CN116064354A - Genetically engineered bacterium for high-yield of L-cysteine, construction method and application - Google Patents
Genetically engineered bacterium for high-yield of L-cysteine, construction method and application Download PDFInfo
- Publication number
- CN116064354A CN116064354A CN202211335028.1A CN202211335028A CN116064354A CN 116064354 A CN116064354 A CN 116064354A CN 202211335028 A CN202211335028 A CN 202211335028A CN 116064354 A CN116064354 A CN 116064354A
- Authority
- CN
- China
- Prior art keywords
- yhao
- cysteine
- yded
- yfik
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
- C07K14/245—Escherichia (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/12—Methionine; Cysteine; Cystine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
- C12N2830/002—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/185—Escherichia
- C12R2001/19—Escherichia coli
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention relates to a genetically engineered bacterium for high-yield L-cysteine, a construction method and application thereof in microbial fermentation preparation of L-cysteine. According to the invention, a DECR-CYS dynamic regulation system capable of responding to intracellular L-cysteine is constructed, and different engineering promoters are utilized to drive an efficient L-cysteine transport system constructed by effective L-cysteine transport proteins YdeD, yfiK, yeaS, alaE and TolC obtained through screening, so that the escherichia coli engineering strain with high yield of L-cysteine is obtained. The engineering strain constructed by the invention can respond to the accumulation level of L-cysteine, dynamically activate an L-cysteine transport system, reduce the toxic influence of L-cysteine on cells, and has good production and application values.
Description
Field of the art
The invention belongs to the field of metabolic engineering, and in particular relates to a genetically engineered bacterium for high-yield L-cysteine, a construction method and application thereof in microbial fermentation preparation of L-cysteine.
(II) background art
L-cysteine is the only amino acid with active sulfhydryl group in the organism, and has a close relation with a plurality of physiological processes in the organism due to the unique physiological characteristics. Meanwhile, the L-cysteine is also widely applied to the industries of foods, medicines, cosmetics and the like.
In the food industry, L-cysteine is often used as a food flavor, dough conditioner, etc.; in the pharmaceutical industry, L-cysteine contains active sulfhydryl groups, so that the L-cysteine can be used as an antidote for various harmful substances, including diseases such as formaldehyde poisoning, inflammation, leukopenia and the like, and can be used for treating and preventing injury caused by radioactive rays to people; in the cosmetic industry, because the sulfhydryl in the L-cysteine structure has reducibility, the L-cysteine can be used for regulating the generation of melanin, effectively reducing the melanin generated by cells at the subsurface of the skin, maintaining the normal metabolism of the skin and whitening the skin.
The main production methods of L-cysteine include hair hydrolysis, enzyme catalysis, chemical synthesis and microbial fermentation. Hair hydrolysis is one of the main methods for producing L-cysteine at present, but the method is accompanied by waste gas and waste liquid such as hydrogen sulfide; the chemical synthesis method has complex operation and high resolution difficulty; the substrate of the enzyme catalysis method has high price and the industrial production has poor economic benefit; the microbial fermentation method is one of the industrial production methods with great prospect, and has the advantages of environmental friendliness, high economic benefit and the like. However, at present, the toxicity of L-cysteine to cells and the complex metabolic pathways are the main reasons that prevent microbial fermentation methods from achieving significant breakthrough.
Metabolic engineering is critical for the production of valuable chemicals by microorganisms. In recent years, with the rapid development of synthetic biology, the flux through dynamic regulation of metabolic pathways has become a viable approach. Dynamic metabolic engineering can effectively improve key fermentation indexes including yield, productivity and the like. Through the use of a series of metabolite sensors and inducers, the metabolic pathway flux of the cell can be greatly optimized to increase the potential for cell production.
(III) summary of the invention
Aiming at the problems, the invention constructs a DECR-CYS dynamic control system capable of responding to the concentration of L-cysteine in cells, and is applied to an escherichia coli engineering strain for producing the L-cysteine to obtain the genetically engineered bacterium for producing the L-cysteine with high yield.
In order to achieve the above purpose, the invention adopts the following technical scheme:
the genetically engineered bacterium for producing the L-cysteine at high yield is constructed and obtained by the following method:
(1) The strain E.coil W3110EYC was used as chassis strain, and the promoters of its transporter ydeD, yfiK, yeaS and alaE were replaced with P yhaO The promoter, strain E.coli W3110EYC:: P was obtained yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE；
(2) Construction of P yhaO The expression combination of apFAB689 was expressed in the strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO Replacement of the promoter of the alaE transporter tolC with P yhaO APFAB689, strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB689-tolC；
(3) Preparing the strain obtained in the step (2) into chemoconversion competence, and converting a fermentation plasmid pE to obtain EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO And (3) apFAB689-tolC/pE, namely the genetically engineered bacterium for high-yield L-cysteine.
DecR protein is a transcription regulatory factor in Escherichia coli and plays an important role in the L-cysteine detoxification process. Functionally, the DecR protein is capable of interacting with the promoter P in the presence of L-cysteine yahOM Bind to and activate promoter P yhaO Is a transcription of (a). The invention designs a set of DECR-CYS dynamic control system capable of responding to the concentration of L-cysteine in cells based on the function of DecR protein and applies the DECR-CYS dynamic control system to the construction of high-yield strain of the L-cysteine in escherichia coli. By using RBS engineering to the promoter P yhaO Engineering promoters with different transcription intensities are obtained by transformation so as to meet the expression requirements of different target genes. Meanwhile, in order to further improve the L-cysteine production level of the escherichia coli, an efficient L-cysteine external transfer system is screened and constructed, and a genetic engineering strain capable of producing the L-cysteine in a high yield is constructed by combining the efficient L-cysteine external transfer system with a DECR-CYS dynamic control system. The application of the DECR-CYS dynamic control system effectively couples the expression of the L-cysteine external transport protein and the concentration of the L-cysteine, and the higher the concentration of the L-cysteine is, the stronger the expression level of the transport protein is, so that the extracellular accumulation of the L-cysteine of the engineering strain is efficiently promoted.
Wherein the promoter P yhaO The sequence of the apFAB689 is shown as SEQ ID NO.1, the sequence of the apFAB689 is shown as SEQ ID NO.2, and the sequence of the DecR gene is shown as SEQ ID NO. 3.
The invention also relates to a method for constructing the genetically engineered bacterium for producing the L-cysteine at high yield, which comprises the following steps:
(1) The strain E.coil W3110EYC is used as chassis strain, CRISPR-Cas9 gene editing technology is applied to replace the promoters of the transport protein ydeD, yfiK, yeaS and alaE with P yhaO The promoter, strain E.coli W3110EYC:: P was obtained yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE；
(2) Construction of P yhaO The expression combination of-apFAB 689 applies CRISPR-Cas9 gene editing technology to make strain E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO Replacement of the promoter of the alaE transporter tolC with P yhaO APFAB689, strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB689-tolC；
(3) Preparing the strain obtained in the step (2) into chemoconversion competence, and converting a fermentation plasmid pE to obtain EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO And (3) apFAB689-tolC/pE, namely the genetically engineered bacterium for high-yield L-cysteine.
