CN104388372B - A kind of recombined bacillus subtilis for producing chondroitin and its application - Google Patents
A kind of recombined bacillus subtilis for producing chondroitin and its application Download PDFInfo
- Publication number
- CN104388372B CN104388372B CN201410734915.5A CN201410734915A CN104388372B CN 104388372 B CN104388372 B CN 104388372B CN 201410734915 A CN201410734915 A CN 201410734915A CN 104388372 B CN104388372 B CN 104388372B
- Authority
- CN
- China
- Prior art keywords
- udp
- gene
- chondroitin
- bacillus subtilis
- synthesis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/26—Preparation of nitrogen-containing carbohydrates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/07—Bacillus
- C12R2001/125—Bacillus subtilis ; Hay bacillus; Grass bacillus
Abstract
The invention discloses a kind of recombined bacillus subtilis for producing chondroitin and its application, belong to technical field of bioengineering.UDP GlcNAc C4 isomerases KfoA and chondroitin synthase KfoC encoding genes are integrated in its perfect metabolism synthesis chondroitin approach in Bacillus subtilis genes group by the present invention, simultaneously, to the gene of UDP GlcA and UDP GlcNAc route of synthesis in bacillus subtilis, carry out modularization assembling expression analysis, by controlling different UDP GlcA and UDP GlcNAc concentration, the key gene and node on producing bacillus subtilis chondroitin route of synthesis are analyzed.The present invention prepares chondroitin for the efficient production of food-grade microorganisms and has established certain basis, is suitable for industrialized production and application.
Description
Technical field
The present invention relates to a kind of recombined bacillus subtilis for producing chondroitin and its application, belong to biotechnology neck
Domain.
Background technology
Chondroitin (chondroitin) is the polysaccharide family of glycosaminoglycan (GAG).Glycosaminoglycan is a class by the two of repetition
Unbranched, the negatively charged polysaccharide chain of sugar unit composition, due to its unique non-flexible property and high negative electrical charge,
GAG shows the conformation of high extensibility, takes big quantity space, absorbs cation and water and forms porous in extracellular matrix
Gel, the GAG being found in most animals helps to be hydrated and extend tissue, and matrix is born pressure
(compressive force).Therefore, glycosaminoglycan, which constitutes a class, has the compound of huge treatment use potentiality.Cartilage
A kind of structure of element is 4-GlcA- β -1,3-GalNAc- β -1 (GlcUA:Glucuronic acid, GalNAc:Acetylgalactosamine) two sugar monomers
The poly- polysaccharide being alternately formed by connecting with β -1,3 keys.Chondroitin sulfate (chondroitin sulfate, CS), is chondroitin sugar chain
4, carbon or 6, carbon after generation by sulfotransferase in GalNAc carry out sulphations.Can according to its chemical composition and structure difference
Be divided into that A, B, C, D, E, F, H etc. are a variety of, generally extracted from mammalian tissues obtained chondroitin sulfate using CS-A, CS-C as
It is main.General chondroitin sulfate is about containing 50-70 dissacharide units, and molecular weight is between 10000-50000 dalton.
Chondroitin sulfate is the important boiomacromolecule of a class, with extensive bioactivity, with multiple pharmacological effect
With physiological function.Research finds that chondroitin sulfate has study of anti-atherogenic effect, and analgesic and anti-inflammatory effects promote Gegenbaur's cell
Hyperplasia, induces new bone formation；Antitumor action, immunoregulation effect, effect that is anti-oxidant, removing the slow aging of free radical and the court of a feudal ruler,
Also there is the effect of anti-inflammatory, antiviral, antiallergy and accelerating wound healing, such as HIV-resistant activity.With to chondroitin sulfate physiology
The further investigation of function and biochemical property, in Europe, the United States, Deng developed countries, chondroitin sulfate is long-term as popular health products
Should, for diseases such as prevention and treatment of coronary heart disease, angina pectoris, miocardial infarction, coronary insufficiency, myocardial ischemias, without obvious poison
Side effect, can significantly reduce the morbidity and mortality of patients with coronary heart disease, also be used for Saving cortilage as meal supplement.
Chondroitin sulfate is primarily present in the cartilaginous tissue of animal, and the industrialized production of chondroitin sulfate is mainly use
Enzyme process traditional extraction process such as is combined with alkaline process, from the animal soft tissues such as tracheae, nasal septum, chicken keel and Shark cartilage
Extract chondroitin sulfate.Traditional extracting method causes that the yield of chondroitin is low, and cost is higher, and a large amount of industry that alkaline hydrolysis is produced
Waste water easily produces considerable influence to environment.Meanwhile, the shortage of raw material and the complexity of downstream purification technique limit the work
The global availability of property composition, therefore market is limited to that increasing need can not be met.Moreover, in the long run, due to
Constantly promulgate that, to animal origin Drug safety increasingly strict management rules, animal tissue extracts the chondroitin sulfate obtained
It will may be limited in outside crude drug market.Head is needed therefore, preparing chondroitin sulfate using safely and effectively method and turning into
The problem of solving.This is sought for new alternative route with regard to active demand people.
