CN106497845B - A kind of recombined bacillus subtilis of high yield chondroitin and its application - Google Patents

A kind of recombined bacillus subtilis of high yield chondroitin and its application Download PDF

Info

Publication number
CN106497845B
CN106497845B CN201611149169.9A CN201611149169A CN106497845B CN 106497845 B CN106497845 B CN 106497845B CN 201611149169 A CN201611149169 A CN 201611149169A CN 106497845 B CN106497845 B CN 106497845B
Authority
CN
China
Prior art keywords
chondroitin
bacillus subtilis
subtilis
recombined bacillus
coexpression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201611149169.9A
Other languages
Chinese (zh)
Other versions
CN106497845A (en
Inventor
康振
陈坚
堵国成
张琳培
王浩
周正雄
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangnan University
Original Assignee
Jiangnan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangnan University filed Critical Jiangnan University
Priority to CN201611149169.9A priority Critical patent/CN106497845B/en
Publication of CN106497845A publication Critical patent/CN106497845A/en
Priority to US15/808,944 priority patent/US10975405B2/en
Application granted granted Critical
Publication of CN106497845B publication Critical patent/CN106497845B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/104—Aminoacyltransferases (2.3.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/04—Polysaccharides, i.e. compounds containing more than five saccharide radicals attached to each other by glycosidic bonds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/07—Nucleotidyltransferases (2.7.7)
    • C12Y207/07009—UTP-glucose-1-phosphate uridylyltransferase (2.7.7.9), i.e. UDP-glucose-pyrophosphorylase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y504/00—Intramolecular transferases (5.4)
    • C12Y504/02—Phosphotransferases (phosphomutases) (5.4.2)
    • C12Y504/02002—Phosphoglucomutase (5.4.2.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y504/00—Intramolecular transferases (5.4)
    • C12Y504/02—Phosphotransferases (phosphomutases) (5.4.2)
    • C12Y504/0201—Phosphoglucosamine mutase (5.4.2.10)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention discloses a kind of recombined bacillus subtilis of high yield chondroitin and its applications, belong to technical field of bioengineering.The present invention improves the yield of chondroitin by carrying out route of synthesis optimization, i.e. key gene in coexpression UDP-GlcUA approach and UDP-GlcNAc approach in the bacillus subtilis for producing chondroitin.Recombined bacillus subtilis provided by the invention can meet the requirement of health care and food safety, the risk of endotoxin-free and pathogen infection；And the accumulation of chondroitin can be made to reach highest, it is 6.06g/L, molecular weight 78.64kD.This research provides new strategy for high yield chondroitin, on the one hand can be applied to other glycosaminoglycans, on the other hand lays a good foundation for industrialization large-scale production chondroitin.