The promoter P yhaO The sequence of the apFAB689 is shown as SEQ ID NO.1, the sequence of the apFAB689 is shown as SEQ ID NO.2, and the sequence of the DecR gene is shown as SEQ ID NO. 3.
The invention also relates to application of the genetically engineered bacterium in microbial fermentation preparation of L-cysteine.
Specifically, the application is as follows: inoculating the genetically engineered bacteria into a fermentation culture medium, fermenting and culturing for 60-72 hours at the temperature of 26-37 ℃ and the rpm of 200-800, and separating and purifying a fermentation liquor supernatant after fermentation to obtain the L-cysteine.
The fermentation medium comprises the following components: glucose 30g/L, (NH) 4 ) 2 SO 4 10g/L、KH 2 PO 4 1g/L、Na 2 S 2 O 3 10g/L, yeast extract 5g/L, na 2 HPO 4 1g/L, 1g/L peptone, 1ml/L microelement solution, deionized water as solvent, and natural pH value; the microelement solution comprises the following components: 0.15g/L Na 2 MoO 4 ·2H 2 O，2.5g/L H 3 BO 3 ，0.7g/L CoCl 2 ·6H 2 O，0.25g/L CuSO 4 ·5H 2 O，1.6g/L MnCl 2 ·4H 2 O，0.3g/L ZnSO 4 ·7H 2 O, the solvent is deionized water.
Before fermentation, the genetically engineered bacteria are usually inoculated into a 10ml LB culture medium test tube, cultured for 12 hours on a shaking table with the rotating speed of 180rpm at the temperature of 37 ℃, then inoculated into a 100ml fermentation culture medium of a secondary seed solution with the inoculum size of 1% of the volume concentration, cultured for 12 hours on a shaking table with the rotating speed of 180rpm at the temperature of 30 ℃, and then inoculated into the fermentation culture medium of a fermentation tank with the inoculum size of 10% of the volume concentration for culture.
According to the invention, a DECR-CYS dynamic regulation system capable of responding to intracellular L-cysteine is constructed, and different engineering promoters are utilized to drive an efficient L-cysteine transport system constructed by effective L-cysteine transport proteins YdeD, yfiK, yeaS, alaE and TolC obtained through screening, so that the escherichia coli engineering strain with high yield of L-cysteine is obtained.
The beneficial effects of the invention are mainly as follows: the engineering strain constructed by the invention can respond to the accumulation level of L-cysteine and dynamically activate an L-cysteine transport system. The higher the L-cysteine concentration, the stronger the transcription level of the transporter in the L-cysteine transport system, which can effectively avoid unordered over-or under-expression of the transport system: the excessive expression level may cause waste of metabolic resources; underexpression may lead to an insufficient capacity for external transport. The DECR-CYS dynamic control system can reasonably and effectively convert the L-cysteine in the cells to outside the cells, reduces the toxic influence of the L-cysteine on the cells, and has good production and application values.
(IV) description of the drawings
FIG. 1 shows the intensity of intense light of strain WT/pR with different concentrations of cysteine added externally;
FIG. 2 shows fluorescence intensities of strain series WT/pR-X under 20mM cysteine conditions;
FIG. 3 shows the OD of the engineering bacteria constructed in example 4 600 And L-cysteine content in the supernatant of the fermentation broth;
FIG. 4 shows the OD of the engineering bacteria constructed in example 5 600 And L-cysteine content in the supernatant of the fermentation broth;
FIG. 5 shows the OD of the engineering bacteria constructed in example 6 600 L-cysteine content in supernatant of fermentation broth；
FIG. 6 shows the OD of the engineering bacteria constructed in example 7 600 And L-cysteine content in the supernatant of the fermentation broth;
FIG. 7 shows the OD of the engineering bacteria constructed in example 8 600 And L-cysteine content in the supernatant of the fermentation broth;
FIG. 8 is an OD of engineering bacteria constructed in example 9 600 And L-cysteine content in the supernatant of the fermentation broth;
FIG. 9 shows the OD of the engineering bacteria constructed in example 10 600 And L-cysteine content in the supernatant of the fermentation broth.
(fifth) detailed description of the invention
The invention will be further described with reference to the following specific examples, but the scope of the invention is not limited thereto:
the parent E.coli strain comes from China Center for Type Culture Collection (CCTCC) with the collection number of CCTCC NO: m20191026, has been disclosed in CN 111019877 a.
Strain e.coli W3110 is from the university of jerusalem CGSC collection (Coli Genetic Stock Center), 8 th month 5 th day of the collection date 1975, deposit number cgsc#4474, which is disclosed in patent US 2009/0298135a1, US2010/0248311 A1.
In an example, the final concentration of kanamycin in the medium is 0.05mg/L, the final concentration of spectinomycin in the medium is 0.05mg/L, and the final concentration of ampicillin in the medium is 0.10mg/L.
LB culture: 10g/L peptone, 5g/L yeast powder and 5g/L sodium chloride, and the solvent is deionized water, and the pH value is natural. LB plates were prepared by adding agar to LB liquid medium at a final concentration of 2g/L.
Example 1: determination of L-cysteine content
(1) 1mL of the bacterial liquid was centrifuged at 12000 Xg for 1min in a 2mL EP tube, and the supernatant and the pellet were separated. The supernatant was used for detection of L-cysteine and other metabolites.
(2) 0.27g of CNBF was weighed and dissolved in 10mL of acetonitrile as solution I; the mother liquor is 0.2M boric acid solution and 0.05M borax solution, and the standard buffer solution with pH=9.0 is prepared by mixing 4:1 volumes and is named as solution II. The sample was diluted to a concentration of 0 to 5g/L, and mixed in a ratio of 100. Mu.L of the sample, 300. Mu.L of the I solution and 500. Mu.L of the II solution, and reacted at 600rpm for 1 hour in a constant temperature shaker. And filling the sample into a liquid phase bottle through a film to be tested.
(3) The instrument is a Siemens flight UPLC ultra-high pressure liquid chromatograph. The chromatographic column was a C18 column (4.6X105 mm,5 μm); the ultraviolet detector detects the wavelength of 260nm; the sample injection amount is 10 mu L; column temperature is 30 ℃; the flow rate is 0.8mL/min; the mobile phase used was AB two phases, phase A neat acetonitrile, phase B50 mM HAc-NaAc buffer: acetonitrile: triethylamine = 82.8:17:0.2, ph=4.9. The gradient elution procedure is shown in table 1.