According to the structure and cellular anabolic pathways of chondroitin, chondroitin and its derivative are synthesized with microbial fermentation
Research turns into study hotspot in recent years.By cultivate microbial cell and obtain substantial amounts of chondroitin be most economic benefit and
The production technology of potentiality to be exploited.The advantage of fermentation method production chondroitin is embodied in：1) do not limited by raw material, microculture cost
Low, production intensity is big；2) process conditions are gentle；3) the stable safety of product quality；4) it is environment-friendly, pollution-free etc..
The microorganism such as many fungies and bacterium energy synthesis of oligonucleotides right chondroitin or its analog in nature, at present
Research finds that the microorganism that can produce chondroitin is concentrated mainly on p pestic Pasteurella multocida, Escherichia coli
Escherichia coli K4.But need to possess as industrial producing strain：1) person poultry safety；2) can be former using cheap saccharic
Material；3) grow rapidly, fermentation period is short；4) genetic background understands；5) condition such as chondroitin or its analog can largely be synthesized.By
All there is certain pathogenic and Escherichia coli production endotoxin and heat source substance etc. in above-mentioned bacterial strains, it is impossible to meet present food
Medical safety requirement.
The fermentation of bacillus subtilis production chondroitin of present invention application aliment security level.The present invention passes through genetic recombination skill
Art, the approach of perfect bacillus subtilis metabolism synthesis chondroitin, and the synthesis way of two precursor substances to chondroitin
Footpath carries out modularization regulating and expressing, and then causes the change of two precursor UDP-Gal-NAc and UDP-GlcA concentration of intracellular, most
Cause the change of the chondroitin yield invention operating process simple eventually, it is easy to accomplish industrialization large-scale production prepares chondroitin.
The content of the invention
It is that UDP- is imported in bacillus subtilis the invention provides a kind of recombined bacillus subtilis for producing chondroitin
NAG C4 isomerases and chondroitin synthase, build the approach of bacillus subtilis metabolism synthesis chondroitin.
The recombined bacillus subtilis, can also be with modularization assembling control methods, respectively to the two of intracellular chondroitin
The base of the route of synthesis of individual precursor UDP-N- n acetylglucosamine ns (UDP-GlcNAc) and UDP- glucuronic acids (UDP-GlcA)
Because being regulated and controled, chondroitin yield is improved.
In one embodiment of the invention, the bacillus subtilis is Bacillus subtilis 168.
In one embodiment of the invention, the UDP-GlcNAc C4 isomerases and chondroitin synthase, are sources
In Escherichia coli K4 (E.coli serotype O5:K4(L):H4, E.coli K4) KfoA and KfoC genes.
In one embodiment of the invention, the encoding gene of the chondroitin synthase is derived from Pasteurella F
The pmCS of type (Pasteurella type F).
In one embodiment of the invention, the UDP-GlcNAc C4 isomerases and chondroitin synthase, are sources
In Escherichia coli K4 (E.coli serotype O5:K4(L):H4, E.coli K4) KfoA and KfoC genes, KfoA core
Nucleotide sequence is as shown in SEQ ID NO.1, and KfoC nucleotide sequence is as shown in SEQ ID NO.2.
In one embodiment of the invention, the route of synthesis of the UDP-N-GlcNAc includes coding UDP-N- acetyl
The gene glmU of aminoglucose pyrophosphorylase, encodes the gene glmM of phosphoglucomutase；The conjunction of the UDP-GlcUA
Include the gene tuaD of encoding UDP-glucose dehydrogenase into approach, encode the base of uridine 5'-diphosphate-glucose pyrophosphorylase
Because of gtaB.
In one embodiment of the invention, two precursor UDP-N- n acetylglucosamine ns and UDP- glucose aldehyde are expressed
The route of synthesis gene of acid to regulate and control the synthesis of chondroitin, including expressing gene glmU, or glmU and glmM, or tuaD, or
TuaD and gtaB.
In one embodiment of the invention, encode the gtaB of the uridine 5'-diphosphate-glucose pyrophosphorylase, compile
The gene tuaD of code UDPG dehydrogenase, the gene glmM and UDP-N- acetylamino Portugal for encoding phosphoglucomutase
The gene glmU of sugared pyrophosphorylase can derive from Pasteurella (Pasteurella type F), Escherichia coli
(Escherichia coli) or bacillus (Bacillus).
In one embodiment of the invention, the gene source of path enzyme described above is encoded in bacillus subtilis
(Bacillus subtilis), encodes the burnt phosphorus of gene tuaD, uridine 5'-diphosphate-glucose of the UDPG dehydrogenase
The gene gtaB of phosphorylase, gene glmM and UDP-N- the n acetylglucosamine n pyrophosphorylase of phosphoglucomutase base
Because glmU nucleotide sequence is respectively shown in SEQ ID NO.3-6.
In one embodiment of the invention, the gene of coding UDP-GlcNAc C4 isomerases and chondroitin synthase
Recombination and integration carries out induced expression on genome, and promoter is xylose inducible promoters Pxly.
In one embodiment of the invention, with expression vector pP43NMK expression UDP-N- n acetylglucosamine ns (UDP-
N-GlcNAc) and UDP- glucuronic acids (UDP-GlcUA) route of synthesis gene, promoter be composing type strong promoter P43.
It is with expression vector pP43NMK present invention also offers a kind of method for building the recombined bacillus subtilis
The gene of UDP-N- n acetylglucosamine ns or UDP- glucuronic acid route of synthesis is recombinantly expressed, and in Bacillus subtilis genes group
The gene of upper integrant expression coding UDP-GlcNAc C4 isomerases and chondroitin synthase.
In one embodiment of the invention, glmU, or glmU and glmM are expressed by expression vector of pP43NMK；
KfoA and KfoC are incorporated into expressing in series in Bacillus subtilis genes group, and promoter is xylose inducible strong promoter Pxyl.
In one embodiment of the invention, tuaD, or tuaD and gtaB are expressed by expression vector of pP43NMK,
KfoA and KfoC are incorporated into expressing in series in Bacillus subtilis genes group, and promoter is xylose inducible strong promoter Pxyl.
Present invention also offers a kind of method for applying the recombined bacillus subtilis fermentation production chondroitin, culture medium：
Dusty yeast 20g/L, sucrose or glucose 50g/L, sodium dihydrogen phosphate 15.6g/L,；Potassium sulfate 3.9g/L.At 37 DEG C, fermentation
48h obtains chondroitin of the mean molecule quantity in 20-40kDa or so.
In one embodiment of the invention, carbon source uses sucrose.
The present invention utilizes producing bacillus subtilis chondroitin, compared with other bacterium, and the invention has very big application excellent
Gesture.First, the host used in process of the present invention is food-grade, fully meets the requirement of health care and food security, without interior
The risk of toxin and pathogen infection, will not carry out hidden danger to the medical food safety belt of product；Secondly, bacillus subtilis is trained
This is simple, and production intensity is big, while dense by two precursors UDP-GlcNAc and UDP-GlcUA for regulating and controlling route of synthesis respectively
The change of degree, can obtain the different production bacterial strain of yield.Based on applied analysis, the inventive method is industrially used to prepare spy
Determining the chondroitin of molecular weight ranges has potential and very extensive value.
Brief description of the drawings
Fig. 1 show modularization restructuring UDP-GlcNAc and UDP-GlcA route of synthesis gene order schematic diagrames.
Fig. 2 show yield effect of the bacillus subtilis containing various combination gene recombination plasmid to chondroitin：1,
ZHcho168；2, ZHcho168/pP43NMK/tuaD；3, ZHcho168/pP43NMK/tuaD-gtaB；4, ZHcho168/
pP43NMK/glmU；5, ZHcho168/pP43NMK/glmU-glmM.
Embodiment
Sequence table show nucleotide sequence information of the present invention：
(1) SEQ ID NO.1 sequence informations are from Escherichia coli K4 (E.coli O5:K4(L):H4, E.coli
K4 UDP-GlcNAc C4 isomery enzyme coding gene KfoA coded sequences)；
(2) SEQ ID NO.2 sequence informations are from Escherichia coli K4 (E.coli O5:K4(L):H4, E.coli
K4 chondroitin synthase encoding gene KfoC coded sequences)；
(3) SEQ ID NO.3 sequence informations are that the UDPG dehydrogenase gene tuaD that bacillus subtilis is originated is compiled
Code sequence；
(4) SEQ ID NO.4 sequence informations are the gene for the UDPG pyrophosphorylase that bacillus subtilis is originated
GtaB coded sequences；
(5) SEQ ID NO.5 sequence informations are the gene glmM for the mutase that bacillus subtilis is originated coded sequence；
(6) SEQ ID NO.6 sequence informations are the UDP-N- n acetylglucosamine n pyrophosphorylations that bacillus subtilis is originated
The gene glmU of enzyme coded sequence；
(7) SEQ ID NO.7 sequence informations are bacillus subtilis constitutive promoter P43 gene order；
(8) SEQ ID NO.8 sequence informations are bacillus subtilis inducible promoter Pxyl gene order.
Embodiment 1 is integrated recombinant plasmid pAX01-KfoC-KfoA and built
UDP-GlcNAc C4 isomerases KfoA and chondroitin synthase KfoC used in the present embodiment, from large intestine bar
Bacterium K4 (E.coli serotype O5:K4(L):H4, E.coli K4), E.coliK4 inoculations are in 5ml LB Liquid Cultures
Base, in 37 DEG C of 200rpm cultures 16h.Thalline is collected, the base of E.coliK4 bacterial strains is extracted using bacterial genomes extracts kit
Because of a group DNA.
According to the genomic information sequence announced, primer KfoA-F/R, KfoC-F/R are separately designed, with the gene of extraction
Group DNA is template, and using the PCR amplification system and program of standard, amplification obtains KfoC and KfoA genes.
Primer sequence information：5 ' -3 ' direction
KfoC-F:CGGGATCCATGAGTATTCTTAATCAAGC
KfoC-R:TCCCCGCGGACTTCGGGTACCTTATAAATCATTCTCTATTTTTTCC
KfoA-F:CGGGGTACCAAGAGAGGAATGTACACATGAATATATTAGTTACAGGTGG
KfoA-R:TCCCCGCGGTTAAATATAACCATTTGGGTTTTTC
BamHI and KpnI, SacII restriction enzyme site are introduced respectively at KfoC upstream and downstream primers two ends.PCR amplifications are obtained
The KfoC fragments and plasmid pAX01 taken is respectively adopted BamHI and SacII and carries out double digestion, using Ago-Gel nucleic acid electrophoresis
Gel extraction is carried out, recovery product is attached, the μ l of system 10：The double carriers cut of 1 μ l, the double purpose fragments cut of 4 μ l, 5 μ l
Solution ligases, 16 DEG C of connections are stayed overnight, and convert JM109 competent cells, picking single bacterium colony PCR checkings, positive recombinant
It is sequenced, is compared correctly, recombinant plasmid pAX01-KfoC is successfully constructed.KpnI and SacII is introduced in KfoA primers upstream and downstream
Restriction enzyme site, PCR amplifications are obtained after KfoA, are carried out KpnI and SacII double digestions respectively with pAX01-KfoC plasmids, are adopted
Gel extraction is carried out with Ago-Gel nucleic acid electrophoresis, recovery product is attached, the μ l of system 10：The double carriers cut of 1 μ l, 4 μ l
Double purpose fragments cut, 5 μ l Solution ligases, 16 DEG C of connections are stayed overnight, and convert JM109 competent cells, picking single bacterium colony
PCR verifies that positive recombinant is sequenced, and compares correctly, recombinant plasmid pAX01-KfoC-KfoA is successfully constructed.
Recombinant plasmid pAX01-KfoC-KfoA conversion Bacillus subtilis 168 are flat with 20 μ g/ml erythromycin
Plate carries out screening integrative recombinant, and enters performing PCR checking and sequence verification to recombinant bacterial strain, to successfully integrating Pxyl-KfoC-
The bacillus subtilis strain that KfoA is successfully constructed is named as ZHcho168.
Embodiment 2 recombinant plasmid pP43NMK/tuaD, pP43NMK/tuaD-gtaB structure
The inoculations of Bacillus subtilis 168 are in 5ml LB culture mediums, 37 DEG C, 200rpm cultures 16h.Collect bacterium
Body, the genomic DNA of streptococcus zooepidemicus strain is extracted using bacterial genomes extracts kit.According to the Bacillus announced
Subtilis168 genomic information sequences, separately design primer tuaD-F/tuaD-R, gtaB-F/gtaB-R.In sense primer
TuaD-F 5 ends introduce KpnI restriction enzyme sites and P43RBS sequences, introduced at anti-sense primer tuaD-R 5 ends XhoI and
SacI restriction enzyme sites；SacI restriction enzyme sites and P43RBS sequences are introduced at sense primer gtaB-F 5 ends,
Anti-sense primer gtaB-R 5 ends introduce XhoI and XbaI restriction enzyme sites.
Primer information is as follows：
tuaD-F：CGGGGTACCAAGAGAGGAATGTACACATGAAAAAAATAGCTGTCATTGG
tuaD-R：CCGCTCGAGCGGTACATTCGAGCTCTTATAAATTGACGCTTCCCAAG
gtaB-F：
CGGGGTACCGAGCTCAAGAGAGGAATGTACACATGAAAAAAGTACGTAAAGC
gtaB-R：CCGCTCGAGCGGACTCTAGTCTAGATTAGATTTCTTCTTTGTTTAGTAAACC is withered with what is extracted
Careless subtilis genomic dna is template, and using the PCR amplification system and program of standard, amplification respectively obtains tuaD, gtaB base
Cause.
Plasmid pP43NMK uses KpnI and XhoI double digestions, while the tuaD gene outcomes that PCR amplifications are obtained also are used
KpnI and XhoI double digestions, after 1% agarose gel electrophoresis, gel extraction target stripe, recovery product is attached, body
It is 10 μ l：The double carriers cut of 1 μ l, the double purpose fragments cut of 4 μ l, 5 μ lSolution ligases, 16 DEG C of connections are stayed overnight, converted
JM109 competent cells, picking single bacterium colony PCR checkings, positive recombinant is sequenced, and compares correct, pP43NMK/tuaD matter
Grain is successfully constructed.
Similarly, recombinant plasmid pP43NMK/tuaD is subjected to SacI and XhoI double digestions, gtaB fragments PCR by aforesaid operations
Product also carries out SacI and XhoI double digestions.Two fragments reclaimed are attached, the μ l of system 10：The double carriers cut of 1 μ l, 4 μ l
Double purpose fragments cut, 5 μ l Solution ligases, 16 DEG C of connections are stayed overnight, and convert JM109 competent cells, picking single bacterium colony
PCR verifies that positive recombinant is sequenced, and as a result compares correct, pP43NMK/tuaD-gtaB plasmid constructions success.Above-mentioned structure
2 recombinant plasmids built convert ZHCHO168 host respectively, obtain 2 recombined bacillus subtilis bacterial strains：ZHCHO168/
pP43NMK/tuaD；ZHCHO168/pP43NMK/tuaD-gtaB.
Embodiment 3 recombinant plasmid pP43NMK/glmU, pP43NMK/glmU-glmM structure
According to the genomic information sequences of Bacillus subtilis 168 announced, primer glmU-F/ is separately designed
glmU-R、glmM-F/glmM-R.KpnI restriction enzyme sites and P43RBS sequences are introduced at sense primer glmU-F 5 ends,
Introduce XhoI and XbaI restriction enzyme sites at anti-sense primer glmU-R 5 ends, follow-up several genes using SpeI and
XbaI isocaudarners are attached；SpeI restriction enzyme sites and P43RBS sequences are introduced at sense primer glmM-F 5 ends,
Anti-sense primer glmM-R 5 ends introduce XhoI and XbaI restriction enzyme sites.
Primer information is as follows：
glmU-F：CGGGGTACCAAGAGAGGAATGTACACATGGATAAGCGGTTTGCAGTTG
glmU-R：CCGCTCGAGCGGACTCTAGTCTAGATTATTTTTTATGAATATTTTTCAC
glmM-F：GGACTAGTAAGAGAGGAATGTACACATGGGCAAGTATTTTGGAACAGACGG
glmM-R：CCGCTCGAGCGGACTCTAGTCTAGATTACTCTAATCCCATTTCTGACCGGAC
Bacillus subtilis genes group DNA using extraction is template, using the PCR amplification system and program of standard, difference
Amplification obtains glmU, glmM gene.
Plasmid pP43NMK uses KpnI and XhoI double digestions, while the glmU gene outcomes that PCR amplifications are obtained also are used
KpnI and XhoI double digestions, after 1% agarose gel electrophoresis, gel extraction target stripe, recovery product is attached, body
It is 10 μ l：The double carriers cut of 1 μ l, the double purpose fragments cut of 4 μ l, 5 μ lSolution ligases, 16 DEG C of connections are stayed overnight, converted
JM109 competent cells, picking single bacterium colony PCR checkings, positive recombinant is sequenced, and compares correct, pP43NMK/glmU matter
Grain is successfully constructed.On pP43NMK/glmU plasmid basics, the group of glmM, glmS and pgi gene is carried out respectively by aforesaid operations
Dress：PP43NMK/glmU plasmids carry out double digestion using XbaI and XhoI, and the PCR primer of glmM fragments uses SpeI and XhoI
Double digestion, this step is attached using a pair of isocaudarners, the μ l of system 10：The double carriers cut of 1 μ l, the double purpose fragments cut of 4 μ l, 5 μ
L Solution ligases, 16 DEG C of connections are stayed overnight, and convert JM109 competent cells, picking single bacterium colony PCR checkings, positive restructuring
Son is sequenced, and as a result compares correct, pP43NMK/glmU-glmM plasmid constructions success.
Above-mentioned all plasmids carry out sequencing comparison, as a result correctly.ZHCHO168 bacterial strains are converted respectively, obtain 2 restructuring withered
Careless Bacillus strain：ZHCHO168/pP43NMK/glmU, ZHCHO168/pP43NMK/glmU-glmM.
The shake flask fermentation of the recombined bacillus subtilis bacterial strain of embodiment 4
5 recombinant bacterial strains of the above-mentioned structure of picking：ZHCHO168、ZHCHO168/pP43NMK/tuaD、ZHCHO168/
PP43NMK/tuaD-gtaB, ZHCHO168/pP43NMK/glmU, ZHCHO168/pP43NMK/glmU-glmM, monoclonal inoculation
In 5ml LB culture mediums, 37 DEG C of incubated overnights of 200rpm are placed in.250ml triangle shaking flasks (liquid amount 25ml) are inoculated in after 16h
In, fermentation medium is minimal medium：2% dusty yeast, 5% sucrose, sodium dihydrogen phosphate 15.6g/L, potassium sulfate 3.9g/L.
Transferred by 10% inoculum concentration in shaking flask, be placed in 37 DEG C of cultures of 200rpm, 2h additions 2g/L xylose is lured after inoculation
Lead KfoA and KfoC gene expressions, fermented and cultured 48h.
The collection of chondroitin in zymotic fluid, takes appropriate zymotic fluid, and the SDS and fermentation broth contents for adding 0.5% final concentration are mixed
Close, discharge room temperature centrifugation 20min under the chondroitin polysaccharide of cell membrane surface, subsequent 5000rpm.Fermented liquid supernatant transfer puts another
In centrifuge tube, the absolute ethyl alcohol for adding 2 times of volumes fully mixes the chondroitin polysaccharide precipitated in zymotic fluid.1h is stood at room temperature,
Room temperature centrifuges 20min under 10000rpm again, removes clean liquid, it is abundant that precipitation adds the isometric 1M NaCl solutions of zymotic fluid
Dissolving, after appropriate dilution, using the content of Nephelometric Determination chondroitin, utilizes chondroitin sulfate and cetylpyridinium chloride knot
Symphysis determines chondroitin sulfate in finite concentration orientation with good linear pass into stabilized emulsion at wavelength 680nm
System.
Find out from accompanying drawing 2, express the synthesis of UDP-GlcNAc approach from gene, the yield of chondroitin is gradually stepped up, explanation
Improving UDP-GlcNAc concentration contributes to the synthesis of chondroitin, recombinant bacterial strain ZHCHO168/pP43NMK/glmU-glmM production
Highest is measured, 1.55g/L is reached.And express tuaD genes (the i.e. recombinant bacterial strain ZHCHO168/ of UDP-GlcA route of synthesis
PP43NMK/tuaD), the yield of chondroitin reaches 1.76g/L.
Meanwhile, shown by the mean molecule quantity measurement result to chondroitin product, the product mean molecule quantity of acquisition exists
30kDa or so.
Although the present invention is disclosed as above with preferred embodiment, it is not limited to the present invention, any to be familiar with this skill
The people of art, without departing from the spirit and scope of the present invention, can do various changes and modification, therefore the protection model of the present invention
Enclose being defined of being defined by claims.
Claims (4)
1. a kind of recombined bacillus subtilis for producing chondroitin, it is characterised in that be that UDP-N- is expressed in bacillus subtilis
N acetylglucosamine n C4 isomerases and chondroitin synthase, build the approach of bacillus subtilis metabolism synthesis chondroitin；It is described
Bacillus subtilis is Bacillus subtilis 168；UDP-GlcNAc C4 isomerases and the chondroitin synthase difference
By KfoA and KfoC gene codes, KfoA nucleotide sequence is as shown in SEQ ID NO.1, KfoC nucleotide sequence such as SEQ
Shown in ID NO.2；The genetic recombination of coding UDP-GlcNAc C4 isomerases and chondroitin synthase is incorporated on genome and carried out
Induced expression, promoter is xylose inducible promoters Pxly；UDP-N- n acetylglucosamine ns or UDP- Portugals are also expressed respectively
The gene of the route of synthesis of uronic acid, regulates and controls the synthesis of chondroitin；The route of synthesis of the UDP-N- n acetylglucosamine ns includes
The gene glmU of UDP-N- n acetylglucosamine n pyrophosphorylases is encoded, the gene glmM of mutase is encoded；The UDP- glucose
The route of synthesis of aldehydic acid includes the gene tuaD of encoding UDP-glucose dehydrogenase, the base of encoding UDP-glucose pyrophosphorylase
Because of gtaB；Encode gene tuaD, the gene of uridine 5'-diphosphate-glucose pyrophosphorylase of the UDPG dehydrogenase
GtaB, the gene glmU of gene glmM and UDP-N- the n acetylglucosamine n pyrophosphorylase of phosphoglucomutase nucleosides
Acid sequence is respectively shown in SEQ ID NO.3-6；It is described to express UDP-N- n acetylglucosamine ns or UDP- glucuronic acids respectively
Route of synthesis gene, including using pP43NMK as expression vector expressing gene glmU, or glmU and glmM, or tuaD, or
TuaD and gtaB.
2. application process of the recombined bacillus subtilis described in claim 1 in production chondroitin and chondroitin sulfate.
3. method according to claim 2, it is characterised in that the recombined bacillus subtilis is using pP43NMK as table
The gene glmU of UDP-N- n acetylglucosamine n pyrophosphorylases, or glmU and the gene for encoding mutase are encoded up to vector expression
glmM；And expressing in series coding UDP-N- n acetylglucosamine ns C4 is integrated with xylose inducible strong promoter Pxyl on genome
The gene of isomerase and chondroitin synthase.
4. method according to claim 2, it is characterised in that the recombined bacillus subtilis is using pP43NMK as table
Up to the gene tuaD of vector expression encoding UDP-glucose dehydrogenase, or tuaD and encoding UDP-glucose pyrophosphorylase base
Expressing in series coding UDP-N- n acetylglucosamine ns are integrated with xylose inducible strong promoter Pxyl because of gtaB, and on genome
The gene of C4 isomerases and chondroitin synthase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410734915.5A CN104388372B (en) | 2014-12-04 | 2014-12-04 | A kind of recombined bacillus subtilis for producing chondroitin and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410734915.5A CN104388372B (en) | 2014-12-04 | 2014-12-04 | A kind of recombined bacillus subtilis for producing chondroitin and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104388372A CN104388372A (en) | 2015-03-04 |
| CN104388372B true CN104388372B (en) | 2017-07-21 |
Family
ID=52606333
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410734915.5A Active CN104388372B (en) | 2014-12-04 | 2014-12-04 | A kind of recombined bacillus subtilis for producing chondroitin and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104388372B (en) |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755022B (en) * | 2015-11-25 | 2020-08-04 | 中国科学院大连化学物理研究所 | Acetylglucosamine phosphoglucomutase AtAGM coding gene, enzyme, preparation and application thereof, and enzyme activity detection method |
| CN106244566B (en) * | 2016-08-10 | 2019-08-20 | 江南大学 | A kind of chondroitin synthase mutant and its application |
| CN106244613B (en) * | 2016-08-25 | 2019-05-17 | 江南大学 | A kind of bacillus subtilis of stationary phase autothermic cracking and its application |
| CN106244492B (en) * | 2016-08-29 | 2019-04-05 | 香河县龙津生物工程有限责任公司 | A method of bacillus subtilis is produced using chondroitin sulfate production industrial wastewater as fermenting raw materials |
| CN106497845B (en) * | 2016-12-14 | 2019-08-06 | 江南大学 | A kind of recombined bacillus subtilis of high yield chondroitin and its application |
| CN107312738B (en) * | 2017-07-26 | 2020-03-06 | 江南大学 | Recombinant escherichia coli for efficiently producing fructose chondroitin and construction method thereof |
| CN108841771B (en) * | 2018-07-11 | 2020-12-01 | 江南大学 | Recombinant corynebacterium glutamicum capable of producing chondroitin and application of recombinant corynebacterium glutamicum |
| CN109486734B (en) * | 2018-10-30 | 2021-12-31 | 清华大学 | Genetically engineered bacterium for producing chondroitin and construction method and application thereof |
| CN112708569B (en) * | 2019-10-24 | 2022-11-01 | 华熙生物科技股份有限公司 | Yeast engineering bacterium for producing chondroitin sulfate by fermentation and application thereof |
| CN114507685A (en) * | 2022-03-04 | 2022-05-17 | 郑州大学 | Bacillus subtilis polygene modular assembly and inducible expression plasmid and construction method thereof |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001080810A2 (en) * | 1999-11-10 | 2001-11-01 | Angelis Paul L De | Chondroitin synthase gene and methods of making and using same |
| WO2007094986A2 (en) * | 2006-02-02 | 2007-08-23 | The Board Of Regents Of The University Of Oklahoma | Methods of expressing gam-negative glycosaminoglycosaminoglycan synthase genes in gram-positive hosts |
| CN101679955A (en) * | 2007-04-24 | 2010-03-24 | 生化学工业株式会社 | Chondroitin-producing bacterium and method of producing chondroitin |
| CN102337312A (en) * | 2011-10-19 | 2012-02-01 | 江南大学 | Method for increasing yield of chondroitin sulfate produced by fermentation method |
| CN103789338A (en) * | 2012-11-01 | 2014-05-14 | 中国药科大学 | Plasmid, recombinant engineering bacteria and preparation method of hyaluronic acid with uniform molecular weight |
| US20140273163A1 (en) * | 2013-03-14 | 2014-09-18 | Glycobia, Inc. | Oligosaccharide compositions, glycoproteins and methods to produce the same in prokaryotes |
-
2014
- 2014-12-04 CN CN201410734915.5A patent/CN104388372B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001080810A2 (en) * | 1999-11-10 | 2001-11-01 | Angelis Paul L De | Chondroitin synthase gene and methods of making and using same |
| WO2007094986A2 (en) * | 2006-02-02 | 2007-08-23 | The Board Of Regents Of The University Of Oklahoma | Methods of expressing gam-negative glycosaminoglycosaminoglycan synthase genes in gram-positive hosts |
| CN101679955A (en) * | 2007-04-24 | 2010-03-24 | 生化学工业株式会社 | Chondroitin-producing bacterium and method of producing chondroitin |
| US20100151532A1 (en) * | 2007-04-24 | 2010-06-17 | Seikagaku Corporation | Chondroitin-producing bacterium and method of producing chondroitin |
| CN102337312A (en) * | 2011-10-19 | 2012-02-01 | 江南大学 | Method for increasing yield of chondroitin sulfate produced by fermentation method |
| CN103789338A (en) * | 2012-11-01 | 2014-05-14 | 中国药科大学 | Plasmid, recombinant engineering bacteria and preparation method of hyaluronic acid with uniform molecular weight |
| US20140273163A1 (en) * | 2013-03-14 | 2014-09-18 | Glycobia, Inc. | Oligosaccharide compositions, glycoproteins and methods to produce the same in prokaryotes |
Non-Patent Citations (3)
| Title |
|---|
| Recombinant Production of Hyaluronic Acid;Stephen H.Brown等;《Current Pharmaceutical Biotechnology》;20081231;第9卷;第239-240页，尤其是第239页右边栏第21-24行 * |
| Sequencing and analysis of the divergon comprising gtaB, the structural gene of UDP-glucose pyrophosphorylase of Bacillus subtilis 168;BLAZENKA SOLDO等;《Journal of General Microbiology》;19931231;第139卷;第3185-3195页 * |
| 启动子工程改造大肠杆菌K4生产果糖软骨素;吴秋林等;《生物加工过程》;20140531;第12卷(第3期);第19-25页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104388372A (en) | 2015-03-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104388372B (en) | A kind of recombined bacillus subtilis for producing chondroitin and its application | |
| CN105087456B (en) | A method of producing the recombined bacillus subtilis building of specified molecular weight hyaluronic acid | |
| CN104928333B (en) | A kind of method that knockout glcK promotes bacillus subtilis synthesis of acetyl Glucosamine | |
| CN105255803B (en) | A kind of recombined bacillus subtilis for efficiently synthesizing acetylglucosamine | |
| CN104498420B (en) | It is a kind of produce heparosan recombined bacillus subtilis and its application | |
| CN106148265B (en) | It is a kind of produce chondroitinase recombined bacillus subtilis and its application | |
| CN104293726A (en) | Recombinant bacillus subtilis producing micromolecular hyaluronic acid | |
| CN108707573B (en) | Genetically engineered bacterium for producing N-acetylglucosamine and application thereof | |
| CN104498394A (en) | Recombinant bacillus subtilis increased in yield of acetylglucosamine | |
| CN107916283B (en) | A kind of production technology of niacinamide | |
| Cimini et al. | Improved fructosylated chondroitin production by kfoC overexpression in E. coli K4 | |
| CN106755205A (en) | A kind of method that enzyme process prepares chondroitin sulfate | |
| CN103937734A (en) | Genetically-engineered bacterium realizing high production of hyaluronic acid and application thereof | |
| CN110093367A (en) | A kind of bacillus subtilis oscillation mode gene expression system and its construction method and application | |
| US10508279B2 (en) | Recombinant Escherichia coli for high efficiency production of fructosylated chondroitin and method for making thereof | |
| CN109486734A (en) | A kind of genetic engineering bacterium producing chondroitin and its construction method and application | |
| CN104371965A (en) | Method for producing hyaluronic acids with different molecular weights through reasonable regulation | |
| CN109971696A (en) | A kind of recombinant bacterium of resting cell method high yield N-acetyl-neuraminate and application | |
| US10233439B2 (en) | Directed modification of glucosamine synthase mutant and application thereof | |
| CN102533801A (en) | Streptomyces griseus subsp.griseus trehalose synthetase gene and applications thereof | |
| CN106754598A (en) | A kind of recombined bacillus subtilis of high yield heparosan and its application | |
| CN106635940B (en) | One plant of construction method for producing Glucosamine bacillus subtilis and application | |
| CN102154326A (en) | Streptomyces coelicolor trehalose synthase enzyme gene and application thereof | |
| CN107189992B (en) | A kind of heparosan synthase and its application | |
| CN106497845B (en) | A kind of recombined bacillus subtilis of high yield chondroitin and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant |