CN106032525A - A genetically engineered bacterium for synthesizing resveratrol and a constructing method thereof - Google Patents
A genetically engineered bacterium for synthesizing resveratrol and a constructing method thereof Download PDFInfo
- Publication number
- CN106032525A CN106032525A CN201510107705.8A CN201510107705A CN106032525A CN 106032525 A CN106032525 A CN 106032525A CN 201510107705 A CN201510107705 A CN 201510107705A CN 106032525 A CN106032525 A CN 106032525A
- Authority
- CN
- China
- Prior art keywords
- gene
- sts
- tyrr
- coli
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
A genetically engineered bacterium for synthesizing resveratrol is disclosed. The genetically engineered bacterium is obtained by knocking tyrR and trpED which are genes limiting tyrosine synthesis from glucose out of E.coli BW25113, and the chromosome is recombined with a tyrosine deaminase gene tal of rhodotorula glutinis, a petroselinum crispum p-coumaric acid: coenzyme A ligase gene 4cl and a stilbene synthase gene sts of grapes. The genetically engineered bacterium adopts glucose as a substrate to synthesize the resveratrol.
Description
Technical field
The invention belongs to synthetic biology and metabolic engineering field, particularly relate to gene knockout and gene
The technique constructions such as restructuring can the colibacillus engineering of synthesizing resveratrol and construction method thereof.
Background technology
Resveratrol is a kind of non-flavonoid polyphenolic substance, chemical entitled RV
(3,4 ', 5-trihydroxystilbene), are primarily present in the plants such as Fructus Vitis viniferae, Semen arachidis hypogaeae, mulberry and Rhizoma Polygoni Cuspidati.
Numerous studies show, resveratrol has the multiple pharmacological effect such as anticancer, antiinflammatory, protection cardiovascular[1]～[5]。
Resveratrol is also used as the additive of cosmetics and health product, the most also has Related product,
Such as Jia Kangli (Shaklee) VIVIX natural plant extraction liquid, U.S.'s Swanson red wine elite nourishing capsule
With red wine element etc..
Resveratrol synthetic method has plant extraction method, chemical synthesis and Microbe synthesis method.From natural
Plant is extracted resveratrol be faced with extraction work is numerous and diverse, time cycle length, yield poorly and shortage of resources
Etc. problem, and chemosynthesis has synthetic route length, energy consumption height, and easily causes the problems such as environmental pollution.
Microbe synthesis method has the advantages that to obtain a large amount of purpose products at short notice, and environmental pollution is little,
The advantages such as natural resources destroys less, operation relative ease.Therefore, the engineering bacteria of high yield resveratrol is built
Strain synthesizing resveratrol has great market value.
The key gene of resveratrol route of synthesis is mainly recombinated by current research report with plasmid,
And then it is intracellular that recombinant vector is imported recombinant bacterial strain, last recombinant bacterial strain is with to coumaric acyl, phenylalanine
Or tyrosine etc. is fermenting substrate synthesizing resveratrol[6]～[13].Chinese patent CN102605006A and
In the technical scheme that CN103540561A records, by Phenylalanine Hydroxylase Gene, TALase base
Cause, 4-coumaric acyl: CoA ligase gene and Resveratrol synthase gene maybe will express tyrosine deamination
Enzyme TAL, 4-perfume (or spice) cinnamic acid: CoA ligase 4CL, stilbene synthase STS, malonic acid transhipment enzyme matC with
And the gene of malonic acid absorption enzyme matB is transformed in strain respectively, obtain the weight for expressing resveratrol
Group engineering strain；But these researchs are faced with 2 problems: 1) plasmid expression has unstability, i.e. loses
Passing unstability and environment unstability, as in the environment of hot fermentation, plasmid is easily lost；2) right
The substrate prices such as coumaric acyl, phenylalanine or tyrosine are high, are unfavorable for the industrialization of production technology.
List of references is as follows:
[1]Schuster S,Penke M,Gorski T,et al.Resveratrol differentially regulates NAMPT and SIRT1in
hepatocarcinoma cells and primary human hepatocytes[J].PLoS One,2014,9(3):e91045.
[2]Tomé-Carneiro J,Larrosa M,Yanez-Gascon MJ,et al.One-year supplementation with a grape extract
containing resveratrol modulates inflammatory-related microRNAs and cytokines expression in peripheral blood
mononuclear cells of type 2diabetes and hypertensive patients with coronary artery disease[J].Pharmacol Res,2013,
72:69-82.
[3].Ferretta A,Gaballo A,Tanzarella P,et al.Effect of resveratrol on mitochondrial function:Implications in
parkin-associated familiar Parkinson's disease[J].Biochim Biophys Acta,2014,1842(7):902-915.
[4].Gu XS,Wang ZB,Ye Z,et al.Resveratrol,an activator of SIRT1,upregulates AMPK and improves
cardiac function in heart failure[J].Genet Mol Res,2014,13(1):323-335.
[5].Yao R,Yasuoka A,Kamei A,et al.Nuclear receptor-mediated alleviation of alcoholic Fatty liver by
polyphenols contained in alcoholic beverages[J].PLoS One,2014,9(2):e87142.
[6].Becker JV,Armstrong GO,van der Merwe MJ,et al.Metabolic engineering of Saccharomyces cerevisiae
for the synthesis of the wine-related antioxidant resveratrol[J].FEMS Yeast Res,2003,4(1):79-85.
[7].Beekwilder J,Wolswinkel R,Jonker H,et al.Production of resveratrol in recombinant microorganisms[J].
Appl Environ Microbiol,2006,72(8):5670-5672.
[8].Huang LL,Zhu QQ.Method for the production of resveratrol in a recombinant oleaginous
microorganism[P].WO2006125000A2,2006.
[9].Shin SY,Jung SM,Kim MD,et al.Production of resveratrol from tyrosine in metabolically engineered
Saccharomyces cerevisiae[J].Enzyme Microb Technol,2012,51(4):211-216.
[10].Watts KT,Lee PC,Schmidt-Dannert C.Biosynthesis of plant-specific stilbene polyketides in
metabolically engineered Escherichia coli[J].BMC Biotechnol,2006,6:22.
[11].Huang LL,Zhu QQ.Method for the production of resveratrol in a recombinant bacterial host cell[P].US
2007/0031951A1,2007.
[12].Lim CG,Fowler ZL,Hueller T,et al.High-yield resveratrol production in engineered Escherichia coli[J].
Appl Environ Microbiol,2011,77(10):3451-3460.
[13].Wu J,Liu P,Fan Y,et al.Multivariate modular metabolic engineering of Escherichia coli to produce
resveratrol from L-tyrosine[J].J Biotechnol,2013,167(4):404-411.
Summary of the invention
The present invention is directed to above-mentioned existing issue, use in the way of the integration of chromosome, by resveratrol
The key gene of route of synthesis is recombinated on great achievement bacillus chromosome, obtains to close with glucose for substrate
Become the restructuring strain of resveratrol, thereby account for the unstable problem of expression of recombinant plasmid and solve raw material
The problem that this height is unfavorable for industrialization.
One aspect of the present invention provides the genetic engineering bacterium of a kind of synthesizing resveratrol, and this genetic engineering bacterium is
Gene tyrR and trpED limiting glucose synthetic hydroxyphenylaminopropionic acid, and its is knocked out in E.coli BW25113
Chromosome recombination has tyrosine deaminase gene tal, 4-coumaric acid: CoA ligase gene 4cl and stilbene close
Enzyme gene sts；This genetic engineering bacterium is with glucose for substrate synthesizing resveratrol.
Wherein, said gene can be by codon optimized, the core of described tyrosine dehydrogenase gene tal
Nucleotide sequence is as shown in SEQ ID NO:1；Described 4-coumaric acid: the nucleoside of CoA ligase gene 4cl
Acid sequence is as shown in SEQ ID NO:2；Described stilbene synthase gene sts nucleotide sequence such as SEQ IN
Shown in NO:3.
The method that the invention still further relates to build the genetic engineering bacterium of synthesizing resveratrol, step is as follows:
1) stilbene synthase gene sts, tyrosine dehydrogenase gene tal and 4-coumaric acid are obtained respectively: coenzyme A is even
Meet enzyme gene 4cl, and construction recombination plasmid pET-sts and pET-tal-4cl；
2) with step 1) in recombiant plasmid pET-sts and pET-tal-4cl be that template PCR respectively amplifies and takes
With sts genetic fragment and the tal-4cl genetic fragment of T7 promoter and terminator, then by described amplification
After genetic fragment import in plasmid pTKIP-cat and construction recombination plasmid pTKIP-sts and
pTKIP-tal-4cl；
3) with linearizing plasmid pTKS/CS as template, respectively with containing gene tyrR and trpED homology
The primer PCR of recombination sequence amplifies the tetracycline resistance gene tetA sequence with above-mentioned homologous recombination sequence
Row；
4) by step 3) tetA that carries gene tyrR homologous recombination sequence is Sequence Transformed in carrying pTKRed
In the E.coli BW25113 strain cell of plasmid, and filter out positive strain E.coli BW25113 (△
tyrR::tetA)/pTKRed；Wherein, the E.coli BW25113 bacterial strain carrying pTKRed plasmid described in exists
Induce through IPTG before converting；
5) by step 2) in build recombiant plasmid pTKIP-sts convert in step 4) positives strain E.coli
In the strain cell of BW25113 (△ tyrR::tetA)/pTKRed, then coat the solid containing antibiotic
Cultivate after in culture medium；
6) by step 5) in restructuring strain in culture medium be placed in containing spectinomycin and the M9 of ammonia benzyl mycin
In culture medium activate, after be inoculated in the M9 culture medium comprising only spectinomycin, treat OD600During ≈ 0.6
After adding IPTG and L-arabinose overnight induction, after adding chloromycetin cultivation, coat containing chlorine
Overnight incubation in chloramphenicol resistance flat board；
7) picking step 6) in bacterium colony is put respectively in tetracyclin resistance flat board, ammonia benzyl chloramphenicol resistance flat board and
Cultivate after on chlorampenicol resistant flat board, select tetracyclin resistance flat board and ammonia benzyl chloramphenicol resistance flat board not to grow,
And the bacterium colony of growth is again after PCR verifies on chlorampenicol resistant flat board, further after sequence verification,
Obtain positive strain E.coli BW25113 (Δ tyrR::sts-cat)；Then, strain E.coli is knocked out
The chloromycetin gene cat in gene sts downstream in BW25113 (Δ tyrR::sts-cat), it is thus achieved that strain E.coli
BW25113(ΔtyrR::sts)；
8) step 7 is utilized) the strain E.coli BW25113 (Δ tyrR::sts) for preparing imports plasmid pTKRed
And build E.coli BW25113 (△ tyrR::sts)/pTKRed strain, then will be same with gene trpED
The tetA sequence of source recombination sequence uses step 4) in same method import in above-mentioned strain and structure obtains
E.coli BW25113 (Δ tyrR::sts, Δ trpED::tetA)/pTKRed strain；
9) by step 2) described in recombiant plasmid pTKIP-tal-4cl proceed to step 8) in build E.coli
In BW25113 (Δ tyrR::sts, Δ trpED::tetA)/pTKRed strain and obtain strain E.coli
BW25113 (△ tyrR::sts, △ trpED::tetA)/pTKRed/pTKIP-tal-4cl, and use step 5)-7)
In same method obtain positive strain E.coli BW25113 (Δ tyrR::sts, Δ trpED::tal-4cl-cat)；
Use step 7 subsequently) in same method knock out the chloromycetin gene cat of tal-4cl downstream of gene, it is thus achieved that
The genetically engineered E.coli BW25113 (Δ tyrR::sts, Δ trpED::tal-4cl) of synthesizing resveratrol.
Present invention solves the technical problem that it is with E.coli BW25113 as initial strain, knock out restriction Fructus Vitis viniferae
2 genes (tyrR and trpED) of sugar synthetic hydroxyphenylaminopropionic acid, improve the glucose yield to tyrosine；And
And gene (tyrosine ammonia lyase gene tal, 4-coumaric acid of synthesis from tyrosine to resveratrol will be related to
CoA ligase gene 4cl and stilbene synthase gene sts) recombinate on strain chromosome.So reach from
Glucose is through the purpose of tyrosine approach synthesizing resveratrol, and the genes of interest on chromosome of recombinating
Can stably express associated products, it is achieved the real industrialized output of resveratrol.
Accompanying drawing explanation
Fig. 1 is the agarose gel electricity that E.coli BW25113 in embodiment 2 (Δ tyrR::sts) successfully constructs
Swimming figure；Wherein,
Swimming lane 1 is E.coli BW25113,
Swimming lane 2 is E.coli BW25113 (Δ tyrR::tetA),
Swimming lane 3 is bacterial strain E.coli BW25113 (Δ tyrR::sts-cat),
Swimming lane 4 is E.coli BW25113 (Δ tyrR::sts),
M: molecular weight Marker DL5000.
Fig. 2 is that the agarose that E.coli BW25113 (Δ tyrR::sts, Δ trpED::tal-4cl) success builds coagulates
Gel electrophoresis figure；Wherein,
Swimming lane 1 is E.coli BW25113 (Δ tyrR::sts),
Swimming lane 2 is E.coli BW25113 (Δ tyrR::sts, Δ trpED::tetA),
Swimming lane 3 is E.coli BW25113 (Δ tyrR::sts, Δ trpED::tal-4cl-cat),
Swimming lane 4 is E.coli BW25113 (Δ tyrR::sts, Δ trpED::tal-4cl),
M: molecular weight Marker DL5000.
Fig. 3 is that E.coli BW25113 (△ tyrR::sts, △ trpED::tal-4cl) strain induces SDS-PAGE
Electrophoretogram；Wherein,
Swimming lane 1 is the E.coli BW25113 of IPTG induction 4h；Before swimming lane 2 is induced for IPTG
E.coli BW25113(△tyrR::sts,△trpED::tal-4cl)；Swimming lane 3 is the E.coli after induction 3.5h
BW25113(△tyrR::sts,△trpED::tal-4cl)；Swimming lane 4 is the E.coli after induction 4h
BW25113(△tyrR::sts,△trpED::tal-4cl)；Swimming lane 5 is the E.coli after induction 4.5h
BW25113(△tyrR::sts,△trpED::tal-4cl)；M represents Marker, unit K Da.
Fig. 4 is the detection collection of illustrative plates of resveratrol standard substance (100mg/L)；
Fig. 5 is sample after E.coli BW25113 (Δ tyrR::sts, Δ trpED::tal-4cl-cat) strain fermentation
Detection collection of illustrative plates；
Fig. 6 be comparison strain E.coli BW25113 fermentation after the detection collection of illustrative plates of sample；
Detailed description of the invention
By gene---the rhodotorula glutinis (Rhodotorula glutinis) relevant to resveratrol synthesis in the application
Tyrosine deaminase gene tal, the 4-coumaric acid of parsley (Petroselinum crispum): coenzyme A connect
The stilbene synthase gene sts of enzyme gene 4cl and Fructus Vitis viniferae (Vitis vinifera) is reconstituted on colibacillary chromosome,
And replace knocked out on escherichia coli chromosome limit glucose synthetic hydroxyphenylaminopropionic acid gene tyrR and
TrpED, the most above-mentioned related gene, under the control of T7 promoter, can complete table under the induction of IPTG
Reach.
Method (the Site-specific chromosomal integration of large delivered according to Kuhlman etc.
Synthetic constructs [J], Nucleic Acids Research, 2010,38 (6), e92), utilize lambda-Red
Recombinase and I-SceI nuclease complete exogenous gene integration on great achievement bacillus chromosome；Induce at IPTG
After its lambda-Red expresses, there is linear footprint fragment (linear landing pad fragments)
Genetic fragment (expand in from plasmid pTKS CS) Homologous integration is on colibacillary chromosome；L-
After the I-SceI of arabinose induction expresses, I-SceI identifies and is positioned at donor plasmid (with genes of interest
PTKIP) cog region and on strain chromosome is also sheared；The most again add IPTG induction
Express lambda-Red (λ-Red), the genes of interest fragment deriving from donor plasmid is incorporated into through shearing
Chromosome on complete integrate.
In the application, using plasmid pTKRed, pTKIP-cat and pTKS/CS, its specifying information can refer to
Addgene tissue announces plasmid information；Wherein pTKRed comprises λ-Red recombinase expression cassette (lactose behaviour
Make son to control) and I-SceI enzyme nucleic acid expression frame (arabinose operon control), carry grand sight mould simultaneously
The anti-resistant gene of element；PTKS/CS comprises tetracycline resistance gene, and wherein tetracycline resistance gene both sides are contained
The chromosome footprint fragment (Landing pad region) of 25bp and I-SceI recognition site；pTKIP-cat
Containing ammonia benzyl mycin resistant gene and multiple clone site (can be inserted into genes of interest), its ammonia benzyl chloramphenicol resistance
Gene and multiple clone site both sides also have chromosome footprint fragment (Landing pad region) and I-SceI
Recognition site, inserting genes of interest downstream is ammonia benzyl mycin resistant gene, (the position, side of cat resistant gene
In resistant gene downstream) there is flippse recognition site (FRT).In the application, by corresponding genes of interest
Displacement knocks out gene tyrR and trpED limiting glucose synthetic hydroxyphenylaminopropionic acid；First, pTKRed plasmid imports
In escherichia coli, abduction delivering goes out λ-Red recombinase, and the tetA gene containing recombination sequence is at λ-Red
TyrR gene is replaced under the effect of recombinase；Subsequently by carry genes of interest pTKIP import above-mentioned containing
In the strain of tetA gene, abduction delivering goes out I-SceI nuclease；I-SceI nuclease is wiped out and is positioned on chromosome
TetA gene and hydrolysis be positioned at the genes of interest on plasmid pTKIP, the most again λ of abduction delivering
Genes of interest sts is replaced the tetA gene on chromosome by-Red recombinase；Complete the replacement weight of gene sts simultaneously
After group, utilize identical method and technique that genes of interest tal-4cl is replaced the trpED gene on chromosome.
In a word, utilize tetA to complete genes of interest sts as intermediate transition genetic fragment to replace on escherichia coli chromosome
Limit the gene tyrR of glucose synthetic hydroxyphenylaminopropionic acid.
PTKIP-cat plasmid comprises resistant gene at its Insert Fragment, pTKIP plasmid construct just described above,
The resistant gene that genes of interest downstream is cat inserted, the both sides of genes of interest and resistant gene are same simultaneously
Source sequence, chromosome footprint fragment and identification fragment (including I-SceI nuclease recognition site), finally
The fragment inserted on chromosome includes genes of interest and resistant gene, but can be in the both sides of resistant gene cat
Introduce flippse recognition site (flippase recognition target site), according to document (One-step
Inactivation of chromosomal genes in Escherichia coli K-12using PCR products,
Proc.Natl Acad.Sci.USA 2000；Record in 97:6640-6645), utilizes pCP20 plasmid to turn
Changing strain, the FLP (flippase recombination enzyme) that plasmid pCP20 abduction delivering goes out can know
The flippse recognition site of the both sides of other cat resistant gene, thus remove the resistant gene being positioned on chromosome.
With the following Examples the application is described further；
Wherein: LB culture medium, M9 culture medium are the conventional base culture medium of Biotechnology Experiment, additionally
Some experimental technique step is referred to " Molecular Cloning: A Laboratory guide " and molecular biology experiment handbook.
Embodiment 1: the structure of recombinant vector pTKIP-sts and pTKIP-tal-4cl；
(1) obtain from NCBI website the rhodotorula glutinis (Rhodotorula glutinis) reported tal,
The 4cl and the sts of Fructus Vitis viniferae (Vitis vinifera) of parsley (Petroselinum crispum), through codon
These 3 genes (being provided by Shanghai Jierui Biology Engineering Co., Ltd) complete synthesis after optimization, obtain clone and carry
Body pUC57-tal, pUC57-4cl and pUC57-sts；The sequence of gene tal, 4cl and sts such as SEQ ID
Shown in NO:1, SEQ ID NO:2 and SEQ ID NO:3.
(2) respectively with carry genes of interest pUC57 for template amplification gene sts, tal and 4cl, base
Because of fragment sts and carrier pETDuet-1 through restricted enzyme BamH I and Xho I enzyme action, be connected after,
Build recombinant vector pET-sts；Genetic fragment tal and carrier pETDuet-1 are through restricted enzyme Nco I
After Hind III digestion, connection, build recombinant vector pET-tal；Genetic fragment 4cl and pET-tal warp
Restricted enzyme Nde I and Avr II enzyme action, connect after, build recombinant vector pET-tal-4cl.
(4) primer Duet-F and Duet-R is utilized, respectively with recombinant vector pET-sts and pET-tal-4cl
Comprise sts, tal-4cl genetic fragment of T7 promoter and T7 terminator for template amplification, by its respectively with
Carrier pTKIP-cat through restriction enzyme A pa I and Nhe I enzyme action, be connected after, build restructuring carry
Body pTKIP-sts and pTKIP-tal-4cl.
Forward primer Duet-F:ATATCGATCCCGCGAAATTAAT(SEQ ID
NO:4)；Line overstriking sequence is Apa I restriction enzyme site；
Downstream primer Duet-R:
TGCCTTT
CAGCAAAAAACCCCT(SEQ ID NO:5)；Line overstriking sequence is Nhe I restriction enzyme site,
Italic overstriking sequence is FRT sequence.
The structure of embodiment 2E.coli BW25113 (Δ tyrR::sts)
(1) using after plasmid pTKS/CS double digestion linearisation as template, tyrR-CS1/tyrR-CS2 it is
Primer amplification tetracycline resistance gene (tetA).
TyrR-CS1:GTGTCATATCATCATATTAATTGTTCTTTTTTCAGGTGA
AGGTTCCCATG(SEQ ID NO:6)；
TyrR-CS1:TGGTGTTGCACCATCAGGCATATTCGCGCTTACTCTTC
GTTCTTCTTCTG(SEQ ID NO:7)；
Wherein, in primer, line overstriking is the sequence at tetA gene two ends, and line overstriking Sequences upstream is big
The homologous sequence of the both sides of tyrR gene on enterobacteria chromosome.
(2) structure of E.coli BW25113/pTKRed: utilize electricity robin to be imported by plasmid pTKRed
In E.coli BW25113 (Novagen) strain cell, coating 100mg/L spectinomycin resistant flat board, 30
12～16h are cultivated under degree Celsius.
(3) tetA recombinates and substitutes tyrR gene on strain chromosome, reaches the purpose that tyrR knocks out: E.
Coli BW25113/pTKRed bacterial strain is inoculated in the LB fluid medium of 50mL according to the ratio of 1%,
When OD600 ≈ 0.3, add IPTG to final concentration of 2mM；When OD600 ≈ 0.6, preparation electricity converts
Competent cell；After prepared by competent cell, add tetA fragment prepared by 10 μ L step (1)
Carry out mixing electricity to turn with 100 μ L competent cells, after recovery, coat containing 100mg/L spectinomycin
With the LB solid medium of 10mg/L tetracycline, it is placed in 30 degrees Celsius of incubators and cultivates 12～16h.
(4) verify and pick out positive strain E.coli BW25113 (△ through bacterium colony PCR next day
tyrR::tetA)/pTKRed。
(5) structure of E.coli BW25113 (△ tyrR::tetA)/pTKRed/pTKIP-sts: utilize electricity to turn
Change the recombinant bacterial strain built by plasmid pTKIP-sts steps for importing (4) intracellular, the recombinant bacterium after recovery
Strain is coated containing 10mg/L tetracycline, 100mg/L spectinomycin and the LB of 100mg/L ammonia benzyl mycin
Solid medium, 30 degrees Celsius of lower incubators cultivate 12～16h.
(6) recombinant bacterial strain that (5) build is chosen in M9 culture medium (100mg/L spectinomycin and 100
Mg/L ammonia benzyl mycin) in activate, next day is by (only 2% being inoculated in M9 culture medium fresh for 20mL
Add 100mg/L spectinomycin).Add when OD600 ≈ 0.6 IPTG to final concentration 2mM, L-I
Uncle's sugar is to final concentration 0.2% (mass ratio), overnight induction.Morning next day adds 34mg/L chloromycetin, treats
Dilute bacterium solution 10 afternoon-5, take 100 μ L dilution bacterium solution and coat 34mg/L chlorampenicol resistant flat board, 37
Degree Celsius incubator cultivate 12～16h.
(7) picking list bacterium colony is put respectively in 10mg/L tetracyclin resistance flat board, 100mg/L ammonia benzyl mycin
In resistant panel and 34mg/L chlorampenicol resistant flat board.Tetracyclin resistance flat board and ammonia benzyl mycin is selected to resist
Property flat board do not grow, and on chlorampenicol resistant flat board, the bacterium colony of growth is verified through PCR again, and checking is correct
Bacterial strain further through sequence verification, positive strain E.coli BW25113 (△ tyrR::sts-cat) carries out preservation.
(8) structure of E.coli BW25113 (△ tyrR::sts): knock out the chloromycetin gene cat in sts downstream,
In order to avoid affecting follow-up recombination checking work.The method knocking out cat: utilize electricity to convert plasmid pCP20
In importing strain cell；Coat 100mg/L ammonia benzyl chloramphenicol resistance flat board after electrical conversion Soviet Union, be placed in 30 DEG C
Incubator cultivates 12～16h, and knocking out of bacterium colony PCR checking cat gene next day, positive strain carries out preservation；
Ask for an interview Fig. 1.
The forward primer tyrR-up:CTGTATGGCATTGAACTGGGGTATT of above-mentioned PCR checking
(SEQ ID NO:8)；
Downstream primer tyrR-down:GCTGAACATTTTCCCGAGTATTGAT (SEQ ID
NO:9)；
These two pair primer is the sequence at tyrR two ends, shown in reference Fig. 1, and the extension increasing sequence length before knocking out
For 2.4kb, extension increasing sequence after (tetA restructuring) a length of 2.3kb of extension increasing sequence, sts-cat restructuring after knocking out
A length of 4.0kb, cat knock out a length of 2.7kb of rear extension increasing sequence.
The structure of embodiment 3:E.coli BW25113 (△ tyrR::sts, △ trpED::tal-4cl)
Using construction method same in embodiment 2, step is as follows:
(1) for knocking out the amplification of tetA fragment of trpED, the primer be trpED-CS1 with
trpED-CS2。
trpED-CS1:CCCGCCTAATGAGCGGGCTTTTTTTTGAACAAAATTAGA
GAATAACAATG(SEQ ID NO:10)；
trpED-CS2:ACGATTTTCGCTAAAACGGTTTGCATCATTTACCCTCGTG
CCGCCAGTGC(SEQ ID NO:11)；
Wherein, in primer, line overstriking is the sequence at tetA gene two ends, and line overstriking Sequences upstream is
The homologous sequence of the both sides of trpED gene on escherichia coli chromosome.
(2) structure of E.coli BW25113 (△ tyrR::sts)/pTKRed, with embodiment 2 (2)
(3) tetA that step (1) obtains is recombinated to the position of trpED gene, and build E.coli
BW25113 (△ tyrR::sts, △ trpED::tetA)/pTKRed, construction method is with the step (3) of embodiment 2
With (4).
(4) E.coli BW25113 (△ tyrR::sts, △ trpED::tetA)/pTKRed/pTKIP-tal-4cl
Build: utilize electricity to convert the recombinant bacterial strain built by plasmid pTKIP-tal-4cl importing (3) intracellular.
(5) tetA knock out the recombination with tal-4cl-cat, with embodiment 2 (6).
(6) with embodiment 2, tetracyclin resistance flat board and ammonia benzyl chloramphenicol resistance flat board is selected not to grow, and
On chlorampenicol resistant flat board, the bacterium colony of growth carries out PCR checking, verifies that correct bacterial strain is further through order-checking
Checking, positive strain E.coli BW25113 (△ tyrR::sts, △ trpED::tal-4cl-cat) carries out preservation.
Above-mentioned PCR verifies forward primer trpED-up:CGAGGAACTCACACATTAGC (SEQ
ID NO:12)；
Downstream primer trpED-down:CGGTCAGCACCCCCATCTCC (SEQ ID NO:13)；
These two pair primer is the sequence at trpED two ends, knocks out a length of 4.2kb of front extension increasing sequence, after knocking out
The a length of 6.7kb of extension increasing sequence after (tetA restructuring) a length of 2.5kb of extension increasing sequence, tal-4cl-cat restructuring,
Cat knocks out a length of 5.4kb of rear extension increasing sequence.
(7) structure of E.coli BW25113 (△ tyrR::sts, △ trpED::tal-4cl): knock out under tal-4cl
The cat of trip, with embodiment 2 (8), is shown in Fig. 2.
Embodiment 4E.coli BW25113 (△ tyrR::sts, △ trpED::tal-4cl) strain abduction delivering feelings
Condition
The stilbene synthase a length of 1179bp of sts gene order, Protein S TS is made up of 392 aminoacid, phase
It is 43.12KDa to molecular weight；The a length of 2082bp of tyrosine ammonia lyase tal gene order, albumen TAL
Being made up of 693 aminoacid, relative molecular weight is 76.23KDa；4-coumaric acid: CoA ligase 4cl
The a length of 1632bp of gene order, 4-coumaric acid: CoA ligase is made up of, relatively 543 aminoacid
Molecular weight is 59.73Kda.
E.coli BW25113 (△ tyrR::sts, △ trpED::tal-4cl) prepared by embodiment 3 and E.coli
BW25113, is inoculated in LB liquid medium respectively, after 37 DEG C are cultivated 15h, is inoculated in by 1%
In fresh liquid LB culture medium (100 times of expansion), after 37 DEG C are cultivated nearly 2h, add final concentration of 1mM
IPTG induce, after inducing 4.5 hours terminate, parallel SDS-PAGE electrophoresis detection.In thalline
Protein expression situation asks for an interview the electrophoretogram shown in accompanying drawing 3.
The yield of fermentation detection resveratrol；
1) by the E.coli BW25113 (Δ tyrR::sts, Δ trpED::tal-4cl-cat) and E.coli of preparation
BW25113 is inoculated in LB liquid medium respectively by the inoculum concentration of 1%, 220rpm, 30 DEG C, training
Support 12～16h.
Take the bacterium solution after activation to be connected in 20mL fermentation medium by the inoculum concentration of 1%, 37 DEG C, 220rpm,
After cultivating 2h, adding the IPTG of final concentration of 1mM, proceed to 30 DEG C afterwards and cultivate, ferment 48h
Rear sampling detection.
Fermentation medium is as follows:
Fermentation medium
The glucose of the MgSO4 7H2O, 400g/L of another individually preparation 300g/L；Every 20mL fermentation
The glucose 200 μ L of the MgSO4 7H2O 200 μ L, 400g/L of 300g/L is added in culture medium.
2) preparation of fermented sample:
Take 1mL bacterium solution to be centrifuged, 8000rpm, 10min, remove supernatant, after adding 1mL acetone, shake
Swing, then carry out ultrasonic 3h in being placed in supersonic cleaning machine.
Bacterium solution after ultrasonic is centrifuged, ibid.Take supernatant to carry out rotation and be evaporated dry, then add 1mL methanol and carry out molten
Solve, obtain testing sample.
3) HPLC detection
Instrument: Yi Lite P1201 high performance liquid chromatograph (P1201 high pressure constant flow pump, UV1201 ultraviolet
-visible detection device, hand sampling valve and EC2006 Data Processing in Chromatography Workstation)
Chromatographic condition: chromatograph: Ultimate AQ-C18 (55 μm) (14 × 150mm)；Flowing phase: 42%
Methanol, 58% water；Flow velocity: 1mL/min；Column temperature: 35 DEG C；Sample size: 10 μ L；Ultraviolet is examined
Survey device wavelength: 306nm；Send out with E.coli BW25113 (Δ tyrR::sts, Δ trpED::tal-4cl-cat) strain
Ferment sample is experiment detection sample, with the fermented sample of E.coli BW25113 strain for control test sample.
Fig. 4 is the detection collection of illustrative plates of resveratrol standard substance (100mg/L), Fig. 5 for and E.coli
The detection collection of illustrative plates of sample after BW25113 (Δ tyrR::sts, Δ trpED::tal-4cl-cat) strain fermentation, Fig. 6 is
The detection collection of illustrative plates of sample after the fermentation of comparison E.coli BW25113 strain；Resveratrol standard substance
(100mg/L) peak (shown in Fig. 4) retention time is 10.67417min, and peak area is 8883.54mv.sec,
The retention time at the peak of the fermented sample (shown in Fig. 6) of comparison strain is peak retention time 10.64917min,
Peak area is 0.56mv.sec, the E.coli of embodiment 3 preparation
The peak (shown in Fig. 5) of the fermented sample of BW25113 (Δ tyrR::sts, Δ trpED::tal-4cl-cat) gained is protected
Stay time 10.65250min, peak area 65.03mv.sec；White Herba chenopodii in the fermented sample of prepared strain
Amount in reed alcohol more blank strain sample improves a lot.
Although the present invention is open as above with preferred embodiment, but it is not for limiting the present invention, appoints
What those skilled in the art without departing from the spirit and scope of the present invention, may be by the disclosure above
Technical solution of the present invention is made possible variation and amendment by method and technology contents, therefore, every does not takes off
From the content of technical solution of the present invention, it is any that above example is made by the technical spirit of the foundation present invention
Simple modification, equivalent variations and modification, belong to the protection domain of technical solution of the present invention.
Claims (10)
1. a genetic engineering bacterium for synthesizing resveratrol, is characterized in that, this genetic engineering bacterium is at E.coli
BW25113 strain knocks out gene tyrR and trpED limiting glucose synthetic hydroxyphenylaminopropionic acid, and its
Chromosome recombination has the tyrosine deaminase gene tal of rhodotorula glutinis, the 4-coumaric acid of parsley: coenzyme A connects
Enzyme gene 4cl and the stilbene synthase gene sts of Fructus Vitis viniferae；This genetic engineering bacterium synthesizes white Herba chenopodii with glucose for substrate
Reed alcohol.
The genetic engineering bacterium of a kind of synthesizing resveratrol the most as claimed in claim 1, is characterized in that, described
Tyrosine deaminase gene tal displacement knocks out the gene tyrR of described restriction glucose synthetic hydroxyphenylaminopropionic acid；Described
4-coumaric acid: CoA ligase gene 4cl and stilbene synthase gene sts displacement knocks out described restriction glucose and closes
Become the gene trpED of tyrosine.
The genetic engineering bacterium of a kind of synthesizing resveratrol the most as claimed in claim 1 or 2, is characterized in that, institute
The nucleotide sequence of the tyrosine dehydrogenase gene tal stated is as shown in SEQ ID NO:1；Described 4-coumaric acid:
The nucleotide sequence of CoA ligase gene 4cl is as shown in SEQ ID NO:2；Described stilbene synthase base
Because sts nucleotide sequence is as shown in SEQ IN NO:3.
4. build the method for the genetic engineering bacterium of synthesizing resveratrol described in claim 1-3, it is characterized in that, step
Rapid as follows:
1) stilbene synthase gene sts, tyrosine dehydrogenase gene tal and 4-coumaric acid are obtained respectively: coenzyme A is even
Meet enzyme gene 4cl, and construction recombination plasmid pET-sts and pET-tal-4cl；
2) with step 1) in recombiant plasmid pET-sts and pET-tal-4cl be that template PCR respectively amplifies and takes
With sts genetic fragment and the tal-4cl genetic fragment of T7 promoter and terminator, then by described amplification
After genetic fragment import in plasmid pTKIP-cat and construction recombination plasmid pTKIP-sts-cat and
pTKIP-tal-4cl-cat；
3) with linearizing plasmid pTKS/CS as template, respectively with containing gene tyrR and trpED homology
The primer PCR of recombination sequence amplifies the tetracycline resistance gene tetA sequence being respectively provided with homologous recombination sequence
Row；
4) by step 3) Sequence Transformed in carrying pTKRed with the tetA of gene tyrR homologous recombination sequence
In the E.coli BW25113 strain cell of plasmid, and filter out positive strain E.coli BW25113 (△
tyrR::tetA)/pTKRed；Wherein, the E.coli BW25113 bacterial strain carrying pTKRed plasmid described in exists
Induce through IPTG before converting；
5) by step 2) in build recombiant plasmid pTKIP-sts-cat convert in step 4) positives strain
In the strain cell of E.coli BW25113 (△ tyrR::tetA)/pTKRed, then coat containing antibiotic
Solid medium on after cultivate；
6) by step 5) in restructuring strain in culture medium be placed in containing spectinomycin and the M9 of ammonia benzyl mycin
In culture medium activate, after be inoculated in the M9 culture medium comprising only spectinomycin, treat OD600During ≈ 0.6
After adding IPTG and L-arabinose overnight induction, after adding chloromycetin cultivation, coat containing chlorine
Overnight incubation in chloramphenicol resistance flat board；
7) picking step 6) in bacterium colony is put respectively in tetracyclin resistance flat board, ammonia benzyl chloramphenicol resistance flat board and
Cultivate after on chlorampenicol resistant flat board, select tetracyclin resistance flat board and ammonia benzyl chloramphenicol resistance flat board not to grow,
And the bacterium colony of growth is again after PCR verifies on chlorampenicol resistant flat board, further after sequence verification,
Obtain positive strain E.coli BW25113 (△ tyrR::sts-cat)；Then, strain E.coli is knocked out
The chloromycetin gene cat in gene sts downstream in BW25113 (△ tyrR::sts-cat), it is thus achieved that strain E.coli
BW25113(△tyrR::sts)；
8) step 7 is utilized) the strain E.coli BW25113 (△ tyrR::sts) for preparing imports plasmid pTKRed
And build E.coli BW25113 (△ tyrR::sts)/pTKRed strain, then will be same with gene trpED
The tetA sequence of source recombination sequence uses step 4) in same method import in above-mentioned strain and structure obtains
E.coli BW25113 (△ tyrR::sts, △ trpED::tetA)/pTKRed strain；
9) by step 2) described in recombiant plasmid pTKIP-tal-4cl-cat proceed to step 8) in build
In E.coli BW25113 (△ tyrR::sts, △ trpED::tetA)/pTKRed strain and obtain strain E.coli
BW25113 (△ tyrR::sts, △ trpED::tetA)/pTKRed/pTKIP-tal-4cl-cat, and use step
5) method-7) obtains positive strain E.coli BW25113 (△ tyrR::sts, △ trpED::tal-4cl-cat)；
Use step 7 subsequently) in same method knock out the chloromycetin gene cat of tal-4cl downstream of gene, it is thus achieved that
The genetically engineered E.coli BW25113 (△ tyrR::sts, △ trpED::tal-4cl) of synthesizing resveratrol.
5. the method for the genetic engineering bacterium building synthesizing resveratrol as claimed in claim 4, is characterized in that, institute
State step 2) in forward primer used by PCR as shown in SEQ NO ID:4, reverse primer such as SEQ NO
Shown in ID:5.
6. the method for the genetic engineering bacterium building synthesizing resveratrol as claimed in claim 4, is characterized in that, institute
State step 3) in for PCR amplification containing the forward primer such as SEQ NO of gene tyrR homologous recombination sequence
Shown in ID:6, reverse primer is as shown in SEQ NO ID:7.
7. the method for the genetic engineering bacterium building synthesizing resveratrol as described in claim 4 or 6, is characterized in that,
Described step 3) in for PCR amplification containing the forward primer such as SEQ of gene trpED homologous recombination sequence
Shown in NO ID:10, reverse primer is as shown in SEQ NO ID:11.
8. the method for the genetic engineering bacterium building synthesizing resveratrol as claimed in claim 4, is characterized in that, institute
State step 4) in carry the E.coli BW25113 strain of pTKRed plasmid and be first inoculated in the training of LB liquid
Support in base, treat OD600During ≈ 0.3, add IPTG to final concentration of 2mM；Continue inducing culture, treat OD600
During ≈ 0.6, preparation is for the competent cell converted.
9. the method for the genetic engineering bacterium building synthesizing resveratrol as claimed in claim 4, is characterized in that, institute
State step 6) in the final concentration of 2mM of IPTG, final concentration of the 0.2% of L-arabinose；Described
The concentration of spectinomycin is 100mg/L, and the concentration of described ammonia benzyl mycin is 100mg/L, described chloromycetin
Concentration is 34mg/L.
10. the method for the genetic engineering bacterium building synthesizing resveratrol as claimed in claim 4, is characterized in that,
Step 7) and step 9) described in knock out the method for chloromycetin gene cat as follows:
Plasmid pCP20 is transformed in bacterium cell and coats on ammonia benzyl chloramphenicol resistance flat board, be placed in temperature
After cultivating in case, after bacterium colony PCR verifies, screening obtains positive strain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510107705.8A CN106032525A (en) | 2015-03-12 | 2015-03-12 | A genetically engineered bacterium for synthesizing resveratrol and a constructing method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510107705.8A CN106032525A (en) | 2015-03-12 | 2015-03-12 | A genetically engineered bacterium for synthesizing resveratrol and a constructing method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106032525A true CN106032525A (en) | 2016-10-19 |
Family
ID=57150497
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510107705.8A Pending CN106032525A (en) | 2015-03-12 | 2015-03-12 | A genetically engineered bacterium for synthesizing resveratrol and a constructing method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106032525A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108315290A (en) * | 2018-03-05 | 2018-07-24 | 深圳市启未生物科技有限公司 | A kind of construction method of high yield resveratrol colibacillus engineering and its application |
| CN109385417A (en) * | 2017-08-03 | 2019-02-26 | 华东理工大学 | Internal DNA seamless integration method |
| CN110628657A (en) * | 2019-09-19 | 2019-12-31 | 广州蓝星生物工程有限公司 | Saccharomyces cerevisiae engineering bacterium for synthesizing resveratrol as well as preparation method and application thereof |
| CN111108210A (en) * | 2017-09-20 | 2020-05-05 | 西江大学校产学协力团 | Method for producing trans-resveratrol by using magnetic photosynthetic cell membrane vesicles |
| WO2023164985A1 (en) * | 2022-03-02 | 2023-09-07 | 中国科学院深圳先进技术研究院 | Genetically engineered bacterium for synthesizing p-coumaric acid and derivative thereof, method for constructing same and use thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103540561A (en) * | 2013-10-22 | 2014-01-29 | 江南大学 | Genetically engineered bacterium for producing resveratrol and construction method thereof |
-
2015
- 2015-03-12 CN CN201510107705.8A patent/CN106032525A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103540561A (en) * | 2013-10-22 | 2014-01-29 | 江南大学 | Genetically engineered bacterium for producing resveratrol and construction method thereof |
Non-Patent Citations (4)
| Title |
|---|
| THOMAS E. KUHLMAN等: "Site-specific chromosomal integration of large synthetic constructs", 《NUCLEIC ACIDS RESEARCH》 * |
| 姚元锋等: "L-酪氨酸代谢工程研究进展", 《食品与发酵工业》 * |
| 王长松等: "微生物合成白藜芦醇的研究进展", 《微生物学通报》 * |
| 谢小冬: "《氨基酸发酵生产技术》", 31 January 2007, 军事医学科学出版社 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109385417A (en) * | 2017-08-03 | 2019-02-26 | 华东理工大学 | Internal DNA seamless integration method |
| CN111108210A (en) * | 2017-09-20 | 2020-05-05 | 西江大学校产学协力团 | Method for producing trans-resveratrol by using magnetic photosynthetic cell membrane vesicles |
| CN108315290A (en) * | 2018-03-05 | 2018-07-24 | 深圳市启未生物科技有限公司 | A kind of construction method of high yield resveratrol colibacillus engineering and its application |
| CN110628657A (en) * | 2019-09-19 | 2019-12-31 | 广州蓝星生物工程有限公司 | Saccharomyces cerevisiae engineering bacterium for synthesizing resveratrol as well as preparation method and application thereof |
| CN110628657B (en) * | 2019-09-19 | 2022-09-13 | 广州蓝星生物工程有限公司 | Saccharomyces cerevisiae engineering bacterium for synthesizing resveratrol as well as preparation method and application thereof |
| WO2023164985A1 (en) * | 2022-03-02 | 2023-09-07 | 中国科学院深圳先进技术研究院 | Genetically engineered bacterium for synthesizing p-coumaric acid and derivative thereof, method for constructing same and use thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106032525A (en) | A genetically engineered bacterium for synthesizing resveratrol and a constructing method thereof | |
| CN103981203B (en) | 5 amino-laevulic acid superior strains and its preparation method and application | |
| CN105087456B (en) | A method of producing the recombined bacillus subtilis building of specified molecular weight hyaluronic acid | |
| Yun et al. | The novel catabolic pathway of 3, 6‐anhydro‐L‐galactose, the main component of red macroalgae, in a marine bacterium | |
| Wang et al. | Engineering Saccharomyces cerevisiae with the deletion of endogenous glucosidases for the production of flavonoid glucosides | |
| Zhang et al. | Genome shuffling of Propionibacterium shermanii for improving vitamin B12 production and comparative proteome analysis | |
| CN104388372B (en) | A kind of recombined bacillus subtilis for producing chondroitin and its application | |
| JP6611359B2 (en) | Methods using capsaicin synthase for microbial production of capsaicinoids | |
| CN108795789A (en) | A kind of high-yield itaconic acid Yarrowia lipolytica engineered strain and its construction method, zymotechnique and application | |
| CN104004701A (en) | Method for building high-yield 5-aminolevulinic acid escherichia coli engineering strains | |
| CN106282078B (en) | A kind of recombinant bacterial strain and the preparation method and application thereof producing shikimic acid | |
| CN109913398A (en) | Genetic engineering bacterium, building and the application of high yield pantothenic acid without Beta-alanine addition | |
| Tan et al. | Carbon-negative synthetic biology: challenges and emerging trends of cyanobacterial technology | |
| CN104312987A (en) | Biosynthesis method of glucuronic acid and glucuric acid | |
| CN107201331A (en) | Express hydroxytyrosol and the Escherichia coli of hydroxytyrosol glucoside and construction method and application | |
| CN109486734A (en) | A kind of genetic engineering bacterium producing chondroitin and its construction method and application | |
| CN105647844A (en) | Recombinant bacteria using xylose to produce glycollic acid and building method and application of recombinant bacteria | |
| CN110475851A (en) | For generating the microorganism through gene optimization of interested molecule | |
| CN110117582B (en) | Fusion protein, encoding gene thereof and application thereof in biosynthesis | |
| CN104531597B (en) | One plant is produced the restructuring corynebacterium glutamicum of L phenylalanines and its built and application | |
| CN106635940A (en) | Construction method and applications of bacillus subtilis with high yield of glucosamine | |
| CN109913508A (en) | A method of phloretin is synthesized using cyanobacteria | |
| US20190169664A1 (en) | Microbial platform for production of glycosylated compounds | |
| CN104017767A (en) | Method for improving yield of 5-aminolevulinic acid by utilizing combined control strategy | |
| CN104894043A (en) | Engineering bacteria for producing gamma-aminobutyric acid and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161019 |
|
| RJ01 | Rejection of invention patent application after publication |