Description

A kind of recombined bacillus subtilis of high yield chondroitin and its application
Technical field
The present invention relates to a kind of recombined bacillus subtilis of high yield chondroitin and its applications, belong to biotechnology neck Domain.
Background technique
Chondroitin sulfate (chondroitin sulfate) belongs to a member in glycosaminoglycan (GAG) family, is by precursor 6 progress sulphations of 4, carbon or carbon after the generation of chondroitin sugar chain through sulfotransferase in GalNAc are formed.A kind of structure of chondroitin For 4-GlcA- β -1,3-GalNAc- β -1 (GlcUA: glucuronic acid, GalNAc: acetylgalactosamine) two sugar monomers are with β -1, and 3 The poly- polysaccharide that key is alternately formed by connecting.A, B, C, D, E, F, H etc. can be divided into according to its chemical composition and structure difference, with CS-A, CS-C is most common.Chondroitin sulfate typically contains 50-70 dissacharide units, and molecular weight is between 10000-50000 dalton. Chondroitin sulfate have multiple pharmacological effect and physiological function, such as study of anti-atherogenic effect, analgesic and anti-inflammatory effects, promote at Osteocyte hyperplasia induces new bone formation；Aging is delayed in antitumor action, immunoregulation effect, anti-oxidant, removing free radical and the court of a feudal ruler Effect, also has the function of anti-inflammatory, antiviral, antiallergy and accelerating wound healing.With to chondroitin sulfate physiological function and The further investigation of biochemical property, in Europe, the United States, Deng developed country, chondroitin sulfate as popular health care product prolonged application in The diseases such as prevention and treatment of coronary heart disease, angina pectoris, myocardial infarction, coronary insufficiency, myocardial ischemia, without apparent toxic side effect, It can significantly reduce the morbidity and mortality of patients with coronary heart disease, be also used for Saving cortilage as meal supplement.
The industrialized production of chondroitin sulfate is mainly the traditional extraction technique for using enzyme process to combine with alkaline process at present, from It is extracted in the animal soft tissues such as tracheae, nasal septum, chicken keel and Shark cartilage.This method yield is low, at high cost, and alkaline hydrolysis The a large amount of industrial wastewaters generated generate adverse effect to environment.Meanwhile the shortage and the complicated journey of downstream purification technique of raw material Degree limits the acquisition of chondroitin sulfate, is not able to satisfy the ever-increasing market demand.Also, in the long run, animal is come Source Drug safety management it is increasingly strict, animal extraction method obtain chondroitin sulfate may will be limited in crude drug market it Outside.It in recent years, is to synthesize the chemical-enzymatic of starting point progress sulphation gradually by the attention of researcher with chondroitin, therefore, Realize that the high yield of chondroitin becomes important link in microorganism.
Summary of the invention
The present invention provides a kind of recombined bacillus subtilis of high yield chondroitin, are in bacillus subtilis On the basis of 168 genome conformity expressing K foC and KfoA gene of B.subtilis, co-expressed by expression vector of pP43NMK The key gene of chondroitin route of synthesis.
In one embodiment of the invention, the coexpression refers to the key enzyme base of coexpression UDP-GlcUA approach Because of pgcA, gtaB, tuaD, or key gene glmS, glmM, glmU of coexpression UDP-GlcNAc approach.
In one embodiment of the invention, the coexpression refers to combination coexpression, and the combination coexpression is altogether Express tuaD and glmU, or coexpression tuaD, glmU, gtaB, glmM, glmS.
It is to integrate coexpression a second object of the present invention is to provide the construction method of the recombined bacillus subtilis The B.subtilis 168 of KfoC and KfoA gene is host, co-expresses chondroitin route of synthesis by expression vector of pP43NMK Key gene；The coexpression refers to key gene pgcA, gtaB, tuaD of coexpression UDP-GlcUA approach, or altogether Express key gene glmS, glmM, glmU of UDP-GlcNAc approach.
In one embodiment of the invention, the coexpression refers to combination coexpression, and the combination coexpression is altogether Express tuaD and glmU, or coexpression tuaD, gtaB, glmU, glmM and glmS.
Third object of the present invention is to provide a kind of method of fermenting and producing chondroitin, the method is by the recombination Bacterium is seeded in fermentation medium, and 24~60h is cultivated at 37 DEG C.
In one embodiment of the invention, the fermentation medium is using sucrose as carbon source.
In one embodiment of the invention, the composition of the fermentation medium, which becomes, divides: 20g/L yeast powder, 50g/L Sucrose, 3.9g/L potassium sulfate, 1.5g/L magnesium sulfate, 50mM phosphate buffer, pH 6.5-7.5.
In one embodiment of the invention, the composition of the fermentation medium, which becomes, divides: 20g/L yeast powder, 15g/L Sucrose, 3.9g/L potassium sulfate, 1.5g/L magnesium sulfate, 50mM phosphate buffer, pH 6.5-7.5.
The present invention also provides the recombined bacillus subtilis in medicine, the application of field of health care products, and the application is specific It is the drug for preparing sulfur acid chondroitin, pharmaceutical product.
The utility model has the advantages that the present invention in the bacillus subtilis for producing chondroitin by carrying out route of synthesis optimization, i.e. table altogether Key gene up in UDP-GlcUA approach and UDP-GlcNAc approach improves the yield of chondroitin, and recombinant plasmid PP43-DU-PBMS conversion bacillus subtilis does not inhibit thalli growth, has biggish application value.Firstly, mistake of the present invention Host used in journey is food-grade, can meet the requirement of health care and food safety, the wind of endotoxin-free and pathogen infection Danger；Secondly, coexpression tuaD, gtaB, glmU, glmM and glmS gene cause two precursors in liberal supply and proportional balancing method, and Further by 3L tank fed-batch culture, the accumulation of chondroitin is made to reach highest, is 6.06g/L, molecular weight 78.64kD. This research provides new strategy for high yield chondroitin, on the one hand can be applied to other glycosaminoglycans, on the other hand big to industrialize Large-scale production chondroitin is laid a good foundation.
Detailed description of the invention
Fig. 1 is the construction of recombinant plasmid schematic diagram for co-expressing pathway gene；
Fig. 2 be PCR verify recombined bacillus subtilis building, M be 5000bp Marker, 1-4 respectively indicate containing The recombinant bacterium of plasmid pP43-DBA, pP43-UMS, pP43-DU and pP43-DU-PBMS；
Fig. 3 is the chondroitin yield of recombinant bacterium after co-expressing pathway gene；
Fig. 4 is that recombinant bacterium B.subtilis E168C/pP43-DU-PBMS is shaking with strain B.subtilis E168C is compareed Cell growth and production curve in bottle culture；
Fig. 5 is fed-batch culture of the recombinant bacterium B.subtilis E168C/pP43-DU-PBMS in 3L tank.
Specific embodiment
Chondroitin tunning molecular weight detection analysis method: Efficient numerical method-multiple angle laser light scattering is used It is analyzed, selects differential refraction detector RI, analyzed using gel chromatographic columns Ultrahydrogel Linear.Flowing Mutually selection 0.1M sodium nitrate is eluted, flow velocity 0.5mL/min, and column temperature is set as 50 DEG C, and sample volume is 20 μ L, each The sample elution time is 20min, calculates average molecular mass and polydispersity coefficient using software.
The nucleotide sequence information that embodiment is related to:
(1) SEQ ID NO.1 sequence information is the gene pgcA of the phosphoglucomutase in bacillus subtilis source Coded sequence；
(2) SEQ ID NO.2 sequence information is the gene of the UDP-glucose pyrophosphorylase in bacillus subtilis source GtaB coded sequence；
(3) SEQ ID NO.3 sequence information is that the UDP-glucose dehydrogenase gene tuaD in bacillus subtilis source is compiled Code sequence；
(4) SEQ ID NO.4 sequence information is the gene glmS code sequence of the amide transferase in bacillus subtilis source Column；
(5) SEQ ID NO.5 sequence information is the gene of the aminoglucose transphosphorylase in bacillus subtilis source The coded sequence of glmM；
(6) SEQ ID NO.6 sequence information is the UDP-N- n acetylglucosamine n pyrophosphorylation in bacillus subtilis source The coded sequence of the gene glmU of enzyme；
Embodiment 1 co-expresses the building of the recombined bacillus subtilis of pathway gene
B.subtilis E168C competent cell is prepared first, and required reagent is inorganic salts mother liquor (g/L): K2HPO4140, KH2PO460, (NH4)2SO420, (Na3C6H5O7·2H2O) 10, MgSO47H2O 2；GMI solution is (every 100mL): inorganic salts mother liquor 9.6mL, 20% glucose 2.5mL, 5% caseinhydrolysate 0.4mL, 10% yeast juice 1mL；GMII Solution (every 100mL): inorganic salts mother liquor 9.7mL, 20% glucose 2.5mL, 5% caseinhydrolysate 0.08mL, 10% yeast juice 0.04mL, 1M MgCl20.25mL, 1M CaCl20.05mL.It is molten that B.subtilis E168C single colonie is inoculated in 5mL GMI Liquid, 30 DEG C, 125rpm culture 16h take 2mL culture solution to be transferred to 18mL GMI solution, 37 DEG C, 200rpm culture 3.5h, then take 10mL culture solution is transferred to 90mL GMII solution, and 37 DEG C, 200rpm culture 90min collect bacterium in 4 DEG C, 5000g centrifugation 10min Body is only retained 10mL liquid and thallus is resuspended, dispensed as unit of 500 μ L.
Using pP43NMK as expression vector, 4 recombinant type plasmid pP43-DBA of chondroitin route of synthesis gene are co-expressed, PP43-UMS, pP43-DU and pP43-DU-PBMS (Fig. 1) are that previously building (had been disclosed in Production of specific- molecular-weight hyaluronan by metabolically engineered Bacillus subtilis 168, Metabolic Engineering, 2016, Jinpeng), B.subtilis E168C sense is transformed by changing the mode that turns By in state cell, and it is coated on the screening flat board containing 50 μ g/mL kanamycins, selects transformant and carry out PCR verifying.Conversion The recombinant bacterium of pP43-DBA, pP43-UMS, pP43-DU and pP43-DU-PBMS plasmid uses primer gtaB-F/pgcA-R respectively, GlmM-F/glmS-R, tuaD-F/glmU-R and glmU-F/gtaB-R verifying, as a result as shown in Fig. 2, and naming the recombinant bacterium to be B.subtilis E168C/pP43-DBA, B.subtilis E168C/pP43-UMS, B.subtilis E168C/pP43-DU, B.subtilis E168C/pP43-DU-PBMS。
Primer sequence information: 5 ' -3 ' directions
GtaB-F:ATGAAAAAAGTACGTAAAGCCATAA
PgcA-R:TTATTTTGCTGTTGACTCAACAA
GlmM-F:ATGGGCAAGTATTTTGGAACAGACG
GlmS-R:TTACTCCACAGTAACACTCTTCGCA
TuaD-F:GTGAAAAAAATAGCTGTCATTGGAAC
GlmU-R:TTATTTTTTATGAATATTTTTCACATAATC
GlmU-F:ATGGATAAGCGGTTTGCAGTTG
GtaB-R:TTAGATTTCTTCTTTGTTTAGTAAAC
The shake flask fermentation of 2 recombined bacillus subtilis of embodiment
The 4 plants of recombined bacillus subtilis and control bacterium B.subtilis E168C single colonie of above-mentioned building are picked them separately, It is inoculated in seed culture medium, 37 DEG C of 200rpm is placed in and is incubated overnight 16h.It transfers by volume for 10% inoculum concentration in 25mL (250mL shaking flask), fermentation medium in fermentation medium are as follows: 20g/L yeast powder, 50g/L sucrose, potassium sulfate 3.9g/L, sulfuric acid Magnesium 1.5g/L, 50mM phosphate buffer, pH 7.0, wherein needing 50 μ g/mL kanamycins of addition in recombination bacteria culture fluid.It is placed in 37 DEG C of culture 54h of 200rpm, and 2h addition xylose mother liquid induces its final concentration of 20g/L after inoculation.
The anhydrous of 3 times of volumes is added into supernatant after 10000g is centrifuged 5min for the fermentation liquid sampled in shaking flask culture Ethyl alcohol, mixes and in 4 DEG C of placements 1h, is centrifuged 5min through 10000g again, collects precipitating, and addition distilled water re-dissolves precipitating, The purification step is in triplicate.The content of chondroitin uses Bitter-Muir sulfuric acid carbazole colorimetric method for determining, adds in colorimetric cylinder Enter the chondroitin sample of 1mL borax sulphate reagent and 200 μ L after certain multiple dilutes, mix and boils 15min in boiling water, it is cold But to room temperature, 50 μ L carbazole reagents are added, mixes and boils in boiling water again 15min, the extinction at 530nm is measured after cooling Value calculates yield according to standard curve.
48h chondroitin yield in 3 with reference to the accompanying drawings, compared with control strain B.subtilis E168C (1.83g/L), containing recombination 4 plants of recombinant bacterium yield in shaking flask of plasmid are improved, and wherein B.subtilis E168C/pP43-DBA yield is 2.17g/ L, B.subtilis E168C/pP43-UMS yield are 2.37g/L, and B.subtilis E168C/pP43-DU yield is 1.96g/ L, E168C/pP43-DU-PBMS yield highest are 2.67g/L, and increase rate is maximum, are 45.90%.Illustrate two precursors The proportional balancing method of UDP-GlcUA and UDP-GlcNAc is highly beneficial to the polymerization speed for accelerating chondroitin.Also, as shown in figure 4, Recombinant bacterium B.subtilis E168C/pP43-DU-PBMS enters thalli growth stationary phase, OD in 12-24h600Up to 21.5, and compare bacterium OD600Up to 19.9, compared with compareing strain, recombinant plasmid pP43-DU-PBMS converts bacillus subtilis Do not inhibit thalli growth, in addition, according to MALLS-SEC result (table 1), the M of the produced chondroitin of above-mentioned 4 plants of recombinant bacteriumswRespectively For 84.36kDa, 97.02kDa, 72.78kDa and 119.20kDa, relatively compares bacterium (83.51kDa) and also increase.Meanwhile product Polydispersity coefficient IpBetween 1.08-1.51, especially when precursor balances, molecular weight of product distribution more collects In, illustrate that the production for realizing the chondroitin of more unified molecular weight can be optimized by approach.
Recombinant bacterium is compared with the molecular weight of chondroitin produced when compareing bacterium in 48h in 1 shaking flask of table
aNumber average molecular weight (Mn)；bWeight-average molecular weight (Mw)；cThe degree of polymerization (Ip=Mw/Mn).
The 3L tank fed-batch of 3 recombined bacillus subtilis B.subtilis E168C/pP43-DU-PBMS of embodiment is trained It supports
Recombinant bacterium single colonie is seeded in 150mL seed culture medium, 37 DEG C, 200r/min culture 16h, by seed culture Liquid is that 10% inoculum concentration is forwarded in the 3L fermentor of the fermentation medium containing 1.35L by volume, and add 50 μ g/mL cards that Mycin.2h, which adds xylose solution, after inoculation induces final concentration of 20g/L.It is using 5M NaOH solution control pH 7.0, temperature is 37 DEG C, and speed of agitator is 600r/min in 8h after inoculation, is 800r/min, ventilatory capacity 2.0vvm after 8h. Feed supplement feed liquid is the sucrose mother liquor of 800g/L, starts feed supplement when sucrose concentration is lower than 5g/L in fermentation liquid, maintains remaining sugar concentration In 0-5g/L.Flow acceleration is respectively 7.5,7.5,15,10g/L/h during 8-12h, hereafter keeps the flow velocity of 5g/L/h to hair Ferment terminates.Simultaneously using the weight-average molecular weight (M of HPSEC-MALLS measurement fermentation termination chondroitinw), quantity mean molecule Measure (Mn) and coefficient of dispersion Ip。
As shown in Figure 5, it can be seen that two-part growth trend is presented in the accumulation of chondroitin yield, and largely accumulates in thallus Middle and later periods stationary phase is grown, cell growth produces non-coupled with chondroitin.When fermenting 70h, the yield of chondroitin reaches highest, It is 2.27 times of shaking flask level, hereafter yield keeps stablizing for 6.06g/L.The M of productwFor 78.64kDa, when compared with shaking flask culture It reduces, probably due to the effect of agitating paddle mechanical shear stress cuts off sugar chain, IpValue 1.89 shows the chondroitin in 3L fermentor Molecular weight distribution is more dispersed.
Although the present invention has been described by way of example and in terms of the preferred embodiments, it is not intended to limit the invention, any to be familiar with this skill The people of art can do various change and modification, therefore protection model of the invention without departing from the spirit and scope of the present invention Enclosing subject to the definition of the claims.
SEQUENCE LISTING
<110>Southern Yangtze University
<120>a kind of recombined bacillus subtilis of high yield chondroitin and its application
<160> 14
<170> PatentIn version 3.3
<210> 1
<211> 1746
<212> DNA
<213>artificial sequence
<400> 1
atgacttgga gaaagagcta tgaacgctgg aaacagacag aacatttaga tctggaatta 60
aaagagcgcc ttattgaatt agagggagat gaacaggccc ttgaggactg tttctataaa 120
gaccttgaat tcggtaccgg cggaatgcgc ggggaaatcg gcgccgggac aaatcggatg 180
aatatttaca ctgtgcgcaa agcatcggcc gggtttgcgg catacatctc gaagcaaggt 240
gaggaagcga aaaaacgggg cgttgtcatt gcttatgatt cccgccataa gtctccggag 300
ttcgcgatgg aagcggcaaa aacacttgcg acacaaggca tccaaacata cgtgtttgat 360
gagcttcgcc cgacgccaga gctgtcattc gctgttagac agctgaacgc ttatggtgga 420
attgtggtaa cggcaagcca taacccgcct gaatataacg gctacaaagt atacggggat 480
gatggcggcc agctgcctcc aaaggaagcg gacatcgtca ttgagcaggt aaacgcgatt 540
gaaaatgagc tgacgatcac agtggacgaa gaaaataagt taaaagaaaa aggcttaatc 600
aaaatcatcg gtgaagatat tgataaagtt tatacagaaa aactgacgtc catttctgta 660
catcctgaat tatcggaaga agtagatgta aaggttgttt tcacaccgct gcatggaact 720
gcaaataaac cggtcagacg cggtcttgaa gcactcggct acaaaaatgt aacggttgtc 780
aaagaacagg aactgccgga ttcaaacttc tccactgtta catcgccgaa cccggaagag 840
catgcggcat tcgaatatgc cattaagctt ggggaggagc agaatgcaga tattctcatc 900
gcgacagatc ctgatgctga ccgcctcggc atcgcggtga aaaacgatca aggcaaatat 960
acagtgctga caggaaacca aaccggagcg ttgctgcttc attacctgct ttctgaaaag 1020
aaaaaacaag gcatcctgcc tgataacggt gttgttctca aaacgatcgt cacaagcgaa 1080
atcggccgtg ctgtagcttc ttcattcggc cttgatacga ttgatacgct gacaggcttt 1140
aagtttatcg gtgaaaagat taaggaatac gaagcatcag gccagtatac cttccaattc 1200
ggttatgaag agagctacgg ttatttaatc ggggattttg cccgcgataa ggacgccatt 1260
caggctgcgc ttttggcagt tgaagtttgc gcgttctata aaaaacaggg aatgtcattg 1320
tatgaggcgc tcatcaatct ctttaacgaa tatggttttt atcgtgaagg gctgaaatcc 1380
ctgacgctga aaggcaaaca aggagcagag caaattgaag cgattcttgc ttccttcaga 1440
caaaatccgc cgcagaaaat ggcgggcaaa caggttgtca cagcagaaga ttacgctgta 1500
agcaaacgga cgcttctgac tgaaagcaaa gaagaagcca tcgacttgcc aaaatcaaat 1560
gtattgaaat acttcctgga agacgggtct tggttctgtc tccgtccttc tggaactgag 1620
ccgaaggtta aattttattt cgccgtaaaa gggtcatctt tggaagacag tgaaaagcga 1680
cttgccgtcc tttctgaaga tgtaatgaag acggtggatg aaattgttga gtcaacagca 1740
aaataa 1746
<210> 2
<211> 879
<212> DNA
<213>artificial sequence
<400> 2
atgaaaaaag tacgtaaagc cataattcca gcagcaggct taggaacacg ttttcttccg 60
gctacgaaag caatgccgaa agaaatgctt cctatcgttg ataaacctac cattcaatac 120
ataattgaag aagctgttga agccggtatt gaagatatta ttatcgtaac aggaaaaagc 180
aagcgtgcga ttgaggatca ttttgattac tctcctgagc ttgaaagaaa cctagaagaa 240
aaaggaaaaa ctgagctgct tgaaaaagtg aaaaaggctt ctaacctggc tgacattcac 300
tatatccgcc aaaaagaacc taaaggtctc ggacatgctg tctggtgcgc acgcaacttt 360
atcggcgatg agccgtttgc ggtactgctt ggtgacgata ttgttcaggc tgaaactcca 420
gggttgcgcc aattaatgga tgaatatgaa aaaacacttt cttctattat cggtgttcag 480
caggtgcccg aagaagaaac acaccgctac ggcattattg acccgctgac aagtgaaggc 540
cgccgttatc aggtgaaaaa cttcgttgaa aaaccgccta aaggcacagc accttctaat 600
cttgccatct taggccgtta cgtattcacg cctgagatct tcatgtattt agaagagcag 660
caggttggcg ccggcggaga aattcagctc acagacgcca ttcaaaagct gaatgaaatt 720
caaagagtgt ttgcttacga ttttgaaggc aagcgttatg atgttggtga aaagctcggc 780
tttatcacaa caactcttga atttgcgatg caggataaag agcttcgcga tcagctcgtt 840
ccatttatgg aaggtttact aaacaaagaa gaaatctaa 879
<210> 3
<211> 1386
<212> DNA
<213>artificial sequence
<400> 3
gtgaaaaaaa tagctgtcat tggaacaggt tatgtaggac tcgtatcagg cacttgcttt 60
gcggagatcg gcaataaagt tgtttgctgt gatatcgatg aatcaaaaat cagaagcctg 120
aaaaatgggg taatcccaat ctatgaacca gggcttgcag acttagttga aaaaaatgtg 180
ctggatcagc gcctgacctt tacgaacgat atcccgtctg ccattcgggc ctcagatatt 240
atttatattg cagtcggaac gcctatgtcc aaaacaggtg aagctgattt aacgtacgtc 300
aaagcggcgg cgaaaacaat cggtgagcat cttaacggct acaaagtgat cgtaaataaa 360
agcacagtcc cggttggaac agggaaactg gtgcaatcta tcgttcaaaa agcctcaaag 420
gggagatact catttgatgt tgtatctaac cctgaattcc ttcgggaagg gtcagcgatt 480
catgacacga tgaatatgga gcgtgccgtg attggttcaa caagtcataa agccgctgcc 540
atcattgagg aacttcatca gccattccat gctcctgtca ttaaaacaaa cctagaaagt 600
gcagaaatga ttaaatacgc cgcgaatgca tttctggcga caaagatttc ctttatcaac 660
gatatcgcaa acatttgtga gcgagtcggc gcagacgttt caaaagttgc tgatggtgtt 720
ggtcttgaca gccgtatcgg cagaaagttc cttaaagctg gtattggatt cggcggttca 780
tgttttccaa aggatacaac cgcgctgctt caaatcgcaa aatcggcagg ctatccattc 840
aagctcatcg aagctgtcat tgaaacgaac gaaaagcagc gtgttcatat tgtagataaa 900
cttttgactg ttatgggaag cgtcaaaggg agaaccattt cagtcctggg attagccttc 960
aaaccgaata cgaacgatgt gagatccgct ccagcgcttg atattatccc aatgctgcag 1020
cagctgggcg cccatgtaaa agcatacgat ccgattgcta ttcctgaagc ttcagcgatc 1080
cttggcgaac aggtcgagta ttacacagat gtgtatgctg cgatggaaga cactgatgca 1140
tgcctgattt taacggattg gccggaagtg aaagaaatgg agcttgtaaa agtgaaaacc 1200
ctcttaaaac agccagtcat cattgacggc agaaatttat tttcacttga agagatgcag 1260
gcagccggat acatttatca ctctatcggc cgtcccgctg ttcggggaac ggaaccctct 1320
gacaagtatt ttccgggctt gccgcttgaa gaattggcta aagacttggg aagcgtcaat 1380
ttataa 1386
<210> 4
<211> 1803
<212> DNA
<213>artificial sequence
<400> 4
atgtgtggaa tcgtaggtta tatcggtcag cttgatgcga aggaaatttt attaaaaggg 60
ttagagaagc ttgagtatcg cggttatgac tctgctggta ttgctgttgc caacgaacag 120
ggaatccatg tgttcaaaga aaaaggacgc attgcagatc ttcgtgaagt tgtggatgcc 180
aatgtagaag cgaaagccgg aattgggcat actcgctggg cgacacacgg cgaaccaagc 240
tatctgaacg ctcacccgca tcaaagcgca ctgggccgct ttacacttgt tcacaacggc 300
gtgatcgaga actatgttca gctgaagcaa gagtatttgc aagatgtaga gctcaaaagt 360
gacaccgata cagaagtagt cgttcaagta atcgagcaat tcgtcaatgg aggacttgag 420
acagaagaag cgttccgcaa aacacttaca ctgttaaaag gctcttatgc aattgcttta 480
ttcgataacg acaacagaga aacgattttt gtagcgaaaa acaaaagccc tctattagta 540
ggtcttggag atacattcaa cgtcgtagca tctgatgcga tggcgatgct tcaagtaacc 600
aacgaatacg tagagctgat ggataaagaa atggttatcg tcactgatga ccaagttgtc 660
atcaaaaacc ttgatggtga cgtgattaca cgtgcgtctt atattgctga gcttgatgcc 720
agtgatatcg aaaaaggcac gtaccctcac tacatgttga aagaaacgga tgagcagcct 780
gttgttatgc gcaaaatcat ccaaacgtat caagatgaaa acggcaagct gtctgtgcct 840
ggcgatatcg ctgccgctgt agcggaagcg gaccgcatct atatcattgg ctgcggaaca 900
agctaccatg caggacttgt cggtaaacaa tatattgaaa tgtgggcaaa cgtgccggtt 960
gaagtgcatg tagcgagtga attctcctac aacatgccgc ttctgtctaa gaaaccgctc 1020
ttcattttcc tttctcaaag cggagaaaca gcagacagcc gcgcggtact cgttcaagtc 1080
aaagcgctcg gacacaaagc cctgacaatc acaaacgtac ctggatcaac gctttctcgt 1140
gaagctgact atacattgct gcttcatgca ggccctgaga tcgctgttgc gtcaacgaaa 1200
gcatacactg cacaaatcgc agttctggcg gttcttgctt ctgtggctgc tgacaaaaat 1260
ggcatcaata tcggatttga cctcgtcaaa gaactcggta tcgctgcaaa cgcaatggaa 1320
gctctatgcg accagaaaga cgaaatggaa atgatcgctc gtgaatacct gactgtatcc 1380
agaaatgctt tcttcatcgg acgcggcctt gactacttcg tatgtgtcga aggcgcactg 1440
aagctgaaag agatttctta catccaggca gaaggttttg ccggcggtga gctaaagcac 1500
ggaacgattg ccttgatcga acaaggaaca ccagtattcg cactggcaac tcaagagcat 1560
gtaaacctaa gcatccgcgg aaacgtcaaa gaagttgctg ctcgcggagc aaacacatgc 1620
atcatctcac tgaaaggcct agacgatgcg gatgacagat tcgtattgcc ggaagtaaac 1680
ccagcgcttg ctccgttggt atctgttgtt ccattgcagc tgatcgctta ctatgctgca 1740
ctgcatcgcg gctgtgatgt ggataaacct cgtaaccttg cgaagagtgt tactgtggag 1800
taa 1803
<210> 5
<211> 1347
<212> DNA
<213>artificial sequence
<400> 5
atgggcaagt attttggaac agacggtgta agaggtgtcg ccaatagtga gcttacacct 60
gagctggcct ttaaagtcgg acgtttcggc ggttatgtgc tgacaaaaga caaacaacgt 120
ccaaaagtgc tgataggccg cgatacacgc atctccggcc atatgctgga gggagccctt 180
gtcgccggac ttttatccat tggcgcagaa gtcatgcgcc tgggtgtcat ttctacacca 240
ggtgtatctt atttgacaaa agcgatggat gcagaggcgg gcgtcatgat ttccgcttct 300
cataacccag tgcaggataa cggcatcaaa ttctttgggg gagatggatt taagctttct 360
gatgaacagg aggctgaaat tgagcgcctg atggacgaac ctgaggataa gctgccaaga 420
cctgtcggag cagaccttgg acttgtaaac gattattttg aaggcggaca aaaatatctg 480
caattcttaa aacagacagc tgatgaagat ttcacaggca ttcatgtggc attggactgt 540
gccaatggcg caacgtcatc cttggcgaca cacctgtttg ctgatttaga tgcagatgtt 600
tctacaatgg ggacttcccc gaacggatta aacattaatg acggcgtcgg ttcgactcat 660
cccgaagcgc tcagcgcgtt tgtcaaagag aaaaacgcgg atctcggtct tgcgttcgac 720
ggtgacggcg accgcctgat tgctgtcgat gaaaaaggaa atattgtaga cggcgaccaa 780
atcatgtaca tatgctcaaa acatctgaaa tcagagggcc gtttaaagga tgatacagtg 840
gtttcaaccg tgatgagcaa cctcggcttc tataaggcgc tcgaaaaaga aggcatcaaa 900
agcgtgcaga cagctgtcgg cgaccgctac gtagtagaag caatgaaaaa agacggctac 960
aacgtcggcg gagagcagtc aggacatctt attttccttg attacaacac gacaggggac 1020
ggattattgt ctgctattat gctgatgaac actttaaaag caacaggcaa gccgctgtca 1080
gagcttgcag ctgaaatgca gaagttcccg cagctgttag tcaatgtgag agtgactgat 1140
aaatataaag ttgaagaaaa tgaaaaagta aaagcagtta tttctgaagt tgaaaaagaa 1200
atgaacggcg acggccggat tttggtgcgc ccttcaggaa ctgaaccgct cgtccgtgtc 1260
atggctgaag cgaagacgaa agagctgtgc gatgagtatg tcaatcgcat tgttgaagtc 1320
gtccggtcag aaatgggatt agagtaa 1347
<210> 6
<211> 1371
<212> DNA
<213>artificial sequence
<400> 6
atggataagc ggtttgcagt tgttttagcg gctggacaag gaacgagaat gaaatcgaag 60
ctttataaag tccttcatcc agtttgcggt aagcctatgg tagagcacgt cgtggacgaa 120
gccttaaaat tatctttatc aaagcttgtc acgattgtcg gacatggtgc ggaagaagtg 180
aaaaagcagc ttggtgataa aagcgagtac gcgcttcaag caaaacagct tggcactgct 240
catgctgtaa aacaggcaca gccatttctt gctgacgaaa aaggcgtcac aattgtcatt 300
tgcggagata cgccgctttt gacagcagag acgatggaac agatgctgaa agaacataca 360
caaagagaag cgaaagctac gattttaact gcggttgcag aagatccaac tggatacggc 420
cgcattattc gcagcgaaaa cggagcggtt caaaaaatag ttgagcataa ggacgcctct 480
gaagaagaac gtcttgtaac tgagatcaac accggtacgt attgttttga caatgaagcg 540
ctatttcggg ctattgatca ggtgtctaat gataatgcac aaggcgagta ttatttgccg 600
gatgtcatag agattcttaa aaatgaaggc gaaactgttg ccgcttacca gactggtaat 660
ttccaagaaa cgctcggagt taatgataga gttgctcttt ctcaggcaga acaatttatg 720
aaagagcgca ttaataaacg gcatatgcaa aatggcgtga cgttgattga cccgatgaat 780
acgtatattt ctcctgacgc tgttatcgga agcgatactg tgatttaccc tggaactgtg 840
attaaaggtg aggtgcaaat cggagaagat acgattattg gccctcatac ggagattatg 900
aatagtgcca ttggcagccg tacggttatt aaacaatcgg tagtcaatca cagtaaagtg 960
gggaatgatg taaacatagg accttttgct cacatcagac ctgattctgt catcgggaat 1020
gaagtgaaga tcgggaattt tgtagaaatt aaaaagactc aattcggaga ccgaagcaag 1080
gcatctcatc taagctatgt cggcgatgct gaggtaggca ctgatgtaaa cctgggctgc 1140
ggttcaatta ctgtcaatta tgatggaaag aataagtatt tgacaaaaat tgaagatggc 1200
gcgtttatcg gctgcaattc caacttggtt gcccctgtca cagtcggaga aggcgcttat 1260
gtggcggcag gttcaactgt tacggaagat gtacctggaa aagcacttgc tattgccaga 1320
gcgagacaag taaataaaga cgattatgtg aaaaatattc ataaaaaata a 1371
<210> 7
<211> 25
<212> DNA
<213>artificial sequence
<400> 7
atgaaaaaag tacgtaaagc cataa 25
<210> 8
<211> 23
<212> DNA
<213>artificial sequence
<400> 8
ttattttgct gttgactcaa caa 23
<210> 9
<211> 25
<212> DNA
<213>artificial sequence
<400> 9
atgggcaagt attttggaac agacg 25
<210> 10
<211> 25
<212> DNA
<213>artificial sequence
<400> 10
ttactccaca gtaacactct tcgca 25
<210> 11
<211> 26
<212> DNA
<213>artificial sequence
<400> 11
gtgaaaaaaa tagctgtcat tggaac 26
<210> 12
<211> 30
<212> DNA
<213>artificial sequence
<400> 12
ttatttttta tgaatatttt tcacataatc 30
<210> 13
<211> 22
<212> DNA
<213>artificial sequence
<400> 13
atggataagc ggtttgcagt tg 22
<210> 14
<211> 26
<212> DNA
<213>artificial sequence
<400> 14
ttagatttct tctttgttta gtaaac 26

Claims (7)

1. a kind of recombined bacillus subtilis of high yield chondroitin, which is characterized in that be in bacillus subtilis B.subtilis On the basis of 168 genome conformities co-express KfoC and KfoA gene, chondroitin synthesis is co-expressed by expression vector of pP43NMK The key gene of approach, the coexpression are coexpression key gene tuaD, gtaB, glmU, glmM and glmS.
2. a kind of method of fermenting and producing chondroitin, which is characterized in that the method is to be inoculated with recombinant bacterium described in claim 1 Into fermentation medium, 24~60h is cultivated at 37 DEG C.
3. according to the method described in claim 2, it is characterized in that, the fermentation medium is using sucrose as carbon source.
4. according to the method described in claim 2, it is characterized in that, the composition of the fermentation medium become point: 20g/L yeast Powder, 50g/L sucrose, 3.9g/L potassium sulfate, 1.5g/L magnesium sulfate, 50mM phosphate buffer, pH 6.5-7.5.
5. according to the method described in claim 2, it is characterized in that, the composition of the fermentation medium become point: 20g/L yeast Powder, 15g/L sucrose, 3.9g/L potassium sulfate, 1.5g/L magnesium sulfate, 50mM phosphate buffer, pH 6.5-7.5.
6. recombined bacillus subtilis described in claim 1 prepares answering for the pharmaceutical preparations of sulfur acid chondroitin in field of medicaments With.
7. the pharmaceutical product side that recombined bacillus subtilis described in claim 1 prepares sulfur acid chondroitin in field of medicaments The application in face.
CN201611149169.9A 2016-11-14 2016-12-14 A kind of recombined bacillus subtilis of high yield chondroitin and its application Active CN106497845B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN201611149169.9A CN106497845B (en) 2016-12-14 2016-12-14 A kind of recombined bacillus subtilis of high yield chondroitin and its application
US15/808,944 US10975405B2 (en) 2016-11-14 2017-11-10 Method for do novo biosynthesis of chondroitin sulfate

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201611149169.9A CN106497845B (en) 2016-12-14 2016-12-14 A kind of recombined bacillus subtilis of high yield chondroitin and its application

Publications (2)

Publication Number Publication Date
CN106497845A CN106497845A (en) 2017-03-15
CN106497845B true CN106497845B (en) 2019-08-06

Family

ID=58330973

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201611149169.9A Active CN106497845B (en) 2016-11-14 2016-12-14 A kind of recombined bacillus subtilis of high yield chondroitin and its application

Country Status (1)

Country Link
CN (1) CN106497845B (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107312738B (en) * 2017-07-26 2020-03-06 江南大学 Recombinant escherichia coli for efficiently producing fructose chondroitin and construction method thereof
CN107937430B (en) * 2017-12-25 2020-09-11 中国农业科学院麻类研究所 Bacillus subtilis incapable of producing cellulase and construction method and application thereof
CN114790435B (en) * 2021-01-25 2023-11-17 山东大学 Bacillus subtilis engineering strain for synthesizing clickable glycosaminoglycan skeleton and construction method and application thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104388372A (en) * 2014-12-04 2015-03-04 江南大学 Recombinant bacillus subtilis for producing chondroitin and application of recombinant bacillus subtilis
CN104974972A (en) * 2010-07-09 2015-10-14 灵知股份公司 Biotechnological Production of Chondroitin
CN104974973A (en) * 2007-04-24 2015-10-14 生化学工业株式会社 Chondroitin-producing bacterium and method of producing chondroitin

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104974973A (en) * 2007-04-24 2015-10-14 生化学工业株式会社 Chondroitin-producing bacterium and method of producing chondroitin
CN104974972A (en) * 2010-07-09 2015-10-14 灵知股份公司 Biotechnological Production of Chondroitin
CN104388372A (en) * 2014-12-04 2015-03-04 江南大学 Recombinant bacillus subtilis for producing chondroitin and application of recombinant bacillus subtilis

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Production of specific-molecular-weight hyaluronan by metabolically engineered Bacillus subtilis 168;Peng Jin等;《Metabolic Engineering》;20160203;第35卷;第21-30页

Also Published As

Publication number Publication date
CN106497845A (en) 2017-03-15

Similar Documents

Publication Publication Date Title
CN105087456B (en) A method of producing the recombined bacillus subtilis building of specified molecular weight hyaluronic acid
Rodrigues et al. Response surface statistical optimization of bacterial nanocellulose fermentation in static culture using a low-cost medium
Yao et al. Versatile strategies for bioproduction of hyaluronic acid driven by synthetic biology
CN106497845B (en) A kind of recombined bacillus subtilis of high yield chondroitin and its application
CN104388372B (en) A kind of recombined bacillus subtilis for producing chondroitin and its application
CN109486786A (en) A kind of yclodextrin glycosyltransferase mutant
CN106754598B (en) Recombinant bacillus subtilis for high-yield heparosan and application thereof
CN111394292B (en) Multi-way composite neuraminic acid-producing bacillus subtilis and application thereof
CN103468624B (en) Genetic engineering bacteria used for high efficient production of mycose
CN104498420B (en) It is a kind of produce heparosan recombined bacillus subtilis and its application
Antunes et al. Conversion of cheese whey into a fucose-and glucuronic acid-rich extracellular polysaccharide by Enterobacter A47
CN107236695A (en) A kind of genetic engineering bacterium for expressing sucrose phosphorylase and its application
CN106479945A (en) A kind of recombined bacillus subtilis efficiently synthesizing acetylglucosamine
CN103789338B (en) Plasmid, recombination engineering and the method preparing homogeneous molecular weight hyaluronic acid
Wang et al. Identification and characterization of a chondroitin synthase from Avibacterium paragallinarum
CN104046586B (en) One strain gene engineering bacterium and the application in producing (2R, 3R)-2,3-butanediol thereof
Li et al. High-level production of pullulan from high concentration of glucose by mutagenesis and adaptive laboratory evolution of Aureobasidium pullulans
CN107189992B (en) A kind of heparosan synthase and its application
CN102154190B (en) Engineering escherichia coli capable of efficiently producing hyaluronic acid and preparation method thereof
CN106244566B (en) A kind of chondroitin synthase mutant and its application
CN102120999A (en) Method for synthesizing human milk fucosylation oligosaccharide by using genetic engineering strain through coupling and fermenting
CN116622747A (en) Gene for coding dextran sucrase and application thereof
Lai et al. Medium formulation and impeller design on the biosynthesis of high molecular weight hyaluronic acid by Streptococcus zooepidemicus ATCC 39920
CN111411066A (en) Double-way composite neuraminic acid-producing bacillus subtilis and construction method thereof
US20170137857A1 (en) Method for in vivo production of glycosaminoglycans

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant