CN116103285A

CN116103285A - PRMT2 interference slow virus and application thereof

Info

Publication number: CN116103285A
Application number: CN202210814494.1A
Authority: CN
Inventors: 钟警; 文格波; 祖旭宇; 郭银平; 刘江华
Original assignee: First Affiliated Hospital of University of South China
Current assignee: First Affiliated Hospital of University of South China
Priority date: 2022-07-12
Filing date: 2022-07-12
Publication date: 2023-05-12

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to PRMT2 interference slow virus and application thereof. The invention designs interference slow virus by taking PRMT2 as a target spot, and researches the action and mechanism of the interference slow virus in triple negative breast cancer. Experiments show that the interference of the lentiviruses PRMT2-KD1 and PRMT2-KD2 can down regulate the PRMT2 gene expression, inhibit cell migration, invasion and aerobic glycolysis; the PRMT2 high expression plasmid is combined with glycolysis inhibitor to verify that PRMT2 influences migration and invasion of cells by regulating aerobic glycolysis; animal experiments show that PRMT2 interference slow virus can inhibit lung metastasis of mouse triple negative breast cancer. The result suggests that PRMT2 can be used as a drug target for the treatment of triple negative breast cancer metastasis.

Description

PRMT2 interference slow virus and application thereof

Technical Field

The invention belongs to the technical field of biological medicine, and particularly relates to PRMT2 interference slow virus and application thereof.

Background

Breast cancer is one of the common female malignancies. The global cancer statistics report in 2020 records about 230 ten thousand new cases of breast cancer. Triple negative breast cancer accounts for about 15% of all breast cancers, and the effectiveness of the existing breast cancer treatment method in treating the triple negative breast cancer is limited due to the fact that the Estrogen Receptor (ER), the Progestogen Receptor (PR) and the protooncogene Her-2 are not expressed, so that the prognosis is poor, the recurrence and metastasis rate is high, and the death rate is high.

Aerobic glycolysis, also known as the Warburg effect, is an important basis and marker for reprogramming of energy metabolism. Under the condition of sufficient oxygen, the tumor cells still acquire energy through an inefficient glycolytic metabolism mode, and the aerobic glycolytic metabolism of the tumor cells is considered as a new direction of anticancer treatment at present, so that the sugar metabolism process and regulation of the tumor cells are deeply researched, and a new action target point is provided for tumor treatment.

PRMT2 is a member of the arginine methyltransferase family, located primarily in the cytoplasm, and can be involved as a transcription cofactor in the transcriptional activity of steroid hormone/nuclear receptors. The functional studies of PRMT2 are currently focused mainly on breast cancer and glioblastoma. The research shows that the high expression PRMT2 can inhibit proliferation and development of breast cancer, but has different effects on migration and invasion of breast cancer, so that the research on the effects and mechanisms of the PRMT2 in breast cancer metastasis can lay a foundation for developing and preparing medicaments for treating breast cancer by taking the PRMT2 as a medicament target. At present, the prior art does not have the shRNA interference lentivirus taking PRMT2 as a target to be used in the treatment and mechanism research of triple negative breast cancer metastasis.

Disclosure of Invention

In view of the above, the technical problem to be solved by the present invention is to provide PRMT2 interfering lentiviruses and applications thereof.

The invention provides shRNA taking PRMT2 as a target, and the nucleic acid sequence of the shRNA is shown as SEQ ID NO.1 and/or SEQ ID NO. 2. In the invention, PRMT2 containing the shRNA interferes with the expression of a PRMT2 gene of a slow virus down-regulated host, and inhibits cell migration, invasion and aerobic glycolysis; can influence the migration and invasion of cells by regulating aerobic glycolysis; in the nude mice lung metastasis model, PRMT2 interfered with the significant decrease in the number of tumor nodules in lung tissue in the lentiviral group, indicating that it can significantly inhibit lung metastasis of mouse triple negative breast cancer. The PRMT2 interference effect on host cells is superior to that of PRMT2 interference lentivirus of other shRNAs.

The invention provides recombinant vectors comprising a vector backbone, and/or shRNA according to claim 1.

Further, the vector backbone of the present invention includes a vector backbone having elements necessary for protein expression capable of expressing the shRNA. In some embodiments, the invention expresses shRNA in a GV640 vector as a subject.

In the present invention, the recombinant vector further includes a recombinant vector formed by the shRNA in a single or repeated tandem form, which is not limited in the present invention.

The invention provides PRMT2 interfering lentiviruses, and raw materials comprise shRNA disclosed by the invention and/or an expression vector disclosed by the invention.

The present invention provides cells for producing PRMT2 interfering lentiviruses of the invention.

Further, the cells are tool cells, including but not limited to: primary cells, diploid fibroblasts, and continuous cell lines that can be used as cell factories for the PRMT2 interfering lentivirus production; furthermore, the continuous cell line comprises tumor cells, and can rapidly produce division. In the present invention, 293T cells are used as a cell factory for PRMT2 to interfere with lentivirus production.

The invention provides a construction method of an interference slow virus, which utilizes PRMT2 interference slow virus disclosed by the invention and/or cells disclosed by the invention to prepare the interference slow virus.

Further, in some embodiments, the interfering lentivirus is prepared by: the PRMT2 interference slow virus is utilized to transform or transfect 293T cells, the cell supernatant is collected, concentrated and purified to obtain the PRMT2 interference slow virus. The method for conversion comprises the following steps: chemical and electrical conversion; the transfection method comprises calcium phosphate coprecipitation, an artificial liposome method and virus transfection, and the invention is not limited to the method.

The invention also provides application of any one of the following I) to IV) in preparing a medicament for treating triple negative breast cancer:

i) The shRNA provided by the invention;

II) the expression vector of the invention;

III), PRMT2 interfering lentiviruses of the invention;

IV) tool cells according to the invention.

Further, the treatment of the present invention includes inhibiting metastasis of breast cancer cells and/or inhibiting invasion of breast cancer cells. In the present invention, the inhibition of breast cancer metastasis includes inhibition of metastasis of triple negative breast cancer, including but not limited to lung metastasis, bone metastasis, brain metastasis or lymphatic metastasis.

The invention provides a medicament comprising any one of the following i) to iv):

i) The shRNA provided by the invention;

ii) the expression vector of the invention;

iii) PRMT2 interfering lentiviruses of the invention;

iv) tool cells according to the invention.

In the present invention, the drug contains the liposome of the recombinant vector of the present invention.

Alternatively, the medicament of the present invention further includes a fermentation broth, a cell, a supernatant, or an active substance containing shRNA, which is not limited in the present invention.

Furthermore, the dosage form of the medicine can be powder, granule or liquid preparation, and the administration mode can be intravenous injection, intramuscular injection or feeding, and the invention is not limited to the above.

Furthermore, the medicine of the present invention also includes pharmaceutically acceptable auxiliary materials or carriers and products made from the medicine, which are not limited in this invention.

The invention designs interference slow virus by taking PRMT2 as a target spot, and researches the action and mechanism of the interference slow virus in triple negative breast cancer. Experiments show that the interference of the lentiviruses PRMT2-KD1 and PRMT2-KD2 can down regulate the PRMT2 gene expression, inhibit cell migration, invasion and aerobic glycolysis; the PRMT2 high expression plasmid is combined with glycolysis inhibitor 2-DG to verify that PRMT2 influences migration and invasion of cells by regulating aerobic glycolysis; animal experiments show that PRMT2 interference slow virus can obviously inhibit lung metastasis of mouse triple negative breast cancer. The result suggests that PRMT2 can be used as a drug target for the treatment of triple negative breast cancer metastasis.

Drawings

FIG. 1 shows PRMT2 interfering lentivirus-mediated PRMT2 gene knockdown efficiency validation, A: protein level, B: mRNA levels;

FIG. 2 shows the effect of PRMT2 interfering lentivirus on MDA-MB-231 cell migration and invasiveness;

FIG. 3 shows the effect of PRMT2 interfering lentivirus on the wound healing capacity of MDA-MB-231 cells;

FIG. 4 shows the effect of PRMT2 interfering lentivirus on MDA-MB-231 cell glucose consumption and lactate production, A: glucose consumption, B: lactic acid production;

FIG. 5 shows the effect of PRMT2 high expression binding glycolytic inhibitor 2-DG on MDA-MB-231 cell migration and invasion capacity;

FIG. 6 shows the effect of PRMT2 high expression binding glycolytic inhibitor 2-DG on MDA-MB-231 cell wound healing capacity;

FIG. 7 shows the effect of PRMT2 interfering lentivirus on lung metastasis of triple negative breast cancer, A: body weight profile over time, B: tumor nodule statistical plots of lung tissue for each group, C: representative pictures of lung tissue and HE staining, D: in vivo imaging of mice at the end of the experiment, E: total fluorescence expression of mice in each group.

Detailed Description

The invention provides PRMT2 interference lentivirus and application thereof, and a person skilled in the art can properly improve the technological parameters by referring to the content of the text. It is expressly noted that all such similar substitutions and modifications will be apparent to those skilled in the art, and are deemed to be included in the present invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the relevant art that the invention can be practiced and practiced with modification and alteration and combination of the methods and applications herein without departing from the spirit and scope of the invention.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. For definitions and terms in the art, the expert may refer specifically to Current Protocols in Molecular Biology (Ausubel). The abbreviations for amino acid residues are standard 3-letter and/or 1-letter codes used in the art to refer to one of the 20 commonly used L-amino acids.

The invention provides shRNA taking PRMT2 as a target, and the nucleic acid sequence of the shRNA is shown as SEQ ID NO.1 and/or SEQ ID NO. 2. SEQ ID NO.1 sequence is: ctggaggcttgctgaaggctgtatgctgagttgttcgtggctggtctgcgttttggccactgactgacgcagaccacacg aacaactcaggacacaaggcctgttactagcactcacatggaacaaatggccc. SEQ ID NO.2 sequence is: ctggaggcttgctgaaggctgtatgctgtggaagtggacgctaaaccaggttttggccactgactgacctggtttagtcc acttccacaggacacaaggcctgttactagcactcacatggaacaaatggccc.

The test materials adopted by the invention are all common commercial products and can be purchased in the market. The invention is further illustrated by the following examples:

EXAMPLE 1 PRMT2 interfering lentivirus construction

1. Experimental materials and methods

(1) Cell line: human metastatic breast cancer cell line MDA-MB-231 (Shanghai Ji Kai organism) in DMEM/F12 medium (Gibco) containing 10% fetal bovine serum (Gibco), 1% diabody (penicillin/streptomycin), 5% CO at 37 ℃ ₂ Is cultured under the condition of (2).

(2) Primer: primers for identifying PCR amplification products of the human PRMT2 recombinant plasmid are designed and synthesized by Shanghai Ji Kai biology, and primers for detecting mRNA of the human PRMT2 gene and internal reference GAPDH are designed and synthesized by Shanghai biology.

(3) Antibody: antibodies for detecting proteins encoded by the human PRMT2 gene were purchased from Santa Cruz, and antibodies for the internal reference protein actin were purchased from CST.

2. Vector construction and lentiviral packaging

The human PRMT2 gene is used as a template, an interference target point and shRNA are designed, wherein the shRNA interference sequence is shown as SEQ ID NO.1 and SEQ ID NO.2, and BamHI and XbaI restriction enzyme cutting sites are added at two ends to synthesize a single-stranded DNA oligo and prepare the double-stranded DNA oligo. The GV640 vector (Shanghai Ji Kai) was linearized using BamHI/XbaI restriction enzyme, the DNA oligo was ligated into the linearized GV640 over-expression vector, transformed and plated, positive clones were selected and identified by PCR. Amplifying and extracting plasmids from bacterial liquid with correct sequencing, co-transfecting 293T cells with plasmids qualified in quality inspection and virus packaging auxiliary plasmids (Helper 1.0 and Helper 2.0), culturing for 48-72 h, and then harvesting viruses (namely unpurified cell supernatant). Removing impurities by centrifugal concentration, concentrating and purifying to obtain the lentivirus.

3. Lentivirus infection of MDA-MB-231 cells and infection efficiency validation:

when the MDA-MB-231 cell density was about 30%, interfering lentiviruses PRMT2-KD1, PRMT2-KD2 and negative control virus (empty vector virus, NC) were added respectively at MOI=10, and the cells were changed after 24 hours of infection, and uninfected cells were used as control. After 72 hours cells were collected, proteins and RNA were extracted and RNA was inverted to cDNA and PRMT2 expression levels were detected by WB and RT-qPCR experiments, with the primer sequences for PRMT2 and GAPDH shown in Table 1.

TABLE 1

Gene name	Upstream primer sequences	Downstream primer sequences	Size and dimensions of
				GAPDH	TGACTTCAACAGCGACACCCA	CACCCTGTTGCTGTAGCCAAA	121bp
PRMT2	CGTGCGAGCTAAGGTGGTGATG	TGAGCATGTGCGATGGACCAAC	106bp

As shown in FIG. 1, when the lentivirus is used to infect MDA-MB-231 cells, the protein and mRNA contents of PRMT2 in the cells are detected by WB and RT-qPCR respectively, and compared with Control, the NC group does not influence the expression of PRMT2 in the MDA-MB-231 cells, and the mRNA and protein contents of PRMT2 in the PRMT2-KD1 and PRMT2-KD2 groups are obviously reduced, which indicates that the PRMT2-KD1 and PRMT2-KD2 can obviously reduce the expression of PRMT2 genes in triple-negative breast cancer cells.

Example 2 PRMT2 interference of lentiviruses against migration invasion and aerobic glycolysis and mechanism studies of triple negative breast cancer cells

(1) Effects of lentiviruses on cell migration and invasion, glucose and lactate levels

The method comprises the steps of respectively infecting MDA-MB-231 cells by using lentiviruses PRMT2-KD1 and PRMT2-KD2, taking uninfected virus cells as a control, taking cells infected with negative control viruses as a negative control NC group, and measuring cell migration and invasion, wound healing, glucose and lactic acid content, wherein the specific steps are as follows:

migration experiment: after 48 hours of infection of MDA-MB-231 cells by lentivirus, the cells were digested and centrifuged, the cells were resuspended in serum-free medium, counted after mixing, 1.5X10 per well ⁵ Cell count cells were inoculated in a Transwell chamber and medium containing 10% fetal bovine serum was added to the lower chamber. After culturing for 48 hours, take outCells were fixed and stained with Giemsa and the migrated cells were photographed.

Invasion experiments: matrigel (Sigma) was diluted 1:5 and coated on the upper surface of the bottom membrane of the Transwell chamber and left on ice for 30 minutes to solidify. Cell suspensions were prepared according to the "migration assay" procedure and inoculated with 1.5X10 ⁵ Cells were counted in a Transwell chamber containing Matrigel coating. After 48 hours, the plate was fixed and stained, and recorded by photographing.

Scratch experiment: MDA-MB-231 cells were inoculated into 6-well plates, after cells were infected with lentiviruses for 72 hours, transverse lines were evenly drawn into the plates, the transverse lines were traversed, and scratches were recorded by photographing after culturing for 0, 24, and 36 hours, respectively.

And (3) detecting the content of glucose: glucose consumption detection: collecting cell culture supernatant, preparing a working system according to the specification, placing into a 37 ℃ incubator for reaction for 10min, and detecting absorbance at 490nm wavelength. The glucose content was calculated according to the following formula.

Sample glucose concentration (mmol/L) = (sample tube absorbance (a))/(calibration tube absorbance (a)) ×calibration solution concentration;

consumption of glucose per group (mmol/L) =measured value of medium alone-measured value per group

Lactic acid content detection: and (3) detecting the lactic acid production content: cell culture supernatants were collected, working systems were configured according to the instructions of the lactic acid assay kit (Nanjing established organism), absorbance values were measured at a wavelength of 530nm, and lactic acid content was calculated according to the following formula.

Sample lactic acid content (mmol/L) = (determination OD-blank OD)/(standard OD-blank OD) ×standard substance concentration×dilution of sample before test

The results of the invasion, migration and scratch experiments showed (fig. 2 and 3) that compared with Control and NC groups, PRMT2-KD1 and PRMT2-KD2 groups showed significantly reduced cells across the bottom membrane of the Transwell chamber, and decreased wound healing capacity, indicating that PRMT2 underexpression can significantly inhibit migration and invasion capacity of triple negative breast cancer cells. The glucose and lactate consumption is shown in FIG. 4, and the glucose consumption and lactate production in PRMT2-KD1 and PRMT2-KD2 groups decreased compared to Control and NC groups, indicating that PRMT2 low expression can significantly inhibit the aerobic glycolysis process in triple negative breast cancer cells.

(2) Exploration of the mechanism of glycolytic inhibitor 2-DG

MDA-MB-231 cells were seeded in 6-well plates to a density of about 60% to 70%, and after adherence, PRMT2 high expression plasmid (PRMT 2-OE) and pcDNA3.1 (+) control plasmid (both purchased from Shanghai Ji Kai organism) were transfected according to Lipofectamine2000 (Invitrogen) instructions, respectively, and after 6 hours cell exchange was performed using cells not transfected with plasmids as control. After 48 hours of culture, the cells were collected for use. Migration, attack and scratch test procedures were as described above.

The migration, invasion (shown in figure 5) and scratch (shown in figure 6) experimental results show that compared with the Control group and the pcDNA3.1 (+) group, the PRMT2 high expression (PRMT 2-OE) group has obviously increased cell number passing through a Transwell cell, and the wound healing capacity is enhanced; the PRMT2-OE+2DG group showed significantly reduced cell numbers across the Transwell chamber and decreased wound healing capacity after 2mM 2-DG treatment compared to the PRMT2-OE group. The result shows that the PRMT2 high expression can promote migration and invasion capacity of triple-negative breast cancer cells, and the glycolysis inhibitor 2-DG can reverse migration and invasion capacity of the PRMT2 high expression on the triple-negative breast cancer cells.

Example 3 PRMT2 interfering lentiviruses inhibit lung metastasis of triple negative breast cancer

Experimental animals: female BALB/c nude mice (Shanghai Ling Chang Bio) aged 5 weeks.

Cell line: human metastatic breast cancer cell line MDA-MB-231 (Shanghai Ji Kai organism).

The slow virus PRMT2-KD1, PRMT2-KD2 and negative control virus are used for respectively infecting MDA-MB-231 cells, puromycin is added after 72 hours for screening for 48 hours, and puromycin is continuously added after passage for screening until stable transfer cell lines are successfully constructed.

Preparing cell suspension from negative control cell in logarithmic growth phase and PRMT2 low-expression stable cell line, inoculating cells by tail vein injection, inoculating 100 μl cell suspension (containing 2×10 cells) per mouse ⁶ Individual cells). Body weight was measured once a week, 49 days laterD-Luciferin (15 mg/mL) was injected intraperitoneally in an amount of 10. Mu.L/g, and after 15 minutes, 2% sodium pentobarbital was injected intraperitoneally to anesthetize the mice, and the total fluorescence expression of the mice was measured and recorded by imaging under a Lumina LT biopsy imager (Perkin Elmer). Injecting excessive 2% sodium pentobarbital to euthanize, opening the abdominal cavity, separating lung tissues, recording the tumor node number on the lung tissues, and photographing; lung tissue was collected and fixed and HE stained.

As shown in fig. 7, there was no significant change in body weight in the PRMT2-KD1 and PRMT2-KD2 groups, and the number of tumor nodules on lung tissue in the PRMT2-KD1 and PRMT2-KD2 groups was significantly reduced, compared to NC group (negative control virus steady transfer cell line injection); the in vivo imaging data showed a significant decrease in total fluorescence expression in the PRMT2-KD1 and PRMT2-KD2 sets of regions. The above results indicate that PRMT2 low expression can inhibit the metastatic capacity of triple negative breast cancer.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims

shRNA with a nucleic acid sequence shown as SEQ ID NO.1 or SEQ ID NO. 2.
2. A recombinant vector comprising a vector backbone, and the shRNA of claim 1.
Prmt2 interfering lentivirus, the starting material of which comprises shRNA according to claim 1, and/or recombinant vector according to claim 2.
4. Transforming or transfecting the PRMT2 interfering lentivirus tool cell of claim 3.
5. A method for preparing an interfering lentivirus, comprising collecting the interfering lentivirus after infecting cells with the PRMT2 interfering lentivirus of claim 3.
6. The application of any one of the following I) to IV) in preparing a medicament for treating triple negative breast cancer:

i) The shRNA of claim 1;

II) the recombinant vector of claim 2;

III), the PRMT2 interfering lentivirus of claim 3;

IV), tool cells according to claim 4.
7. The use according to claim 6, wherein the treatment comprises inhibiting metastasis of breast cancer cells and/or inhibiting invasion of breast cancer cells.
8. A medicament for treating triple negative breast cancer comprising any one of the following i) to iv):

i) The shRNA of claim 1;

ii) the recombinant vector of claim 2;

iii) The PRMT2 interfering lentivirus of claim 3;

iv) the tool cell of claim 4.
9. The drug according to claim 8, characterized by a liposome containing the recombinant vector of claim 2.