferred to a condition of continuous illumination or darkness for 3d after sprouting for 3 d; b is a histogram of statistical analysis of the length and number of the root tip meristematic regions of the rice under different illumination conditions. As can be seen from fig. 6: rice OsHY1 can inhibit the development of the root tip meristem mediated by optical signals.

The foregoing is merely a preferred embodiment of the present invention, and it should be noted that modifications and variations could be made by those skilled in the art without departing from the technical principles of the present invention, and such modifications and variations should also be regarded as being within the scope of the invention.

Claims (6)

1. A rice organ development and yield regulation gene is characterized in that the gene is added with one base A after the 35 th base of a rice OsHY1 gene.

2. A rice organ development and yield regulating gene according to claim 1 having a nucleotide sequence shown in SEQ ID NO. 1.

3. A rice organ development and yield regulating gene according to claim 1 or 2 wherein said gene is expressed in the root tip vascular and lateral root primordia of rice.

4. Use of a gene for regulating organ development and yield in rice, or of a biological material containing said gene, according to claim 1 or 2, in plant breeding, characterized in that the following uses are possible:

regulating and controlling photosynthesis of leaves;

regulating and controlling the plant height of the rice;

regulating and controlling the field yield of the rice;

regulating and controlling the root system development of the rice.

5. The use of a gene for organ development and yield regulation in rice, or a biological material containing said gene, according to claim 4, wherein said field yield comprises tillering number, individual plant yield and thousand kernel weight.

6. A method for preparing a plant comprising a gene for regulating organ development and yield in rice according to claim 1 or 2, said method comprising the steps of:

carrying out gene mutation on a target site selected on a first exon of the rice OsHY1 gene to obtain a target gene;

amplifying the target gene, extracting plasmid,

transferring the extracted plasmid into a rice wild type strain by an agrobacterium-mediated method to obtain a target plant.

Images