Table 1: gradient elution procedure
| Sequence number | Time (min) | A(％) | B(％) |
| 1 | 0 | 18 | 82 |
| 2 | 3 | 20 | 80 |
| 3 | 5 | 35 | 65 |
| 4 | 8 | 35 | 65 |
| 5 | 10 | 50 | 50 |
| 6 | 12 | 50 | 50 |
| 7 | 13 | 80 | 20 |
| 8 | 15 | 70 | 30 |
| 9 | 18 | 18 | 82 |
| 10 | 23 | 18 | 82 |
Example 2: construction of L-cysteine dynamic response regulation and control system
(1) pTrc99a plasmidTemplates (99 aline-F and 99 aline-R) were amplified by PCR to give linearized vectors. The E.coli W3110 genome was used as a template (primers Pyhao-F and Pyhao-R) and amplified to obtain a promoter P yhaO Fragments. The pET28a-eGFP plasmid is used as a template (primers eGFP-F and eGFP-R) to amplify to obtain the eGFP fragment. The PCR product was digested with DpnI. All PCR products were detected by 1.0% agarose gel electrophoresis and PCR fragments were purified. The recovered 2 DNA fragments were fused into a complete DNA fragment P using fusion PCR yhaO -eGFP. Linearization of vector and fusion fragment P according to the instructions of one-step cloning kit (One step clonekit, vazyme Biotech, nanjing, china) yhaO The eGFP is connected and transformed into E.coli DH5 alpha, the E.coli DH5 alpha is coated on an ampicillin resistance plate, single colony is picked and verified by colony PCR (primers 99a-VF and 99 a-VR), and pTrc99a-P is obtained by sequencing verification yhaO -eGFP (pR) reporter plasmid. Promoter P yhaO The sequence is shown as SEQ ID NO. 1. The primers are shown in Table 2.
Table 2: example 2 primers
| Primer name | Sequence (5 '-3') |
| P yhao -F | aaatattctgaaatgagctgGAAAGCAGTAAACGCCGCG |
| P yhao -R | tttgctcaccatGGTCTGTTTCCTGTGTGAAATCCAGCACGACCCGCCGG |
| eGFP-F | gtgctggaTTTCACACAGGAAACAGACCATGGTGAGCAAAGGCGAGG |
| eGFP-R | tctcatccgccaaaacagccTCACTTGTACAGTTCGTCCATACCC |
| 99aline-F | GGCTGTTTTGGCGGATGAG |
| 99aline-R | CAGCTCATTTCAGAATATTTGCC |
| 99a-VF | GTTTGACAGCTTATCATCGACTGC |
| 99a-VR | AGACCGCTTCTGCGTTCTG |
(2) E.coli W3110 was prepared as chemocompetent cells, and the constructed pR plasmid was transformed into E.coli W3110 competent cells by chemical transformation to obtain WT/pR strain.
(3) WT/pR was inoculated into 10mL of LB medium and cultured overnight at 37℃and 180 rpm. 1mL of the preculture was inoculated into a 250mL shaking flask containing 50mLLB medium, and different L-cysteine concentrations (1, 2.5,5, 10, 20, 40, 60, 80, 100 mM) were exogenously added, and the culture was performed at 37℃and 180 rpm. Samples were taken every 2 hours, and the fluorescence intensity (excitation wavelength: 488, emission wavelength: 520) was detected using an enzyme-labeled instrument. The change in fluorescence intensity is shown in FIG. 1.
The promoter P yhaO The sequence of DecR gene is shown as SEQ ID NO.1 and the sequence of DecR gene is shown as SEQ ID NO. 3.
As can be seen from FIG. 1, the green fluorescent protein of strain WT/pR achieved different expression intensities after adding different concentrations of L-cysteine, and the fluorescence intensity was gradually increased as the concentration of L-cysteine was increased. Expression of green fluorescent protein is subject to promoter P yhaO Is driven by a driver of (a). The above results indicate that in L-cysteineIn the presence of amino acids, the transcription regulatory factor DecR can effectively activate the promoter P yhaO Is a transcription of (a). At the same time, promoter P yhaO Is positively correlated with the concentration of cysteine. The higher the L-cysteine concentration, the promoter P yhaO The stronger the transcription level of (c).
Example 3: construction of RBS and promoter P of different intensities yhaO Is a combinatorial library of (2)
(1) The plasmid pR is used as a template, and the promoter P on the pR plasmid is mutated by PCR site-directed mutagenesis yhaO RBS, apFAB689 (primers used are RBS689-F and universal RBS-R), apFAB685 (primers used are RBS685-F and universal RBS-R) and apFAB682 (primers used are RBS682-F and universal RBS-R) were added later. The PCR product was digested with DpnI. The digested PCR product is transformed into E.coli DH5 alpha, coated on an ampicillin resistance plate, and single colony is selected for sequencing verification (primer 99a-VF and universal RBS-R) to obtain a vector pTrc99a-P yhaO -apFAB689-eGFP(pR-1)，pTrc99a-P yhaO -apFAB685-eGFP(pR-2)，pTrc99a-P yhaO -apFAB682-eGFP (pR-3). The primers are shown in Table 3.
Table 3: example 3 primers
(2) E.coli W3110 was prepared as chemocompetent cells, and the constructed pR-1, pR-2, pR-3 plasmids were transferred into E.coli W3110 competence by chemical transformation to obtain strains WT/pR-1, WT/pR-2 and WT/pR-3.
(3) The strains WT/pR-1, WT/pR-2 and WT/pR-3 were inoculated into 10mL of LB medium and cultured overnight at 37℃and 180 rpm. 1mL of the preculture was inoculated into a 250mL shaking flask containing 50mLLB medium, 20mM of different L-cysteine concentrations were exogenously added, and the culture was performed at 37℃and 180 rpm. The culture was carried out for 12 hours for sampling, and the fluorescence intensity (excitation wavelength: 488, emission wavelength: 520) was measured using an enzyme-labeled instrument. The change in fluorescence intensity is shown in FIG. 2.
The sequence of the apFAB689 is shown as SEQ ID NO.2, the sequence of the apFAB685 is shown as SEQ ID NO.4, and the sequence of the apFAB682 is shown as SEQ ID NO. 5.
By RBS engineering, the promoter P yhaO Engineering modification is carried out. RBS and promoter P of different intensities yhaO The combinations were performed to obtain different master-RBS combinations. As can be seen from FIG. 2, different Promoter-RBS combinations showed different expression levels after addition of the same concentration of L-cysteine. At the same time, as the RBS strength increases, the expression level of the Promoter-RBS combination is also stronger. The engineering transformation effectively enriches the availability of DECR-CYS dynamic control systems, and can meet the expression requirements of different target genes.
Example 4: construction of L-cysteine efficient transport System
(1) The linearized vector (primers pEline-F and pEline-R) was obtained by PCR amplification using the plasmid pTrc99a-cysE as template. The DNA fragments ydeD, yfiK, tolC, yeaS, and alaE were obtained by PCR amplification using the E.coli W3110 genome as a template, respectively. The PCR product was digested with DpnI. All PCR products were detected by 1.0% agarose gel electrophoresis and PCR fragments were purified. The linearized vector was ligated with DCA fragment, transformed into E.coli DH 5. Alpha. And plated on ampicillin resistant plates according to the instructions of the one-step cloning kit (One step clonekit, vazyme Biotech, nanjing, china), single colonies were picked and verified by colony PCR (primers pE-VF and pE-VR), sequencing to obtain plasmids pTrc99a-cysE-ydeD (pED), pTrc99a-cysE-yfiK (pEK), pTrc99a-cysE-tolC (pEC), pTrc99a-cysE-yeaS (pES), pTrc99a-cysE-alaE (pEA). The primers are shown in Table 4.
Table 4: example 4 primers
(2) E.coli W3110EYC was prepared into chemocompetent cells, and the constructed plasmids pTrc99a-cysE-ydeD (pED), pTrc99a-cysE-yfiK (pEK), pTrc99a-cysE-tolC (pEC), pTrc99a-cysE-yeaS (pES), pTrc99a-cysE-alaE (pEA) were transformed into E.coli W3110EYC competence by chemical transformation to obtain E.coli W3110EYC/pED, E.coliW3110EYC/pEK, E.coliW3110EYC/pEC, E.coliW3110EYC/pES, and E.coli W3110EYC/pEA strains.
(3) E.coli W3110EYC/pED, E.coliW3110EYC/pEK, E.coliW3110EYC/pEC, E.coliW3110EYC/pES, and E.coli W3110EYC/pEA strains were inoculated into 10mL of LB medium, respectively, and cultured overnight at 37℃and 180 rpm. 1mL of the preculture was inoculated into a 500mL shaking flask containing 100mL of SM medium, and cultured at 30℃and 200rpm for 12 hours. Inoculating 100mL of preculture to a fermentation tank filled with 1L of SM culture medium, fermenting and culturing at 25-37 ℃ and 200-800 rpm, and OD 600 When=10 to 30, IPTG was added at a final concentration of 0.1mM and the culture was continued for 60h. Determination of the OD of the fermentation liquor after the fermentation has ended 600 Then 1mL of the fermentation broth was centrifuged at 12000rpm for 3min at room temperature, the fermentation supernatant was diluted 5-fold, and the detection was performed according to the method of example 1, OD 600 And the L-cysteine content in the supernatant of the fermentation broth is shown in FIG. 3.
As can be seen from FIG. 3, the accumulation of L-cysteine of the engineering strain E.coli W3110EYC was efficiently promoted by over-expression of yfiK, ydeD, tolC, yeaS and alaE using the plasmids. The yields of the strains E.coli W3110EYC/pED, E.coliW3110EYC/pEK, E.coliW3110EYC/pES, E.coliW3110EYC/pEC and E.coli W3110EYC/pEA reached 7.2,7.0,7.02,6.73 and 6.82g/L, respectively, which were 10%,7%,7%,3% and 4% higher than the yields of the control strain E.coli W3110 EYC/pE. The above results demonstrate that over-expression of the above transporter on a plasmid can effectively promote L-cysteine accumulation in the engineered strain E.coli W3110 EYC.
Example 5: engineering strain E.coliW3110EYC:: P yhaO Construction of ydeD/pE (ECY:: D) and fermentation thereof
(1) The pTarget Plasmid (Addgene Plasmid # 62226) is used as a template, the gRNA was subjected to site-directed mutagenesis by PCR amplification (primers pTTB-F and pTTB-R). The PCR product was digested with DpnI. The digestion products were transferred to E.coli DH 5. Alpha. And plated on a spectinomycin plate, single colonies were picked for sequencing verification (primers pTTB-VF and pTTB-VR), and successfully mutated pTarget-ydeD plasmids were selected.
(2) Using E.coli W3110 genome as a template, 500bp sequences upstream and downstream of the ydeD promoter of the gene and the promoter P were amplified by PCR yhaO Obtaining DNA fragments, down-ydeD-Up (primers Up-F and Up-R), down-ydeD-Down (primers Down-F and Down-R) and Down-P yhaO (ydeD) (primer P yhaO -F and P yhaO -R). The three DNA fragments were fused by fusion PCR to obtain a DNA fragment Donor-ydeD.
(3) The strain E.coli W3110EYC was prepared to a transformation competent, and the pCas Plasmid (Addgene Plasmid # 62225) was transformed into E.coli W3110EYC transformation competent by chemical transformation, and was plated on kanamycin resistance plates to obtain strain E.coli W3110EYC/pCas.
(4) Strain e.coli w3110eyc/pCas was made electrotransducent. After the plasmid pTarget-ydeD and the fragment Donor-ydeD are electrotransferred to W3110EYC/pCas electrotransferred competence, the plasmid is coated on a kanamycin and spectinomycin double-resistance plate, single colony is selected for PCR verification (primers ydeDJYZ-VF and ydeDJYZ-VR), and successfully edited strains are screened to obtain E.coli W3110EYC:: P yhaO ydeD. The primers are shown in Table 5.
Table 5: example 5 primers
(5) Positive single colonies were picked up and inoculated into LB tubes containing 1mM IPTG and 0.05mg/L kanamycin, incubated overnight at 30℃and streaked on LB plates containing 0.05mg/L kanamycin, incubated for 24 hours at 30℃and single colonies were picked up and streaked on LB plates containing 0.05mg/L spectinomycin and failed to successfully eliminate pTarget-ydeD plasmid on LB plates containing 0.05mg/L spectinomycin. Picking single colony successfully eliminated by pTarget-ydeD plasmid, culturing overnight at 37deg.C, streaking the next day bacterial solution on LB plate, culturing at 37deg.C for 12 hr, picking single colony streaking on LB plate containing 0.05mg/L kanamycin, unable to single colony on LB plate containing 0.05mg/L kanamycin, pCas matterSuccessful elimination of the plasmid resulted in the plasmid-free E.coli W3110EYC:: P yhaO -ydeD。
(6) The strain E.coli W3110EYC:: P yhaO Preparation of the ydeD to chemotransfer competence, transformation of the fermentation plasmid pE to E.coli W3110EYC:: P yhaO In the ydeD conversion competence, the mixture was spread on ampicillin-resistant plates to obtain a strain E.coli W3110EYC:: P containing a fermentation plasmid yhaO ydeD/pE (EYC:: D). E.coliW3110EYC:: P to be constructed yhaO A fermentation test and test was carried out as described in example 4 (3) with ydeD/pE (EYC: D). OD (optical density) 600 And the L-cysteine content in the supernatant of the fermentation broth is shown in FIG. 4.
In order to achieve a rational and efficient expression of the transporter, the DECR-CYS dynamic control system is used to drive the expression of the L-cysteine transport system. As can be seen from FIG. 4, the promoter of the transporter ydeD is replaced by P yhaO After the promoter, the strain E.coli W3110EYC:: P yhaO The L-cysteine yield of ydeD/pE (EYC:: D) reached 6.91g/L, a 5% increase over the control strain E.coli W3110EYC/pE (ECY). The above results demonstrate that the use of the DECR-CYS dynamic control system to control expression of the gene ydeD is effective in promoting accumulation of L-cysteine in an engineering strain.
Example 6: engineering strain E.coliW3110EYC:: P yhaO -ydeD::P yhaO Construction of-yfiK/pE (ECY:: DK) and fermentation thereof
(1) The gRNA was subjected to site-directed mutagenesis (primers pTTB-F and pTTB-R) by PCR amplification using the pTarget Plasmid (Addgene Plasmid # 62226) as template. The PCR product was digested with DpnI. The digestion products were transferred to E.coli DH 5. Alpha. And plated on a spectinomycin plate, single colonies were picked for sequencing verification (primers pTTB-VF and pTTB-VR), and the mutant pTarget-yfiK plasmid was selected.
(2) Using E.coli W3110 genome as template, 500bp sequence upstream and downstream of gene yfiK promoter and promoter P were amplified by PCR yhaO Obtaining DNA fragments, down-yfiK-Up (primers Up-F and Up-R), down-yfiK-Down (primers Down-F and Down-R) and Down-P yhaO (yfiK) (primer-P yhaO -F and P yhaO -R). The three DNA fragments are fused by fusion PCR to obtain a DNA fragmentSegment Donor-yfiK.
(3) The strain E.coli W3110EYC:: P yhaO Preparation of the ydeD to become competent, the pCas Plasmid (Addgene Plasmid # 62225) was transformed into E.coli W3110EYC:: P by chemical transformation yhaO In the ydeD transformation competence, the strain E.coli W3110EYC:: P was obtained by coating on a kanamycin resistance plate yhaO -ydeD/pCas。
(4) The strain E.coli W3110EYC:: P yhaO The ydeD/pCas was prepared as electrotransport competent. The plasmid pTarget-yfiK, fragment Donor-yfiK was electrotransferred to W3110EYC:: P yhaO after-ydeD/pCas electrotransformation competence, the bacterial strain is coated on a kanamycin and spectinomycin double-resistance plate, single bacterial colony is selected for PCR verification (primers yfikJYZ-VF and yfikJYZ-VR), and an edited strain is screened to obtain E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK. The primers are shown in Table 6.
Table 6: example 6 primer
(5) Positive single colony E.collW 3110EYC:: P was picked yhaO -ydeD::P yhaO The single colony streaked on LB plate containing 0.05mg/L spectinomycin was picked and streaked on LB plate containing 0.05mg/L spectinomycin, and the pTarget-yfiK plasmid was not successfully deleted on LB plate containing 0.05mg/L spectinomycin, by inoculating yfiK to LB tube containing 1mM IPTG and 0.05mg/L kanamycin, culturing overnight at 30℃and streaking on LB plate containing 0.05mg/L kanamycin, culturing for 24 hours at 30 ℃. Picking single colony successfully eliminated by pTarget-yfiK plasmid in LB test tube, culturing overnight at 37 ℃, streaking the next day bacterial solution in LB plate, culturing for 12h at 37 ℃, picking single colony streaked on LB plate containing 0.05mg/L kanamycin, unable to successfully eliminate pCas plasmid in single colony of LB plate containing 0.05mg/L kanamycin, finally obtaining plasmid-free E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK。
(6) The strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO Preparation of the transformation competent of yfiK, transformation of the fermentation plasmid pE into E.coli W3110EYC:: P yhaO -ydeD::P yhaO In the transformation competence of yfiK, the mixture is coated on an ampicillin resistance plate to obtain a strain E.coli W3110EYC:: P containing a fermentation plasmid yhaO -ydeD::P yhaO -yfiK/pE (EYC:: DK). E.coliW3110EYC:: P to be constructed yhaO -ydeD::P yhaO A fermentation test and test was carried out as described in example 4 (3) on yfiK/pE (EYC:: DK). OD (optical density) 600 And the L-cysteine content in the supernatant of the fermentation broth is shown in FIG. 5.
In order to be able to further increase the accumulation of L-cysteine in the engineering strain, P was found in the strain E.coli W3110EYC: yhaO on the basis of ydeD, a DECR-CYS dynamic control system is utilized to drive the expression of yfiK, so as to obtain the strain E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK. As can be seen from FIG. 5, the promoter of the transporter yfiK was replaced with P yhaO After the promoter, the strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO The L-cysteine yield of-yfiK/pE (EYC:: DK) reached 7.27g/L, compared to the control strain E.coli W3110EYC:: P yhaO -ydeD/pE (EYC: D) increased by 5%. The above results demonstrate that the use of the DECR-CYS dynamic control system to control the expression of the gene yfiK is effective in promoting the accumulation of L-cysteine in an engineering strain.
Example 7: engineering strain E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO Construction of yeaS/pE (EYC:: DKS) and fermentation thereof
(1) The gRNA was subjected to site-directed mutagenesis (primers pTTB-F and pTTB-R) by PCR amplification using the pTarget Plasmid (Addgene Plasmid # 62226) as template. The PCR product was digested with DpnI. The digestion products were transferred to E.coli DH 5. Alpha. And plated on a spectinomycin plate, single colonies were picked for sequencing verification (primers pTTB-VF and pTTB-VR), and the mutated pTarget-yeaS plasmid was selected.
(2) The E.coli W3110 genome was used as template to amplify the 500bp sequence upstream and downstream of the gene yeaS promoter, and the promoter P by PCR yhaO Obtaining DNA fragments, down-yeaS-Up (primers Up-F and Up-R), down-yeaS-Down (primers Down-F and Down-R) and Down-P yhaO (yeaS) (primer P yhaO -F and P yhaO -R). The three DNA fragments are fused by fusion PCR to obtain a DNA fragmentSegment Donor-yeaS.
(3) The strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO Preparation of the yfiK to become competent, the pCas Plasmid (Addgene Plasmid # 62225) was transformed into E.coli W3110EYC:: P by chemical transformation yhaO -ydeD::P yhaO In the transformation competence of yfiK, the strain E.coli W3110EYC:: P was obtained by coating on a kanamycin resistance plate yhaO -ydeD::P yhaO -yfiK/pCas。
(4) The strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK/pCas was prepared as electrotransport competent. The plasmid pTarget-yeaS, fragment Donor-yeaS was electrotransferred to W3110EYC:: P yhaO -ydeD::P yhaO After the-yfiK/pCas electrotransformation competence, the bacterial strain is coated on a kanamycin and spectinomycin double-resistance plate, single colony is selected for PCR verification (primers yeaSJYZ-VF and yeaSJYZ-VR), and the successfully edited bacterial strain is screened to obtain E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO yeaS. The primers are shown in Table 7.
Table 7: example 7 primer
| Primer name | Sequence (5 '-3') |
| pTTB-F | TAATACTAGTCTGATTAATGATTCAATTATGTTTTAGAGCTAGAAATAGC |
| pTTB-R | GCTCTAAAACATAATTGAATCATTAATCAGACTAGTATTATACCTAGGAC |
| Up-F | TCGATCTCGATATTCGCATTGG |
| Up-R | tactgctttcTCAGGCATGCTCCAGTGAAAA |
| P yhaO -F | gcatgcctgaGAAAGCAGTAAACGCCGCG |
| P yhaO -R | GGTCTGTTTCCTGTGTGAAATCCAGCACGACCCGCCGG |
| Down-F | tgctggaTTTCACACAGGAAACAGACCGTGTTCGCTGAATACGGGGTT |
| Down-R | TAGCAGAAACTCACCAGTTCCAGC |
| pTTB-VF | GTCAGTGAGCGAGGAAGCGG |
| pTTB-VR | TAGCACGATCAACGGCACTG |
| yeaSJYZ-VF | CAGCAGCTTTGGTTTTGGAC |
| yeaSJYZ-VR | AATGGCCAGTCCTCCGCGTGATG |
(5) Positive single colony E.collW 3110EYC:: P was picked yhaO -ydeD::P yhaO -yfiK::P yhaO YeaS was inoculated into LB tubes containing 1mM IPTG and 0.05mg/L kanamycin, incubated overnight at 30℃and streaked onto LB plates containing 0.05mg/L kanamycin, incubated at 30℃for 24h, and single colonies were picked and streaked onto LB plates containing 0.05mg/LLB plates of mycin failed to eliminate the pTarget-yeaS plasmid successfully on single colonies of LB plates containing 0.05mg/L spectinomycin. Picking single colony successfully eliminated by pTarget-yeaS plasmid, culturing overnight at 37 ℃, streaking the next day bacterial solution on LB plate, culturing for 12h at 37 ℃, picking single colony streaked on LB plate containing 0.05mg/L kanamycin, unable to successfully eliminate pCas plasmid on single colony of LB plate containing 0.05mg/L kanamycin, finally obtaining plasmid-free E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS。
(6) The strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO Preparation of the yeaS to chemotransfer competence, transformation of the fermentation plasmid pE to E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO In the transformation competence of yeaS, the strain is coated on an ampicillin resistance plate to obtain a strain E.coli W3110EYC:: P containing a fermentation plasmid yhaO -ydeD::P yhaO -yfiK::P yhaO YeaS/pE (EYC:: DKS). E.coliW3110EYC:: P to be constructed yhaO -ydeD::P yhaO -yfiK::P yhaO Fermentation test and detection were carried out as described in example 4 (3) with yeaS/pE (EYC:: DKS). OD (optical density) 600 And the L-cysteine content in the supernatant of the fermentation broth is shown in FIG. 6.
In order to be able to further increase the accumulation of L-cysteine in the engineering strain, P was found in the strain E.coli W3110EYC: yhaO -ydeD::P yhaO on the basis of the yfiK, a DECR-CYS dynamic control system is utilized to drive the expression of the yfiK, so that a strain E.coliW3110EYC:: P is obtained yhaO -ydeD::P yhaO -yfiK::P yhaO yeaS. As can be seen from FIG. 6, the transporter yeaS promoter is replaced by P yhaO After the promoter, the strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO The L-cysteine yield of yeaS/pE (EYC:: DKS) reached 7.47g/L. The above results demonstrate that the use of the DECR-CYS dynamic control system to control expression of the gene yeaS is effective in promoting accumulation of L-cysteine in an engineering strain.
Example 8: engineering strain E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO Construction of alaE/pE (EYC:: DKSA) and fermentation thereof
(1) The gRNA was subjected to site-directed mutagenesis (primers pTTB-F and pTTB-R) by PCR amplification using the pTarget Plasmid (Addgene Plasmid # 62226) as template. The PCR product was digested with DpnI. The digestion products were transferred to E.coli DH 5. Alpha. And plated on a spectinomycin plate, single colonies were picked for sequencing verification (primers pTTB-VF and pTTB-VR), and the mutant pTarget-alaE plasmid was selected.
(2) Using E.coli W3110 genome as template, 500bp sequence upstream and downstream of the alaE promoter of gene and promoter P were amplified by PCR yhaO Obtaining DNA fragments, down-alaE-Up (primers Up-F and Up-R), down-alaE-Down (primers Down-F and Down-R) and Down-P yhaO (alaE) (primer P yhaO -F and P yhaO -R). The three DNA fragments were fused by fusion PCR to obtain a DNA fragment Donor-alaE.
(3) The strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO Preparation of YeaS to become competent, the pCas Plasmid (Addgene Plasmid # 62225) was transformed into E.coli W3110EYC:: P by chemical transformation yhaO -ydeD::P yhaO -yfiK::P yhaO In the transformation competence of yeaS, the strain E.coli W3110EYC:: P was obtained by coating on kanamycin resistance plates yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS/pCas。
(4) The strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO Preparation of yeaS/pCas to electrotransport competence. The plasmid pTarget-alaE, fragment Donor-alaE was electrotransferred to W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO After the electric transformation competence of yeaS/pCas, the bacterial strain is coated on a kanamycin and spectinomycin double-resistance plate, single colony is selected for PCR verification (primers alaEJYZ-VF and alaEJYZ-VR), and the successfully edited bacterial strain is screened to obtain E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE. The primers are shown in Table 8.
Table 8: example 8 primers
(5) Positive single colony E.collW 3110EYC:: P was picked yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO AlaE was inoculated into LB tubes containing 1mM IPTG and 0.05mg/L kanamycin, incubated overnight at 30℃and streaked onto LB plates containing 0.05mg/L kanamycin, incubated for 24h at 30℃and single colonies streaked onto LB plates containing 0.05mg/L spectinomycin were picked and failed to successfully eliminate their pTarget-alaE plasmid on LB plates containing 0.05mg/L spectinomycin. Picking single colony successfully eliminated by pTarget-alaE plasmid, culturing overnight at 37 ℃, streaking the next day bacterial solution on LB plate, culturing for 12h at 37 ℃, picking single colony streaked on LB plate containing 0.05mg/L kanamycin, unable to successfully eliminate pCas plasmid on single colony of LB plate containing 0.05mg/L kanamycin, finally obtaining plasmid-free E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE。
(6) The strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO AlaE was prepared to chemo-competent, and the fermentation plasmid pE was transformed into E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO In the alaE transformation competence, the mixture is coated on an ampicillin resistance plate to obtain a strain E.coli W3110EYC:: P containing a fermentation plasmid yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO alaE/pE (EYC:: DKSA). E.coliW3110EYC:: P to be constructed yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO Fermentation test and test were carried out as described in example 4 (3) with alaE/pE (EYC:: DKSA). OD (optical density) 600 And the L-cysteine content in the supernatant of the fermentation broth is shown in FIG. 7.
In order to be able to further increase the accumulation of L-cysteine in the engineering strain, P was found in the strain E.coli W3110EYC: yhaO -ydeD::P yhaO -yfiK::P yhaO -replacement of the transporter alaE promoter with P on the basis of yeaS yhaO Promoter, obtainedTo the strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE. As can be seen from FIG. 7, the expression of yfiK was driven by the DECR-CYS dynamic control system, strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO The L-cysteine yield of alaE/pE (EYC:: DKSA) reached 7.62g/L. The above results demonstrate that the use of the DECR-CYS dynamic control system to control expression of the gene alaE is effective in promoting accumulation of L-cysteine in an engineering strain.
Example 9: engineering strain E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO Construction of tolC/pE (EYC:: DKSAC) and fermentation thereof
(1) The gRNA was subjected to site-directed mutagenesis (primers pTTB-F and pTTB-R) by PCR amplification using the pTarget Plasmid (Addgene Plasmid # 62226) as template. The PCR product was digested with DpnI. The digested products were transferred to E.coli DH 5. Alpha. And plated on a spectinomycin plate, single colonies were picked for sequencing verification (primers pTTB-VF and pTTB-VR), and the mutant pTarget-tolC plasmid was selected.
(2) Using E.coli W3110 genome as template, 500bp sequence upstream and downstream of tolC promoter of gene and promoter P were amplified by PCR yhaO Obtaining DNA fragments, down-tolC-Up (primers Up-F and Up-R), down-tolC-Down (primers Down-F and Down-R) and Down-P yhaO (tolC) (primer P yhaO -F and P yhaO -R). The three DNA fragments were fused by fusion PCR to obtain a DNA fragment Donor-tolC.
(3) The strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO Preparation of alaE to become competent, the pCas Plasmid (Addgene Plasmid # 62225) was transformed by chemical transformation into E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO In the alaE transformation competence, the strain E.coli W3110EYC:: P was obtained by coating on a kanamycin resistance plate yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE/pCas。
(4) The strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO alaE/pCas was prepared as electrotransport competence. The plasmid pTarget-tolC, fragment Donor-tolC was electrotransferred to W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO After alaE/pCas electrotransformation competence, the strain is coated on a kanamycin and spectinomycin double-resistance plate, single colony is selected for PCR verification, and an edited strain is screened to obtain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO tolC. The primers are shown in Table 9.
Table 9: example 9 primer
(5) Positive single colony E.collW 3110EYC:: P was picked yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO tolC was inoculated into LB tubes containing 1mM IPTG and 0.05mg/L kanamycin, incubated overnight at 30℃and streaked onto LB plates containing 0.05mg/L kanamycin, incubated for 24h at 30℃and single colonies streaked onto LB plates containing 0.05mg/L spectinomycin were picked and failed to successfully eliminate their pTarget-tolC plasmid on LB plates containing 0.05mg/L spectinomycin. Picking single colony successfully eliminated by pTarget-tolC plasmid, culturing overnight at 37 ℃, streaking the next day bacterial solution on LB plate, culturing for 12h at 37 ℃, picking single colony streaked on LB plate containing 0.05mg/L kanamycin, unable to successfully eliminate pCas plasmid on single colony of LB plate containing 0.05mg/L kanamycin, finally obtaining plasmid-free E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -tolC。
(6) The strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO A transformation competent was prepared from tolC, and the fermentation plasmid pE was transformed into E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO In the tolC transformation competence, the mixture is coated on an ampicillin resistance plate to obtain a strain E.coli W3110EYC:: P containing a fermentation plasmid yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO tolC/pE (EYC:: DKSAC). E.coliW3110EYC:: P to be constructed yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO A fermentation test and test was carried out as described in example 4 (3) on tolC/pE (EYC:: DKSAC). OD (optical density) 600 And the L-cysteine content in the supernatant of the fermentation broth is shown in FIG. 8.
In order to be able to further increase the accumulation of L-cysteine in the engineering strain, P was found in the strain E.coli W3110EYC: yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO the expression of tolC is driven by a DECR-CYS dynamic control system on the basis of alaE to obtain the strain E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO tolC. As can be seen from FIG. 8, the promoter of the transporter tolC is replaced by P yhaO After the promoter, the strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO L-cysteine production by alaE/pE (EYC:: DKSAC) was reduced to 7.21g/L. The result of the yield improvement resulting from the overexpression of tolC in the binding plasmid was analyzed as promoter P yhaO Insufficient expression of driven tolC results in reduced accumulation of L-cysteine. The above results demonstrate that the expression levels of different target genes need to be optimized for optimal yield accumulation.
Example 10: RBS optimization of gene tolC expression units
(1) RBS optimization was performed on the tolC gene of the strain constructed in example 8, and the expression intensity of the tolC gene was adjusted.
(2) DNA fragments were obtained by PCR amplification using E.coli W3110 genome as a template, 500bp sequences upstream and downstream of the tolC promoter of the gene (primers Up-F and Up-R, primers Down-F (689) and Down-R, primers Down-F (685) and Down-R), andprimers Down-F (682) and Down-R), promoter P yhaO (primer P) yhaO -F and P yhaO -R) and RBS apFAB689 (primers RBS689-R and RBS-F), apFAB685 (primers RBS685-R and RBS-F) and apFAB682 (primers RBS682-R and RBS-F). The four DNA fragments were fused by fusion PCR to obtain DNA fragments Donor-apFAB689-tolC, donor-apFAB685-tolC and Donor-apFAB682-tolC.
(3) The strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO Preparation of alaE to become competent, the pCas Plasmid (Addgene Plasmid # 62225) was transformed by chemical transformation into E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO In the alaE transformation competence, the strain E.coli W3110EYC:: P was obtained by coating on a kanamycin resistance plate yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE/pCas。
(4) The strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO alaE/pCas was prepared as electrotransport competence. The plasmids pTarget-tolC, the fragments Donor-apFAB689-tolC, donor-apFAB685-tolC and Donor-apFAB682-tolC were each electrotransformed to W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO After alaE/pCas electrotransformation competence, the strain is coated on a kanamycin and spectinomycin double-resistance plate, single colony is selected for PCR verification (primers tolCJYZ-VF and tolCJYZ-VR), and successfully edited strains are screened to obtain E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB689-tolC，E.coliW3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO APFAB685-tolC and E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB682-tolC. The primers are shown in Table 10.
Table 10: example 10 primer
(5) Positive single colonies were picked up and inoculated into LB tubes containing 1mM IPTG and 0.05mg/L kanamycin, incubated overnight at 30℃and streaked on LB plates containing 0.05mg/L kanamycin, incubated for 24h at 30℃and single colonies were picked up and streaked on LB plates containing 0.05mg/L spectinomycin and failed to successfully eliminate the pTarget-tolC plasmid on LB plates containing 0.05mg/L spectinomycin. Picking single colony successfully eliminated by pTarget-tolC plasmid, culturing overnight at 37 ℃, streaking the next day bacterial solution on LB plate, culturing for 12h at 37 ℃, picking single colony streaked on LB plate containing 0.05mg/L kanamycin, unable to successfully eliminate pCas plasmid on single colony of LB plate containing 0.05mg/L kanamycin, finally obtaining plasmid-free E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB689-tolC，E.coliW3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO APFAB685-tolC and E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB682-tolC。
(6) Preparing the three aseptic strains into transformation competence, transforming the fermentation plasmid pE into the transformation competence of the strains, and coating the transformation competence on an ampicillin resistance plate to obtain a strain E.coliW3110EYC:: P containing the fermentation plasmid yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB689-tolC/pE(EYC::DKSAC-1)，E.coliW3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO APFAB685-tolC/pE (EYC:: DKSAC-2) and E.coli W3110EYC::: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB682-tolC/pE (EYC:: DKSAC-3). The three strains thus constructed were subjected to fermentation test and detection in accordance with the method of example 4 (3). OD (optical density) 600 And the L-cysteine content in the supernatant of the fermentation broth is shown in FIG. 9.
To further optimize the expression level of the gene tolC, the Promoter-RBS combination with different expression levels constructed in example 3 was used to drive the expression of tolC to increase the accumulation of L-cysteine in the engineered strain. In the strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO The expression of tolC is driven by a DECR-CYS dynamic control system on the basis of alaE to obtain the strain E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB689-tolC，E.coliW3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO APFAB685-tolC and E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB682-tolC. As can be seen from FIG. 9, the promoter of the transporter tolC is replaced by P yhaO -apFAB689，P yhaO -apFAB685 or P yhaO After expression of the combination, the strain achieved accumulation of different L-cysteines. Wherein, the strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO APFAB689-tolC/pE (EYC:: DKSAC-1) achieved an accumulation of L-cysteine of 7.86 g/L.
The sequence of the apFAB689 is shown as SEQ ID NO.2, the sequence of the apFAB685 is shown as SEQ ID NO.4, and the sequence of the apFAB682 is shown as SEQ ID NO. 5.
The results show that the DECR-CYS dynamic control system drives the expression of the L-cysteine transport system through engineering transformation, so that the accumulation of L-cysteine engineering strains can be effectively promoted. Meanwhile, the master-RBS combination body obtained by RBS engineering transformation can meet the expression requirements of different target genes, and has good engineering application prospect.
Claims (8)
1. A genetically engineered bacterium for high-yield L-cysteine is constructed and obtained by the following method:
(1) The strain E.coil W3110EYC was used as chassis strain, and the promoters of its transporter ydeD, yfiK, yeaS and alaE were replaced with P yhaO The promoter, strain E.coli W3110EYC:: P was obtained yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE；
(2) Construction of P yhaO The expression combination of apFAB689 was expressed in the strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO Replacement of the promoter of the alaE transporter tolC with P yhaO APFAB689, strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB689-tolC；
(3) Preparing the strain obtained in the step (2) into chemoconversion competence, and converting a fermentation plasmid pE to obtain EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO And (3) apFAB689-tolC/pE, namely the genetically engineered bacterium for high-yield L-cysteine.
2. The genetically engineered bacterium for high production of L-cysteine according to claim 1, wherein said promoter P yhaO The sequence of (2) is shown as SEQ ID NO. 1.
3. The genetically engineered bacterium for high yield of L-cysteine according to claim 1, wherein the sequence of apFAB689 is shown in SEQ ID No. 2.
4. The genetically engineered bacterium for high yield of L-cysteine according to claim 1, wherein the DecR gene has a sequence shown in SEQ ID No. 3.
5. The method for constructing the genetically engineered bacterium for high yield of L-cysteine as claimed in claim 1, which is characterized by comprising the following steps:
(1) In strain ECoil W3110EYC is chassis strain, CRISPR-Cas9 gene editing technology is applied to replace the promoters of its transport protein ydeD, yfiK, yeaS and alaE with P yhaO The promoter, strain E.coli W3110EYC:: P was obtained yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE；
(2) Construction of P yhaO The expression combination of-apFAB 689 applies CRISPR-Cas9 gene editing technology to make strain E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO Replacement of the promoter of the alaE transporter tolC with P yhaO APFAB689, strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB689-tolC；
(3) Preparing the strain obtained in the step (2) into chemoconversion competence, and converting a fermentation plasmid pE to obtain EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO And (3) apFAB689-tol C/pE, namely the genetically engineered bacterium for high-yield L-cysteine.
6. The method of claim 4, wherein the promoter P yhaO The sequence of the apFAB689 is shown as SEQ ID NO.1, the sequence of the apFAB689 is shown as SEQ ID NO.2, and the sequence of the DecR gene is shown as SEQ ID NO. 3.
7. The use of the genetically engineered bacterium of claim 1 in the preparation of L-cysteine by microbial fermentation.
8. The application according to claim 6, characterized in that the application is: inoculating the genetically engineered bacteria into a fermentation culture medium, fermenting and culturing for 60-72 hours at the temperature of 26-37 ℃ and the rpm of 200-800, and separating and purifying a fermentation liquor supernatant after fermentation to obtain the L-cysteine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211335028.1A CN116064354A (en) | 2022-10-28 | 2022-10-28 | Genetically engineered bacterium for high-yield of L-cysteine, construction method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211335028.1A CN116064354A (en) | 2022-10-28 | 2022-10-28 | Genetically engineered bacterium for high-yield of L-cysteine, construction method and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116064354A true CN116064354A (en) | 2023-05-05 |
Family
ID=86180977
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211335028.1A Pending CN116064354A (en) | 2022-10-28 | 2022-10-28 | Genetically engineered bacterium for high-yield of L-cysteine, construction method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116064354A (en) |
-
2022
- 2022-10-28 CN CN202211335028.1A patent/CN116064354A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Rozkov et al. | Characterization of the metabolic burden on Escherichia coli DH1 cells imposed by the presence of a plasmid containing a gene therapy sequence | |
| WO2012129748A1 (en) | Recombinant e.coli and use thereof in producing 5-aminolevulinic acid | |
| CN108795789A (en) | A kind of high-yield itaconic acid Yarrowia lipolytica engineered strain and its construction method, zymotechnique and application | |
| CN114107078A (en) | High-yield valencene genetic engineering bacterium and construction method and application thereof | |
| WO2024045620A1 (en) | Recombinant strain for producing 2'-fucosyllactose, construction method, and use | |
| CN108998401B (en) | Method for producing 3-aminoisobutyric acid | |
| CN114774341A (en) | Gene engineering bacterium for producing orotic acid and construction method and application thereof | |
| CN106032525A (en) | A genetically engineered bacterium for synthesizing resveratrol and a constructing method thereof | |
| WO2024099089A1 (en) | Genetically engineered strain for producing pseudouridine, construction method therefor and use thereof | |
| CN116875519A (en) | Genetically engineered bacterium for high-yield of L-cysteine as well as construction method and application thereof | |
| CN109913515B (en) | Method for increasing yield of poly gamma-glutamic acid by improving glycerol metabolism of bacillus | |
| CN116064354A (en) | Genetically engineered bacterium for high-yield of L-cysteine, construction method and application | |
| CN116042425A (en) | Yeast engineering bacteria for producing patchouli alcohol and application thereof | |
| CN114736918A (en) | Recombinant escherichia coli for producing salidroside through integrated expression and application thereof | |
| CN114891707A (en) | Recombinant strain and method for producing bilirubin through whole-cell catalysis of recombinant strain | |
| CN110951760B (en) | Protein time-delay expression switch and application thereof in production of glucaric acid | |
| CN108265068B (en) | Recombinant arginine deiminase and industrial preparation method and application thereof | |
| CN114350586B (en) | Genetically engineered bacterium for high-yield of L-cysteine, construction method and application | |
| CN116837015A (en) | Genetically engineered bacterium for high-yield of L-cysteine as well as construction method and application thereof | |
| Zhan et al. | Expanding the CRISPR Toolbox for Engineering Lycopene Biosynthesis in Corynebacterium glutamicum | |
| CN116837016B (en) | Method for constructing recombinant escherichia coli engineering strain for producing capsaicin-vanilla nonanamide, recombinant strain and application | |
| CN117660577B (en) | Application of LtaSA protein or coding gene thereof in riboflavin production | |
| CN116445514A (en) | High-yield L-cysteine gene engineering bacterium based on cysB mutant and application thereof | |
| CN114752543B (en) | Gluconobacter oxydans for synthesizing 2-keto-L-gulonic acid by taking glucose as substrate through one-step fermentation and application thereof | |
| CN117844727A (en) | Genetic improvement method for constructing riboflavin high-yield strain based on bacterial colony induction regulation strategy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |