CN114767702B

CN114767702B - Inhibitor for knocking down circXPO1 and application thereof in preparation of glioma treatment drugs

Info

Publication number: CN114767702B
Application number: CN202210406260.3A
Authority: CN
Inventors: 谭舟; 王学辉; 邱猛生
Original assignee: Hangzhou Normal University
Current assignee: Hangzhou Normal University
Priority date: 2022-04-18
Filing date: 2022-04-18
Publication date: 2023-06-16
Anticipated expiration: 2042-04-18
Also published as: CN114767702A

Abstract

The invention discloses an inhibitor for knocking down circXPO1 and application thereof in preparing a medicament for treating glioma. The expression of the circXPO1 is reported to be related to the occurrence of osteosarcoma, lung adenocarcinoma and prostate cancer, and no related effect on glioblastoma has been reported. According to the invention, a pair of shRNAs are designed according to the splicing sites of the circXPO1, and the shRNAs can obviously inhibit the expression level of the circXPO1 and inhibit the activity, proliferation and migration of glioma.

Description

Inhibitor for knocking down circXPO1 and application thereof in preparation of glioma treatment drugs

Technical Field

The invention relates to the technical field of molecular diagnosis, in particular to an inhibitor for knocking down circXPO1 and application thereof in preparing a medicament for treating glioma.

Background

Human gliomas (gliomas) are the most common primary malignant neoplasms in the central nervous system, accounting for 80% of all malignant primary brain and central nervous system tumors. The World Health Organization (WHO) has re-classified gliomas into types I-IV based on histological morphology and molecular characteristics, wherein types I and II are often referred to as Low-grade glioma (LGG), and types III and IV include Glioblastoma (GBM), anaplastic astrocytoma, and anaplastic oligodendroglioma. Gliomas of type III and IV are often considered subjects because of their great tolerance to drugs, high recurrence rate and severe impact on the quality of life of the patient, and correspondingly, greatly shortened survival time. The low-grade glioma has lower incidence rate, only accounts for 15% of the total glioma, and has better treatment effects in clinical treatment methods such as excision, radiotherapy, chemical drug treatment and the like, and has better prognosis, and the patients with more than ten years of survival time account for about 47%. Malignant gliomas are one of the brain tumors with extremely high malignancy, and although the incidence rate of the total population is only 5.55/10 ten thousand, the survival rate of patients is only one third, the survival time of non-interfered patients is only three months, the survival time after treatment is 12-15 months, and the maximum time is no more than five years.

Circular RNAs (circrnas) are a class of covalently closed circular coding RNAs produced by reverse splicing of mRNA precursors, without 3 'polyadenylation tails and 5' cap structures, are generally more stable than their cognate linear mrnas, are not affected by exonucleases, and are expressed with time and tissue specificity, and thus good biomarker candidates. The circrnas fall into three categories: exon circRNA (ecircRNA), formed by reverse splicing of one or more exons; intron circRNA (ciRNA), formed from introns; exon-intron circRNA (EIciRNA) includes both exons and introns. Circrnas are differentially expressed in a variety of diseases and are involved in the regulation of physiological and pathophysiological processes. The CircRNAs mainly prevent downstream target genes from being degraded by miRNA through binding miRNA, bind to RNA Binding Protein (RBP), or regulate transcription and translation of peptides and proteins through RNA-POL II, and participate in central nervous system related diseases, tumors and other processes. The research of the generation and the function of the circRNA relates to aspects of the tumor fields such as lung cancer, breast cancer, osteosarcoma, glioma and the like. Thus, circRNA can be used as a means for treating tumors, and further promotes the development of the related field.

The expression of the circXPO1 is reported to be related to the occurrence of osteosarcoma, lung adenocarcinoma and prostate cancer, and no related effect on glioblastoma has been reported. Through long-term research, the inhibitor of the circXPO1 can be used as an active substance and has a certain therapeutic effect on malignant glioma.

Disclosure of Invention

The first object of the invention is to provide an application of shRNA with knockdown circXPO1 in preparing a medicine or health care product for treating glioma, wherein the nucleotide sequence of the shRNA consists of a sense strand and an antisense strand:

the nucleotide sequence of the sense strand is shown in SEQ ID NO. 2: 5'-GATCCGTGCGAAGTAATCTATGCCAGCCTTCCTGTCAGAGCTGGCATAGA TTACTTCGCACTTTTTG-3';

the nucleotide sequence of the antisense strand is shown in SEQ ID NO. 3: 5'-AATTCAAAAAGTGCGAAGTAATCTATGCCAGCTCTGACAGGAAGGCTGG CATAGATTACTTCGCACG-3'.

The nucleotide sequence of the circXPO1 gene is shown as SEQ ID NO. 1.

Preferably, the glioma is glioma cell U-87MG or glioma cell U251.

The second object of the invention is to provide an application of shRNA with knockdown circXPO1 in preparing glioblastoma activity inhibitor.

A third object of the present invention is to provide a medicament for treating glioma comprising shRNA with knockdown circXPO 1.

Preferably, the dosage form of the medicament is any one of the dosage forms approved in medicine.

Preferably, a pharmaceutically acceptable carrier is also included.

The fourth object of the invention is to provide an inhibitor shRNA for knocking out the circXPO1, which can inhibit the growth of glioma under the condition of interfering the expression of the circXPO1, and provides a new solution for clinically treating glioma. The inhibitor inhibits the expression of circXPO1 to reduce the level of the expression product of circXPO 1.

In order to explore the role of circXPO1 in glioma occurrence and development, a pair of shRNAs are designed according to the splicing site of the circXPO1, and the shRNAs and scrambles (negative control) are infected by a slow virus packaging method by using a transfection reagent to knock down the expression of the circXPO1 by using a U87-MG and U251 cell line. Cells are collected after 72 hours of infection, and the expression level of the circXPO1 is detected by using a real-time fluorescent quantitative PCR technology to detect the transfection efficiency of shRNA, so that the designed shRNA can obviously inhibit the expression level of the circXPO1 and can inhibit the activity, proliferation and migration of glioma. Meanwhile, the overexpression of the circXPO1 can promote the cell activity, proliferation, migration and the like of glioma, so that the circXPO1 has important significance for treating glioma.

Drawings

FIG. 1 shows the circular structure of circXPO1 and Sanger sequencing; (A) the cyclic structure of circXPO1 and the formation of a schematic diagram, (B) the peak diagram of the sanger sequencing result, (C) RT-PCR detection of the cyclic structure of circXPO1 and the specificity of the primer, (D) qRT-PCR detection of the expression level of circXPO1 after RNase R treatment, and (E) qRT-PCR detection of the expression level of XPO1 after RNase R treatment.

FIG. 2 shows the expression levels of circXPO1 in normal and glioma tissues and GBM cell lines; (A) qRT-qPCR detection of the expression level of circXPO1 in Normal brain tissue (Normal), low Grade Glioma (LGG) and high grade Glioma (GBM), and (B) qRT-qPCR detection of the expression level of circXPO1 in U87-MG cells and U251 cells.

FIG. 3 shows qRT-PCR detection of the knockdown efficiency of shRNA of circXPO1 in glioma cell lines; (A) The expression level of the circXPO1 after the circXPO1-sh treatment was changed, and the expression level of the XPO1 after the circXPO1-sh treatment was changed.

FIG. 4 shows the effect of CCK-8 detection of the circXPO1-sh treatment on the activity of U87-MG and U251 cells.

FIG. 5 shows the effect of immunofluorescence detection of the cell proliferation of U87-MG and U251 after the circXPO1-sh treatment.

FIG. 6 is a graph showing the effect of scratch assay on the ability of U87-MG and U251 cells to heal after treatment with circXPO 1-sh.

FIG. 7 shows qRT-PCR detection of the overexpression efficiency of circXPO1 in glioma cell lines.

FIG. 8 is the effect on U87-MG and U251 cell growth, proliferation and migration after overexpression of circXPO 1; (A) is the effect of CCK-8 on the cell viability of U87-MG and U251 after the overexpression of circXPO1, (B) is the effect of immunofluorescence on the proliferation of U87-MG and U251 after the overexpression of circXPO1, and (C) is the effect of the cell scratch healing ability of U87-MG and U251 after the overexpression of circXPO 1.

Detailed Description

The invention is further described below in connection with specific embodiments, but the scope of the invention is not limited thereto.

Example 1: sanger sequencing and RNase R treatment demonstrated that circular RNA was formed

1. Experimental method

1. RT-PCR to obtain circXPO1

Total RNA from GBM cell lines (i.e., U87-MG, U251 cells) was extracted and reverse transcribed using Trizol reagent (Thermo Fisher Scientific) for RT-PCR analysis. The primers are shown in (Table 1).

To demonstrate that the circXPO1 formation is circular RNA rather than linear, RT-PCR products were recovered, sent to the company for sanger sequencing, and the sequencing results were aligned using DNASTAR software. The results showed that circXPO1 is indeed formed by head-to-tail cyclization of

exons

2, 3 and 4 of the parent gene XPO1 (FIG. 1A, B, C).

2. To confirm the cyclic structure of circXPO1, the stability was assessed by treatment with exonuclease (RNase R). The results indicated that circXPO1 is resistant to RNase R (FIG. 1D), whereas XPO1 is digested by RNase R degradation (FIG. 1E). In summary, circXPO1 is a cyclic and stable transcript.

TABLE 1 PCR and qPCR primer sequences for circXPO1 and XPO1

Example 2: expression of circXPO1 in normal and glioma tissues and GBM cell lines

1. The experimental method comprises the following steps:

1. fluorescent quantitative PCR detection of expression of circXPO1 in normal tissues and glioma tissues and GBM cell lines

Total RNA of glioma tissues and GBM cell lines (i.e., U87-MG, U251 cells) were extracted and Trizol reagent (Thermo Fisher Scientific) was used for fluorescent quantitative PCR (qRT-PCR) analysis. Amplification reactions were performed by a cfx96 real-time PCR detection system (Bio-Rad corporation, hercules, CA, usa) using SYBR Green fluorescent quantitative PCR kit according to the operating specifications. For the circXPO1 and XPO1 primers (Table 1) shown, 2 was used ^-ΔΔCT The expression of the relevant gene was calculated by the method. All qRT-PCR experiments were repeated three times, all data using GAPDH as a control.

2. Experimental results

The expression of circXPO1 was analyzed in normal brain tissue, low grade glioma tissue samples, high grade glioma tissue samples and related cell lines (U87-MG and U251). qRT-PCR results showed that circXPO1 expression was up-regulated in high grade GBM tissue (FIG. 2A) as well as in several GBM derived cell lines such as U87-MG and U251 (FIG. 2B).

Example 3: inhibition of circXPO1 expression using shRNA in U87-MG and U251 cells

1. Experimental method

1. Construction of scramble, circXPO1-sh plasmid (GFP Co-expression): the most commonly used interfering plasmid construction method was used, and the plasmid was constructed by cleavage of shRNA sequences with the P GreenPuro vector (Bio) using the enzyme endonuclease (Biolabs) and ligation with T4 ligase (Biyun).

The method for obtaining the virus liquid comprises the following steps: (1) 2 1.5mL centrifuge tubes were taken and 30. Mu.LDMEM, 30. Mu. LFectin (ThermoFisher) was added. (2) 2 additional 1.5mL centrifuge tubes were added with 60. Mu.L DEMEM, 0.75. Mu.g pspax2 packaging plasmid, 0.25. Mu.g pmd2.G packaging plasmid, 1. Mu.g scramble, circXPO1-sh interfering plasmid, respectively, then mixed with the solution from the centrifuge tube of step (1), allowed to stand for 20 minutes, then added to 293T cell sap cultured in DMEM medium containing 10% fetal bovine serum, respectively, and after 24 and 48 hours, culture supernatants were taken, respectively.

U87-MG and U251 cells were infected with virus solution with scramble and circXPO1-sh, and subsequent experiments were performed after cell infection efficiency was observed to be 90% or more under a fluorescence microscope.

2. And detecting the high-low effect of the circXPO1-sh by adopting a qRT-PCR method.

Total RNA was obtained from U87-MG and U251 cells after scramble and circXPO1-sh infection, and Trizol reagent (Thermo Fisher Scientific) was used for real-time quantitative PCR (qRT-PCR) analysis. Amplification reactions were performed by a cfx96 real-time PCR detection system (Bio-Rad corporation, hercules, CA, usa) using SYBR Green fluorescent quantitative PCR kit according to the operating specifications. For the circXPO1 and XPO1 referencesThe results are shown in Table 1, use 2 ^-ΔΔCT The expression of the relevant gene was calculated by the method. All qRT-PCR experiments were repeated three times, all data using GAPDH as a control.

2. Experimental results

And detecting the expression level of the circXPO1 by using qRT-PCR technology to detect the high and low efficiency of shRNA, and confirming that the circXPO1-sh down regulates the expression of the circXPO1, wherein Pvalue is less than 0.05. (see FIG. 4A). Meanwhile, qRT-PCR detection shows that the shiRNA does not knock down the expression of linear XPO1 (see FIG. 4B), which shows that the shRNA specifically knocks down the expression of circXPO 1.

Example 4 Effect of circXPO1 inhibition on GBM cell viability

1. Experimental method

1、CCK-8

After infection of glioma cell lines (U87-MG and U251) with lentiviruses according to method one of example 3, 100. Mu.L of glioma cells were prepared in 2000/Kong Chuanzhi 96-well plates according to (U87-MG and U251) with DMEM medium containing 10% fetal bovine serum. Dividing into a scramble group and a circXPO1-sh group, placing the culture plates in an incubator at 37 ℃ and CO ₂ Incubation was performed at 5% concentration for a suitable period of time (0-7 days) and medium was removed from the scramble and circXPO1-sh plates at 1,3,5,7 days and replaced with DMEM medium containing 10% CCK 8. The plates were incubated in the incubator for 1 hour. The absorbance (OD value) at 450nm was measured with a microplate reader.

2. Experimental results

The effect of circXPO1 on GBM cell viability was examined in the GBM cell lines U87-MG and U251, and it was found that the interference of circXPO1-sh significantly inhibited U87-MG and U251 cell viability (FIG. 4A).

EXAMPLE 5 BrdU labelling and Ki-67 staining analysis of the effect of inhibition of circXPO1 on GBM cell proliferation

1. Experimental method

1. BrdU labeling method and Ki-67 staining method

(1) Preparation of cell samples: lentiviral infection of glioma cell lines (U87-MG and U251) according to method one of example 3

(2) BrdU (5-bromodeoxyuridine) was added at a final concentration of 90g/L and incubated at 37℃for 2 hours. After 2 hours incubation of the medium, the medium was discarded and the cells were washed 2 times for 5 minutes in PBS. (3) cell immobilization: mu.l of cell fixative (4% paraformaldehyde) was added to each well and incubated at room temperature for 30 min, and the fixative was discarded. The PBS was washed 3 times for 5 minutes each.

(4) HCl fixation: to each well of the culture well of step 2, 2M aqueous HCl solution was added enough to cover the cells, and after incubation at 37℃for 20 minutes, PBS was washed 3 times for 5 minutes each.

(5) Closing: blocking with 5% sheep serum was performed for 1 hour at room temperature.

(6) Incubating primary antibody and secondary antibody: primary antibodies (mouse BrdU mab and rabbit Ki-67 mab) were incubated overnight at 4 ℃, washed 3 times with PBS, then secondary antibodies (goat-anti-mouse IgG1 (r 1), 594 and goat-anti-rabit IgG, 633) were incubated for 1 hour, DAPI (4', 6-diamidino-2-phenylindole) was added 5 minutes before the end of secondary antibody incubation at a volume ratio of 1:10000, and PBS was washed three times. Photographing under a fluorescence microscope.

2. Experimental results

The effect of circXPO1 on GBM cell proliferation in the GBM cell lines (U87-MG and U251) was examined using the BrdU labeling method and the Ki-67 staining method, and it was found that circXPO1-sh significantly inhibited BrdU positive cells and Ki-67 positive cells in U87-MG and U251 cells, and significantly inhibited proliferation of U87-MG and U251 cells (FIG. 5).

Example 6 influence of circXPO1 interference on GBM cell migration capacity.

1. Experimental method

1. Cell migration experiments

After infection of glioma cell lines (U87-MG and U251) with lentiviruses according to method one of example 3, serum-free medium was changed when cell confluency reached around 80%, and after 24 hours of serum starvation of cells, streaking experiments were performed with a small-size gun head, washing 2 times with PBS to wash off floating cells, and serum-free medium was added.

2. Photographing and observing

The scratch sites were photographed every 24 hours under a microscope and the scratch widths were statistically analyzed.

2. Experimental results

The effect of circXPO1 inhibition on GBM cell migration was studied by a wound healing assay. The circXPO1-sh was found to significantly inhibit migration of U87-MG and U251 cells (FIG. 6).

Example 7 qRT-PCR detection of the overexpression Effect of circXPO1

1. Experimental method

1. Vector plasmid construction

Construction of Vector, circXPO1-OE plasmid (GFP Co-expression): the most commonly used method of construction of overexpressed plasmids was performed by endonuclease (Thermo) cleavage of the pLC5-ciR vector (Gift biosciences) and ligation with T4 ligase (Biyun) to construct the plasmid. The full length sequence of circXPO1 was cloned into the pLC5-ciR plasmid empty.

2. Method for obtaining virus liquid

(1) 2 1.5mL centrifuge tubes were taken and 30. Mu.LDMEM, 30. Mu. LFectin (ThermoFisher) was added. (2) Another 2 1.5mL centrifuge tubes were added with 60. Mu.L DMEM, 0.75. Mu.g pspax2 packaging plasmid, 0.25. Mu.g pmd2.G packaging plasmid, 1. Mu.g Vector, circXPO1-OE plasmid, respectively, then mixed with the solution from the centrifuge tube of step (1), allowed to stand for 20 minutes, then added to 293T cell broth cultured in DMEM medium containing 10% fetal bovine serum, respectively, and after 24 and 48 hours, the culture supernatants were taken, respectively. U87-MG and U251 cells were infected with virus solution with Vector and circXPO1-OE, and subsequent experiments were performed after cell infection efficiencies of 90% or more were observed under a fluorescence microscope.

3. And detecting the overexpression effect of the circXPO1-OE by adopting a qRT-PCR method.

Total RNA was obtained from U87-MG and U251 cells after Vector and circXPO1-OE infection, and Trizol reagent (Thermo Fisher Scientific) was used for real-time quantitative PCR (qRT-PCR) analysis. Amplification reactions were performed by a cfx96 real-time PCR detection system (Bio-Rad corporation, hercules, CA, usa) using SYBR Green fluorescent quantitative PCR kit according to the operating specifications. For the circXPO1 and XPO1 primers as shown in Table 1, 2 was used ^-ΔΔCT The expression of the relevant gene was calculated by the method. All qRT-PCR experiments were repeated three times, all data using GAPDH as a control.

2. Experimental results

The expression level of the circXPO1 is detected by using qRT-PCR technology to detect the overexpression efficiency of the circXPO1, and the fact that the circXPO1-OE up-regulates the expression of the circXPO1 is confirmed that the Pvalue is smaller than 0.05. (see FIG. 7).

Example 8: effect of overexpression of circXPO1 on GBM cell activity, proliferation and migration capacity.

1. Experimental method

The effect of circXPO1 on GBM cell activity, proliferation and migration capacity was examined according to the methods of examples 4, 5 and 6.

2. Experimental results

The effect of over-expressed circXPO1 on GBM cell activity, proliferation and migration capacity was tested using CCK-8, brdu labeling, ki-67 staining and scratch experiments, and the results showed that over-expressed circXPO1 could significantly increase GBM cell activity as shown in FIG. 8A, promote cell proliferation as shown in FIG. 8B and migration as shown in FIG. 8C.

Sequence listing

<110> Hangzhou university of education

<120> an inhibitor for knocking down circXPO1 and application thereof in preparation of glioma treatment drugs

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 307

<212> RNA

<213> Artificial sequence (circXPO 1)

<400> 1

uaaucuaugc cagcaauuau gacaauguua gcagaccaug cagcucguca gcugcuugau

uucagccaaa aacuggauau caacuuauua gauaaugugg ugaauugcuu auaccaugga

gaaggagccc agcaaagaau ggcucaagaa guacugacac auuuaaagga gcauccugau

gcuuggacaa gagucgacac aauuuuggaa uuuucucaga auaugaauac gaaauacuau

ggacuacaaa uuuuggaaaa ugugauaaaa acaaggugga agauucuucc aaggaaccag

ugcgaag 307

<210> 2

<211> 67

<212> DNA

<213> Artificial sequence (circXPO 1-shRNA sense strand)

<400> 2

gatccgtgcgaagtaatctatgccagccttcctgtcagagctggcatagattacttcgcactttttg 67

<210> 3

<211> 67

<212> DNA

<213> Artificial sequence (circXPO 1-shRNA antisense strand)

<400> 3

aattcaaaaagtgcgaagtaatctatgccagctctgacaggaaggctggcatagattacttcgcacg 67

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence (primer 1)

<400> 4

cagtgcgaag taatctatgc ca 22

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence (primer 2)

<400> 5

gagccattct ttgctgggct 20

<210> 6

<211> 22

<212> DNA

<213> Artificial sequence (primer 3)

<400> 6

agtcgaatgg ctaaaccaga gg 22

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (primer 4)

<400> 7

ggagcctatt gcccaacaca 20

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence (primer 5)

<400> 8

ccaaggagta agacccctgg 20

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence (primer 6)

<400> 9

tggttgagca cagggtactt 20

Claims

1. The application of shRNA with knockdown circXPO1 in preparing a medicament for treating glioma is characterized in that the nucleotide sequence of the shRNA consists of a sense strand and an antisense strand, the nucleotide sequence of the sense strand is shown as SEQ ID NO.2, and the nucleotide sequence of the antisense strand is shown as SEQ ID NO. 3.

2. The use according to claim 1, wherein the glioma is glioma cell U-87MG or glioma cell U251.

3. The application of shRNA with knockdown circXPO1 in preparing glioblastoma activity inhibitor is characterized in that the nucleotide sequence of shRNA consists of a sense strand and an antisense strand, the nucleotide sequence of the sense strand is shown as SEQ ID NO.2, and the nucleotide sequence of the antisense strand is shown as SEQ ID NO. 3.

4. The use according to claim 3, wherein the glioblastoma is glioma cell U-87MG or glioma cell U251.