CN114752543B - Gluconobacter oxydans for synthesizing 2-keto-L-gulonic acid by taking glucose as substrate through one-step fermentation and application thereof - Google Patents
Gluconobacter oxydans for synthesizing 2-keto-L-gulonic acid by taking glucose as substrate through one-step fermentation and application thereof Download PDFInfo
- Publication number
- CN114752543B CN114752543B CN202210514258.8A CN202210514258A CN114752543B CN 114752543 B CN114752543 B CN 114752543B CN 202210514258 A CN202210514258 A CN 202210514258A CN 114752543 B CN114752543 B CN 114752543B
- Authority
- CN
- China
- Prior art keywords
- gluconobacter oxydans
- diketo
- gluconic acid
- reductase
- keto
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D307/00—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom
- C07D307/02—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom not condensed with other rings
- C07D307/34—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
- C07D307/56—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
- C07D307/62—Three oxygen atoms, e.g. ascorbic acid
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/58—Aldonic, ketoaldonic or saccharic acids
- C12P7/60—2-Ketogulonic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01274—2,5-Didehydrogluconate reductase (1.1.1.274), i.e. 2,5-diketo-D-gluconic acid reductase
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a gluconobacter oxydans for synthesizing 2-keto-L-gulonic acid by taking glucose as a substrate through one-step fermentation and application thereof, belonging to the technical fields of genetic engineering and biological engineering. According to the invention, the recombinant gluconobacter oxydans ZL 01-delta bdhAB-dkgA-KgtpA capable of directly synthesizing 2-KLG through glucose is obtained by knocking out the aldehyde ketone reductase bdhAB and heterologously expressing the 2,5-DKG transporter KgtpA and the 2,5-DKG reductase dkgA in the gluconobacter oxydans ATCC9937, and the strain can be used for synthesizing 2-KLG by taking glucose as a substrate through one-step fermentation, so that the strain has important significance for realizing industrial production of 2-keto-L-gulonic acid or vitamin C in the fields of cosmetics, textiles, foods and the like.
Description
Technical Field
The invention relates to a gluconobacter oxydans for synthesizing 2-keto-L-gulonic acid by taking glucose as a substrate through one-step fermentation and application thereof, belonging to the technical fields of genetic engineering and biological engineering.
Background
Vitamin C is also called L-ascorbic acid, is a water-soluble vitamin, has strong reducibility, and is one of vitamins necessary for human body. The global annual vitamin C demand is about 13-15 ten thousand tons, wherein the annual export of China is 13 ten thousand tons, which accounts for more than 80% of the world's productivity. The annual vitamin C yield in China is about 20 ten thousand tons, which is higher than the global demand, and the vitamin C industry faces serious surplus productivity problems. Therefore, how to further reduce the production cost of vitamin C is of great importance to vitamin manufacturers, and along with the development of other functions of vitamin C, the later demand of vitamin C will be further increased, so that as a mass demand of the national people, the further increase of the productivity of vitamin C plays an important role in the economic promotion of related industries.
The main synthesis methods of vitamin C include Lei's method and two-step fermentation method. The Lei method is the earliest mode applied to vitamin C production, and has the advantages of mature process and higher product yield, but has the defects of complex production procedure, high labor intensity and serious environmental pollution caused by using a large amount of organic solvents in the production process. The second-step fermentation method is proposed by a scientist Yin Guanglin in China in the 70 th century, and a microorganism fermentation method is used for replacing a chemical synthesis step in the Lei method. Firstly, converting glucose into sorbitol by high-pressure hydrogenation, then converting sorbitol into sorbitol by Gluconobacter oxydans fermentation, then converting sorbitol into 2-keto-L-gulonic acid by mixed fermentation, and finally performing lactonization reaction to generate vitamin C. In addition, there are new two-step fermentation process, one-step fermentation process and other processes. Glucose can be converted into 2, 5-diketo-D-gluconic acid by a plurality of microorganisms of genus Erwinia, rahnella, serratia, tatomum, pantoea and the like, and then the 2, 5-diketo-D-gluconic acid is converted into 2-keto-L-gulonic acid by a coryneform 2, 5-diketo-D-gluconic acid reductase, which is a novel two-step fermentation method. In 1982, sonoyama, which is a Japanese salt wild pharmaceutical, fermented an Erwinia strain capable of producing 2, 5-diketo-D-gluconic acid in series with corynebacteria, thereby realizing the production of 2-keto-L-gulonic acid by a novel two-step fermentation method of glucose without high-pressure hydrogenation. In 1985, anderson laboratory in the United states first introduced 2, 5-diketo-D-gluconic acid reductase from corynebacteria into Erwinia which produced 2, 5-diketo-D-gluconic acid, and constructed an engineering strain which realized the direct production of 2-keto-L-gulonic acid from glucose by one-step fermentation. Similar engineering bacteria were constructed in Hardy, switzerland in 1988, but the conversion rate of glucose to 2-keto-L-gulonic acid was lower.
In order to solve the problems, the application aims at excavating and analyzing the main speed-limiting link of the glucose one-step fermentation to generate the 2-keto-L-gulonic acid, so as to build a complete one-step synthesis path of the 2-keto-L-gulonic acid, and promote the development of synthesis biology and the progress of vitamin industry to have potential guiding value and guiding significance.
Disclosure of Invention
The invention provides a recombinant Gluconobacter oxydans, which is at least one improvement on the basis of an original strain:
(1) Overexpressing a 2, 5-diketo-D-gluconic acid reductase from gluconobacter oxydans (Gluconobacter oxydans);
(2) Expressed a gene encoding a 2, 5-diketo-D-gluconic acid transporter derived from talomella citrea;
(3) Knockout or deletion of the aldehyde ketone reductase gene bdhAB; the nucleotide sequence of the bdhAB is shown in SEQ ID NO. 4.
In one embodiment, the amino acid sequence of the 2, 5-diketo-D-gluconic acid reductase is as set forth in SEQ ID No.1; the gene encoding the 2, 5-diketo-D-gluconic acid reductase contains a nucleotide sequence shown as SEQ ID NO. 2.
In one embodiment, the amino acid sequence of the 2, 5-diketo-D-gluconic acid transporter is as set forth in Genbank accession No.: wp_ 087487376.1; the nucleotide sequence of the kgtpA for encoding the 2, 5-diketo-D-gluconic acid transporter is shown as SEQ ID NO. 3.
In one embodiment, the nucleotide sequence of the aldehyde ketone reductase gene bdhAB is shown in SEQ ID NO. 4.
In one embodiment, the recombinant Gluconobacter oxydans expresses a 2,5-DKG reductase using a shuttle plasmid.
In one embodiment, the gene encoding the 2, 5-diketo-D-gluconic acid reductase passes through promoter P 7 Initiating transcription; the promoter P 7 The nucleotide sequence of (2) is shown as SEQ ID NO. 5.
In one embodiment, the gene encoding the 2, 5-diketo-D-gluconic acid transporter passes through promoter P 15 Initiating transcription; the promoter P 15 The nucleotide sequence of (2) is shown as SEQ ID NO. 6.
In one embodiment, the starting strain is Gluconobacter oxydans having 2, 5-diketo-D-gluconate synthesis ability.
In one embodiment, the recombinant gluconobacter oxydans is a starting strain of gluconobacter oxydans ATCC 9937.
The invention also provides a method for producing 2-keto-L-gulonic acid by using the recombinant gluconobacter oxydans.
In one embodiment, the method ferments to produce 2-keto-L-gulonic acid using glucose as a substrate.
In one embodiment, the method is fermenting the recombinant gluconobacter oxydans in a medium containing glucose at 28-30 ℃ for at least 96 hours.
In one embodiment, the method is to culture the recombinant gluconobacter in sorbitol medium for a period of time to obtain seed solution, and then transfer the seed solution to fermentation medium for fermentation.
In one embodiment, fermentation is carried out for 96-120 hours.
In one embodiment, each L of sorbitol medium contains 50g/L sorbitol and 10g/L yeast powder.
In one embodiment, each L of fermentation medium contains 20g/L glucose, 10g/L yeast powder, mgSO 4 ·7H 2 O 0.25g/L。
The invention also claims the use of said recombinant Gluconobacter oxydans or said method for the preparation of a product containing 2-keto-L-gulonic acid.
The invention also claims the use of said recombinant Gluconobacter oxydans or said method for the preparation of vitamin C containing products.
In one embodiment, the use is to use the Gluconobacter oxydans or the method for producing 2-keto-L-gulonic acid, and then to use the 2-keto-L-gulonic acid to produce vitamin C or a vitamin C containing product by a lactonization reaction.
The beneficial effects are that:
(1) The invention deduces and excavates the transport protein necessary for synthesizing 2-keto-L-gulonic acid based on the main speed limiting factor of synthesizing 2-keto-L-gulonic acid by glucose, clearly analyzes the key speed limiting link necessary for the way of generating 2-keto-L-gulonic acid by glucose one-step fermentation, and screens related shuttle plasmid to express key transport protein kgtpA;
(2) The invention constructs recombinant plasmid pBBRMCS2-2,5DKGR over-expressed 2,5-DKG reductase based on the synthetic route of 2-keto-L-gulonic acid; the 2-keto-L-gulonic acid metabolism competition related enzyme is deduced and excavated based on the side reaction path of the 2-keto-L-gulonic acid, the competition gene bdhAB is knocked out based on the SacB technology, and the synthesis path of the 2-keto-L-gulonic acid is successfully constructed in the gluconobacter oxydans ATCC9937, thereby realizing the one-step synthesis of the 2-keto-L-gulonic acid by taking glucose as a raw material, and the unit OD after fermentation 600 The yield of the 2-keto-L-gulonic acid can reach 0.53g/L, 1.63g/L and 2.15g/L respectively.
Drawings
FIG. 1 is a diagram showing a metabolic pathway of synthesizing 2-keto-L-gulonic acid and ascorbic acid in one step using glucose as a substrate.
FIG. 2 shows SDS-PAGE of 2,5-DKG reductase.
FIG. 3 is a graph showing the change in concentration of 2,5-DKG and 2-KLG in the in vitro catalysis of 2,5-DKG reductase.
FIG. 4 is a predicted map of the transmembrane domain of the 2,5-DKG transporter KgtpA.
FIG. 5 is a graph showing the effect of transporter transport of 2, 5-DKG.
FIG. 6 is a schematic diagram of construction of recombinant plasmid pBBR1 MCS-2-dkgA-kgtpA.
FIG. 7 is a graph showing comparison of the results of fermentation production of 2-keto-L-gulonic acid by different strains.
Detailed Description
Culture medium (one)
Sorbitol medium: sorbitol 50g/L, yeast powder 10g/L. The solid medium was prepared by adding 20g/L agar strips.
Glucose fermentation medium: glucose 20g/L, yeast powder 10g/L, mgSO 4 ·7H 2 O 0.25g/L。
(II) HPLC detection of 2-keto-L-gulonic acid: the sample was eluted with a chromatographic column (250X 4.6mm,5 μm, aminex HPX-87Hcolumn (Bio-Rad, calif., USA) with a mobile phase of 50mm/L dilute sulfuric acid, at a flow rate of 0.5mL/min, using a differential refractive detector.
(III) Gluconobacter oxydans transformation method: about 100ng of the successfully constructed plasmid was added to 100. Mu.L of competent cells of G.oxydans ATCC9937, mixed well, and then ice-coated on ice for about 10min, added to a 1mm cuvette, and electrotransport was performed at 180V, 25. Mu.F, 200Ω. Immediately after the electric shock is finished, 1mL of sorbitol liquid seed culture medium is added into the electric shock cup, and after the uniform mixing, all the liquid seed culture medium is transferred into a 14mL shaking tube for 6h of culture. After the completion of the culture, the cells were homogenized by centrifugation, leaving about 100. Mu.L of the medium, and plated on corresponding resistance plates. And (3) culturing the strain in an inversion mode at 30 ℃ for about 20 hours, and picking single colonies for colony PCR verification.
(IV) Gibson assembly method: the reaction system was as follows, 50ng of DNA fragment was added, 100ng of vector was added, 5ul of Gibson mix was added, and sterile ultra pure water was added to 10ul of the system. The reaction conditions were as follows, and the reaction was carried out at 50℃for 60 minutes, immediately after the completion of the reaction, on ice. 10ul of the cells were transformed into E.coli competent JM109.
(V) means for knocking out the gene of Gluconobacter oxydans: the G.oxydans ATCC9937 genome was edited based on the sacB system. Specific methods are described in Qin Z, yu S, liu L, et al A SacB-based system for diverse and multiple genome editing in Gluconobacter oxydans [ J ]. Journal of Biotechnology,2021.
Sixth, 2 XHi-Fi PCR Mix premix was purchased from Bio-engineering Co., ltd.
Example 1: catalytic capability verification of endogenous 2,5-DKG reductase of Gluconobacter oxydans ATCC9937
Designing a primer pair dkgA-F1/dkgA-R1 by taking the genome of the gluconobacter oxydans ATCC9937 as a template, carrying out PCR amplification by using the primer pair, and carrying out PCR Mix premix with 2X high fidelity under the condition of pre-denaturation of 95 ℃ for 5min; the amplification stage was performed at 95℃for 15s,57℃for 15s,72℃for 30s for 30 cycles; extending at 72 ℃ for 5min, and purifying the PCR product to obtain a fragment dkgA shown as SEQ ID NO. 2; PCR amplification was performed with the vector pCDFDuet as a template, using the primer pair Duet-F/Duet-R, and the product was purified. The fragment dkgA and the vector pCDFDuet are recombined by a Gibson assembly method to obtain a recombinant vector, the recombinant vector is transformed into Escherichia coli JM109, plasmids are extracted and sequenced for verification, and the correct recombinant vector pCDFDuet-dkgA is obtained. The recombinant plasmid which is verified to be correct is transformed into escherichia coli BL21 (DE 3) to obtain a recombinant strain BL21-dkgA.
The recombinant strain BL21-dkgA was transferred to 10ml LB containing 50mg/L kanamycin sulfate for culture overnight to prepare a seed solution. Transferring the cultured seed solution into 50ml TB medium containing 50mg/L kanamycin sulfate at 2%, and until the thallus concentration reaches OD 600 The temperature was reduced to 20 ℃ at =0.8, and IPTG was added to induce to a final concentration of 0.5mM to express 2,5-DKG reductase, and cells were collected after induction for 16-20 hours. After the expression, the fermentation broth was centrifuged at 4000rpm for 10min, and the supernatant was discarded to collect the cells. The cells were resuspended in PBS buffer at a ratio of 1g wet cells: 5mL of PBS buffer (OD of the bacterial suspension 15). The cells were crushed by a homogenizer, and the crushed solution was centrifuged at 12000rpm for 1 hour. The supernatants were collected, assayed for enzyme activity and analyzed by SDS-PAGE (FIG. 2). The result shows that the specific enzyme activity is 1673U/mg.
At room temperature, 50. Mu.L of the cell disruption solution was added to 450. Mu.L of 25mmol/L Tris-HCl buffer (pH 6.0), and 50. Mu.L of 5mmol/L NADPH solution and 50. Mu.L of 2, 5-DKG-containing solution were further added to measure the changes in the concentration of 2,5-DKG and 2-KLG in the system, and as a result, the 2,5-DKG was completely converted into 2-KLG in the system after 35min of the reaction as shown in FIG. 3, and the concentration of 2-KLG obtained after the detection was 1.0715g/L.
Primers used in Table 1
| Primer(s) | Sequences 5'-3' (underlined as homology arm regions) |
| dkgA-F1 | CTTTAATAAGGAGATATACCATGTCGTCACAGGTTCCATCCG |
| dkgA-R1 | CTTTCTGTTCGACTTAAGCATCAGAATTTCGCCGTATTCGGATCA |
| Duet-F | TGCTTAAGTCGAACAGAAAGTAATCGT |
| Duet-R | GGTATATCTCCTTATTAAAGTTAAACAAAATTATTTCTACAGGGG |
Example 2: transport protein KgtpA transport effect verification
The transmembrane domain of the KgtpA sequence was predicted using on-line software and the predicted results are shown in figure 4. Designing a primer pair kgtpA-F1/kgtpA-R1 by taking a synthesized 2, 5-diketo-D-gluconic acid transporter gene kgtpA derived from Tatumella citrula (Tatumella citrea) as shown in SEQ ID NO.3 as a template, carrying out PCR amplification by using the primer pair, and carrying out 2X high-fidelity PCR Mix premix under the condition of pre-denaturation at 95 ℃ for 5min; the amplification stage was performed at 95℃for 15s,57℃for 15s,72℃for 30s for 30 cycles; extending at 72 ℃ for 5min, and purifying the PCR product to obtain a fragment kgtpA; PCR amplification was performed using the vector pCOLADuet as a template and the primer pair pCOLA-F/pCOLA-R, and the product was purified. The fragment kgtpA and the vector pCOLADuet are recombined by a Gibson assembly method to obtain a recombinant vector, the recombinant vector is transformed into escherichia coli JM109, plasmids are extracted and sequenced for verification, and the correct recombinant vector pCOLADuet-kgtpA is obtained. The recombinant plasmid which is verified to be correct is transformed into escherichia coli BL21 (DE 3) to obtain a recombinant strain BL21-kgtpA.
The recombinant strain BL21-kgtpA was transferred to 10ml LB containing 50mg/L kanamycin sulfate for culture overnight to prepare a seed solution. Transferring the cultured seed solution into 50ml TB medium containing 50mg/L kanamycin sulfate at 2%, and until the thallus concentration reaches OD 600 When=0.8, the temperature was reduced to 20 ℃ and induction was performed with addition of IPTG to a final concentration of 0.5mM to express the 2,5-DKG transporter kgtpA. After 20h of induction, 2,5-DKG solution was added to the medium to make the final concentration of 2,5-DKG in the medium 3g/L, the culture was continued at 20℃for 12h, and the change in the concentration of 2,5-DKG in the medium was detected, as shown in FIG. 5, WT was a control group which did not express the transporter, after 2,5-DKG was added, the decrease amount of 2,5-DKG in the control group was 0.51g/L, and the content of 2,5-DKG in the fermentation broth after the transporter was expressed was reduced by about 0.91g/L, and the transport capacity was increased by 78.4%.
Primers used in Table 2
| Primer(s) | Sequences 5'-3' (underlined as homology arm regions) |
| kgtpA-F1 | CTTTAATAAGGAGATATACCATGCAAAAATCACAGCCGGGA |
| kgtpA-R1 | CTTTCTGTTCGACTTAAGCATTATTTGGCATCATGAATACGTGGGG |
| pCOLA-F | TGCTTAAGTCGAACAGAAAGTAATCGTATT |
| pCOLA-R | GGTATATCTCCTTATTAAAGTTAAACAA |
Example 3: knockout of bdhAB in Gluconobacter oxydans ATCC9937 genome based on SacB technology
Designing a primer pair bdhAB-up-F/bdhAB-up-R to knock out a bdhAB gene shown as SEQ ID NO.4 by taking a gluconobacter oxydans ATCC9937 genome as a template, carrying out PCR amplification by using the primer pair, and carrying out 2X high-fidelity PCR Mix premix under the condition of pre-denaturation at 95 ℃ for 5min; the amplification stage was performed at 95℃for 15s,57℃for 15s,72℃for 30s for 30 cycles; extending at 72 ℃ for 5min, and purifying the PCR product to obtain a fragment bdhAB upstream homology arm; designing a primer pair bdhAB-down-F/bdhAB-down-R by taking a gluconobacter oxydans ATCC9937 genome as a template, carrying out PCR amplification by using the primer pair, and carrying out PCR Mix premix by using 2X high-fidelity under the condition of pre-denaturation at 95 ℃ for 5min; the amplification stage was performed at 95℃for 15s,57℃for 15s,72℃for 30s for 30 cycles; and (3) extending at 72 ℃ for 5min, and purifying the PCR product to obtain the downstream homology arm of the fragment bdhAB. PCR amplification was performed using the vector pK18mobsacb as a template and the primer pair pK-F/pK-R, and the product was purified. Recombinant vector is obtained by recombining the upstream homology arm of the fragment bdhAB, the downstream homology arm of the bdhAB and the vector pK18mobsacb by a Gibson assembly method, the recombinant vector is transformed into Escherichia coli JM109, plasmids are extracted and sequenced for verification, and the correct knockout vector pK18-bdhAB is obtained.
The pK18-bdhAB knockout vector was transformed into Gluconobacter oxydans ATCC9937 using electrotransformation, the electrotransformed strain was immediately added to pre-chilled liquid sorbitol medium and resuscitated at 30℃and 220rpm for 4 hours to cause the first homologous recombination. Thereafter, it was spread on a kanamycin-resistant solid sorbitol medium and cultured at 30 ℃. After 2 days, colonies were picked and inoculated into liquid sorbitol medium without resistance, and cultured overnight for the second homologous recombination. Then, 50. Mu.L of the bacterial liquid was spread on a solid sorbitol medium containing 10% sucrose and cultured at 30 ℃. After 2 days, colonies were picked for colony PCR and sequenced to verify the mutant strain. After verification, the recombinant strain ZL 01-delta bdhAB is obtained.
Table 3 primers used
Example 4: construction of Gluconobacter oxydans ATCC9937 expression vector
Designing a primer pair dkgA-F2/dkgA-R2 by taking the genome of the Gluconobacter oxydans ATCC9937 as a template, carrying out PCR amplification on the dkgA gene shown in SEQ ID NO.2 by using the primer pair, and carrying out 2X high-fidelity PCR Mix premix under the condition of pre-denaturation at 95 ℃ for 5min; the amplification stage was performed at 95℃for 15s,57℃for 15s,72℃for 30s for 30 cycles; extending at 72 ℃ for 5min, and purifying the PCR product to obtain a fragment dkgA; designing a primer pair P7-F/P7-R by taking the genome of Gluconobacter oxydans ATCC9937 as a template, carrying out PCR amplification by using the primer pair, and carrying out PCR Mix premix by using 2X high-fidelity PCR Mix premix under the condition of pre-denaturation at 95 ℃ for 5min; the amplification stage was performed at 95℃for 15s,57℃for 15s,72℃for 10s for 30 cycles; and (3) extending at 72 ℃ for 5min, and purifying the PCR product to obtain a promoter fragment P7 with a nucleotide sequence shown as SEQ ID NO. 5. Fusion PCR amplification was performed using the primer pair P7-F/dkgA-R2, ligating the promoter P7 fragment to dkgA. PCR amplification was performed using the vector pBBR1MCS-2 as a template and the primer pair pBBR-F/pBBR-R, and the product was purified. The fragment P7-dkgA vector pBBR1MCS-2 is recombined by a Gibson assembly method to obtain a recombined vector, the recombined vector is transformed into escherichia coli JM109, plasmids are extracted and sequenced for verification, and the correct knockout vector pBBR1MCS-2-dkgA is obtained.
Designing a primer pair kgtpA-F2/kgtpA-R2 by taking a synthetic sequence kgtpA shown as SEQ ID NO.3 as a template, carrying out PCR amplification by using the primer pair, and carrying out PCR Mix premix by using 2X high-fidelity under the condition of pre-denaturation at 95 ℃ for 5min; the amplification stage was performed at 95℃for 15s,57℃for 15s,72℃for 30s for 30 cycles; extending at 72 ℃ for 5min, and purifying the PCR product to obtain a fragment kgtpA; designing a primer pair P15-F/P15-R by taking the genome of Gluconobacter oxydans ATCC9937 as a template, carrying out PCR amplification by using the primer pair, and carrying out PCR Mix premix by using 2X high-fidelity PCR Mix premix under the condition of pre-denaturation at 95 ℃ for 5min; the amplification stage was performed at 95℃for 15s,57℃for 15s,72℃for 10s for 30 cycles; and (3) extending at 72 ℃ for 5min, and purifying the PCR product to obtain a promoter fragment P15 (the nucleotide sequence is shown as SEQ ID NO. 6). Fusion PCR amplification was performed using the primer pair P15-F/kgtpA-R2, and the promoter P15 fragment was ligated to kgtpA. PCR amplification was performed using the vector pBBR1MCS-2-dkgA as a template and the primer pair pBBR-F2/pBBR-R2, and the product was purified. The fragment P15-kgtpA and the vector pBBR1MCS-2-dkgA are recombined by a Gibson assembly method to obtain a recombined vector, the recombined vector is transformed into escherichia coli JM109, plasmids are extracted and sequenced for verification, and the correct recombined vector pBBR1MCS-2-dkgA-kgtpA is obtained (as shown in figure 6).
Primers used in Table 4
Example 5: recombinant bacterium uses glucose as substrate to ferment and produce 2-KLG in one step
Sequencing was taken to verify correct pBBR1MCS-2-dkgA and pBBR1MCS-2-dkgA-kgtpThe recombinant plasmids A were transferred into the recombinant strain ZL 01-. DELTA.bdhAB constructed in example 3 by means of electrotransformation, respectively, and the electrotransformed strain was immediately added to a precooled liquid sorbitol medium and resuscitated at 30℃and 220rpm for 4 hours, and applied to a solid sorbitol medium containing kanamycin resistance. After culturing at 30 ℃ for 48 hours, single colonies are picked up, and a primer pair pBBR-F3/pBBR-R3 is designed for colony pcr verification. The correct strains were identified as ZL01- ΔbdhAB-dkgA and ZL01- ΔbdhAB-dkgA-KgtpA, respectively. ZL 01-DeltabdhAB-dkgA and ZL 01-DeltabdhAB-dkgA-KgtpA were transferred to liquid sorbitol culture containing kanamycin resistance, respectively, and cultured at 30℃for 24 hours to obtain seed solutions. The seed solution was transferred to a glucose fermentation medium (kanamycin resistance was added to the recombinant strain containing the plasmid) at an inoculum size of 10%, and after culturing at 30℃for 120 hours, the 2-KLG yield was compared (the results are shown in FIG. 7), and Gluconobacter oxydans ATCC9937 and ZL01- ΔbdhAB were used as controls. The results show that the starting strains Gluconobacter oxydans ATCC9937, the recombinant strains ZL01- ΔbdhAB, ZL01- ΔbdhAB-dkgA-KgtpA unit OD 600 Yield (total yield divided by fermentation broth OD) 600 Values) of 0, 0.53g/L, 1.63g/L, 2.15g/L, respectively.
Primers used in Table 5
| Primer(s) | Sequences 5'-3' (underlined as homology arm regions) |
| pBBR-F3 | CGTTGTAAAACGACGGCCAGTG |
| pBBR-R3 | TACACTTTATGCTTCCGGCTCGT |
Comparative example:
specific embodiments are described in example 4, except that the plasmid pBBR1MCS-2, p13-Kana, p2-Kana plasmid are replaced by p13-Kana or p2-Kana plasmid as expression vector, respectively, and the plasmids are disclosed in the paper "Gluconobacter oxydans dehydrogenase system regulated synthesis of 2-keto-L-gulonic acid". The results show that recombinant bacteria constructed by taking p13-Kana or p2-Kana plasmids as expression vectors cannot grow in a culture medium taking glucose as a carbon source.
While the invention has been described with reference to the preferred embodiments, it is not limited thereto, and various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
SEQUENCE LISTING
<110> university of Jiangnan
<120> Gluconobacter oxydans for one-step fermentation synthesis of 2-keto-L-gulonic acid using glucose as substrate
Application of
<130> BAA220416A
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 279
<212> PRT
<213> Gluconobacter oxydans
<400> 1
Met Ser Ser Gln Val Pro Ser Ala Glu Ala Gln Thr Val Ile Ser Phe
1 5 10 15
His Asp Gly His Thr Met Pro Gln Ile Gly Leu Gly Val Trp Glu Thr
20 25 30
Pro Pro Asp Glu Thr Ala Glu Val Val Lys Glu Ala Val Lys Leu Gly
35 40 45
Tyr Arg Ser Val Asp Thr Ala Arg Leu Tyr Lys Asn Glu Glu Gly Val
50 55 60
Gly Lys Gly Leu Glu Asp His Pro Glu Ile Phe Leu Thr Thr Lys Leu
65 70 75 80
Trp Asn Asp Glu Gln Gly Tyr Asp Ser Thr Leu Arg Ala Tyr Glu Glu
85 90 95
Ser Ala Arg Leu Leu Arg Arg Pro Val Leu Asp Leu Tyr Leu Ile His
100 105 110
Trp Pro Met Pro Ala Gln Gly Gln Tyr Val Glu Thr Trp Lys Ala Leu
115 120 125
Val Glu Leu Lys Lys Ser Gly Arg Val Lys Ser Ile Gly Val Ser Asn
130 135 140
Phe Glu Ser Glu His Leu Glu Arg Ile Met Asp Ala Thr Gly Val Val
145 150 155 160
Pro Val Val Asn Gln Ile Glu Leu His Pro Asp Phe Gln Gln Arg Ala
165 170 175
Leu Arg Glu Phe His Glu Lys His Asn Ile Arg Thr Glu Ser Trp Arg
180 185 190
Pro Leu Gly Lys Gly Arg Val Leu Ser Asp Glu Arg Ile Gly Lys Ile
195 200 205
Ala Glu Lys His Ser Arg Thr Pro Ala Gln Val Val Ile Arg Trp His
210 215 220
Leu Gln Asn Gly Leu Ile Val Ile Pro Lys Ser Val Asn Pro Lys Arg
225 230 235 240
Leu Ala Glu Asn Leu Asp Val Phe Gly Phe Val Leu Asp Ala Asp Asp
245 250 255
Met Gln Ala Ile Glu Gln Met Asp Arg Lys Asp Gly Arg Met Gly Ala
260 265 270
Asp Pro Asn Thr Ala Lys Phe
275
<210> 2
<211> 1308
<212> DNA
<213> Gluconobacter oxydans
<400> 2
tttggcatca tgaatacgtg gggtgaaatt ctgctgccgt gcctctgccg ggcgcagatc 60
acactgcgct ggcagtaatg ccgcaataat cccggcaatg atcagagagc ctgccagagt 120
gacaacggct gcattctgcc cgtacaggta gatcattaat ccgaccaacc aggggccaca 180
gaaaccgccc agattcccta gtccgttaat tacaccacgg gcactaccgg ctgcctccgg 240
cggtgcaata cgtcccggaa tactccagaa cgggctggtg gctgctttca ggaaaaagcc 300
gcaagccacc agagccagat aagcagccac cacaaattca cgtagcagga ctgaggccaa 360
cagacaggcc gcaaaacaga acagagaaat catcacccat tgccgacgtt tgccggtttt 420
atcgctcagg taagagacga cataaatccc tgataacgtc gcgataaaag gtagcactgt 480
cagcaaaccg acgttaccaa tactggctcc ggtcaggttt tttataatag tcggcagcca 540
cagagtgtat ccgtaatcac ctgtctgata gaaaaagttc agaatcacta acttcatcag 600
gcccgggtta tggaaaacct cttgcagggg agcatgactg atcggaggga gtttgctccg 660
ctcggccttg tcacgggcca tttcgcgcag cagatattcc cgttctgctg ccggcagcca 720
acgggcatct tcagggcggt cactgaccat cagccaccag actgccagaa ccactaccga 780
cagtaatcct tcgataataa ataaccagcg ccagtctagc agtgcaataa tccatccgga 840
gacaggggcg gtaatcattc cgccaagcgg ggcgaacatc atgacaaatg cattagcacg 900
ccccagctct ttttcaggaa accagttgct gaccattgtc agaactaccg gcaacatccc 960
accttcagag acccccagtg caaaacgtaa aatcaacagc tggtactgat gagtcacaaa 1020
cccggtagcg accgaaacta cggcccaggc aacaagcgac caggcaataa agcgtttacc 1080
actgccacgt actgcgatat gcccaccagg aacctgcaaa aacagataac caataaagaa 1140
aataccgcta actaccccgg ccatctggct ggacatcagc agatcctgct ccataccgcc 1200
cggcaatgcg aaactgatat ttacccgatc cataaacgac atgatgcagg ctatcaggat 1260
cggcacaata atccgaaacc agcgggttcc cggctgtgat ttttgcat 1308
<210> 3
<211> 840
<212> DNA
<213> artificial sequence
<400> 3
atgtcgtcac aggttccatc cgccgaagcc cagaccgtga tttcctttca tgacggtcac 60
accatgcccc agatcgggct gggtgtgtgg gaaacgccgc cggatgagac ggccgaggtc 120
gtgaaggaag ccgtgaagct cggttaccgg tctgtcgata cggcgcgtct gtacaagaac 180
gaggaaggtg tcggcaaagg tctggaagac catccggaaa tcttcctgac gaccaagctc 240
tggaatgacg agcagggcta tgacagcacc ctgcgggcgt atgaagaaag cgcgcgcctg 300
ctgcgtcgtc cggtgctgga cctgtatctg atccactggc cgatgccggc tcaggggcag 360
tatgtcgaga cgtggaaggc actcgtcgag ctgaagaaat ccggtcgtgt gaagtccatc 420
ggcgtgtcca atttcgagtc ggagcatctg gagcggatca tggatgccac gggtgtcgtg 480
ccggtcgtca accagatcga gctgcatccc gatttccagc agcgcgccct gcgggaattc 540
cacgagaagc acaacatccg caccgagtcc tggcgcccgc tgggcaaggg gcgcgtcctg 600
agcgatgagc ggatcgggaa gatcgctgaa aagcacagcc ggactccggc gcaggtcgtg 660
atccgctggc atcttcagaa tggactgatc gtcattccga aatcggtcaa tcccaagcgt 720
ctggctgaaa atctggatgt gttcggcttc gtgctggatg cggatgacat gcaggccatc 780
gaacagatgg accgcaagga tggccggatg ggcgctgatc cgaatacggc gaaattctga 840
<210> 4
<211> 1080
<212> DNA
<213> Gluconobacter oxydans
<400> 4
atgcagtatc gtcagcttgg tcgctcgggc ctcaagattt cagcactcaa tttcggatcg 60
gtgacgttcg gcggacaggg caattttgcc gccacgggta aggtggacat cgccgaagcg 120
acgcgcatgg tggacatctg cgtcgagcac ggcgtgaaca tgttcgatac ggccgatgcc 180
tattccggcg gtgaagccga ggaaattctc ggccgcgtcc ttcaggggcg cagccgcgaa 240
ctgctcgtca ccagcaaggt gcgtttccca accggaaaag ggccgaacga acagggtctg 300
tcgcgtcacc atatcctcaa tgcctgcgac gacagtctgc gtcgcctggg gcgcgatcac 360
atcgatctct attatctgca tgaatgggat ggtctgacgc cggtcgagga gacgcttgag 420
gcgctccaga ccctgcgcga tcagggcaag atccgctatg cggggatttc caattttgcg 480
ggctggcagg ccatgaaact gctgggcgcc gccgagcggg accgtctgat cgcgccggtc 540
agtcagcagc tttattactc gctggaagcc cgcgacgccg aatatgaact gctgccgctc 600
gccgtcgatc agggattggg cgtgcaggtc tggagtccgc tcgcctgtgg gttgctgacg 660
gacaaatacc ggcgcggcaa gacggcgccg gaagattccc gccgcatttc cggctggcct 720
gagccggaag tccgggatct gaagaagctc tacgatacgg ttgaggttct ggtgcagatc 780
gccgaagagc acagcgtttc cgctgcccgt gtggcactgg cctggacgct gcacaagccg 840
gcgatcacgt cactggttct gggcgcacgc caggaaagcc agcttctgga taatctggcg 900
gccgcgtcgc tccgtctgac gcaggaacag gttcgccggc ttgacgatgt cagcgctccg 960
gatctcatct atccgtactg gcatcagaac cggaatgcct ttgatcgtct ctccaaggcg 1020
gatcttgttt tgcagggacc ggcaaaacgt catcgggagg cccttgaaac gaaaaaatga 1080
<210> 5
<211> 310
<212> DNA
<213> artificial sequence
<400> 5
cacgatcgtc ggcaaagtga tcgaaggcat ggaatacgtg gaccagatca agcgcggttc 60
gggcgcaggt ggcgtggtca aggaccctga caccattctc aaggcttatg tcgaagcctg 120
agtcccgctg aaaagcagga acgcggaaag gccggtgcag gaatgcaccg gcctttttta 180
ttgccttttc ccggacaagc gcatcatatc cccattcata agcggcgctt atgaaaagat 240
agaaacataa gatttcactc tcctttttca gaatcgtatg gtcgtcacga tcagaaaagg 300
aagaataaca 310
<210> 6
<211> 310
<212> DNA
<213> artificial sequence
<400> 6
ttaaaattcc gtcacatggc agctaaatgc ctgttttgct tccatttttg catagctgat 60
ttcttctccc gcctctggct tctgctggaa ccatgagcta aagcaacgta gacgcgaggc 120
gtagatcgtg aagcgggcga aatggactgt ggcttttatg tcactcccct accccgagta 180
gagcctgaag accctgactg gctttgtctc ggggaactct gcgttctata tgcgcttatg 240
catcgcgctg ggtccgttgg tgaaagcatt ttccaacggc tcgaacgtta gtcactaaga 300
ggacgaaaac 310
Claims (8)
1. A recombinant gluconobacter oxydans is characterized in that 2-keto-L-gulonic acid can be synthesized by taking glucose as a substrate through one-step fermentation; the recombinant gluconobacter oxydans knocks out or lacks aldehyde ketone reductase genes on the basis of an original strainbdhABAnd (2) carrying out improvement of (1) or (2):
(1) Overexpression of Gluconobacter oxydansGluconobacter oxydans) 2, 5-diketo-D-gluconic acid reductase of origin;
(2) Overexpression of Gluconobacter oxydansGluconobacter oxydans) 2, 5-diketo-D-gluconic acid reductase from source and expresses the bacterium Tatherum citricumTatumella citrea) A source of 2, 5-diketo-D-gluconic acid transporter;
the starting strain is Gluconobacter oxydans ATCC9937; the vector for expressing 2, 5-diketo-D-gluconic acid reductase and/or 2, 5-diketo-D-gluconic acid transporter is pBBRMCS2; the aldehyde ketone reductase genebdhABThe gene sequence of (2) is shown as SEQ ID NO. 4; the amino acid sequence of the 2, 5-diketo-D-gluconic acid reductase is shown as SEQ ID NO.1; the amino acid sequence of the 2, 5-diketo-D-gluconic acid transporter is as in Genbank accession No.: wp_ 087487376.1.
2. The recombinant gluconobacter oxydans of claim 1 in which the gene encoding the 2, 5-diketo-D-gluconic acid reductase passes the promoter P 7 Transcription is initiated.
3. The recombinant gluconobacter oxydans according to claim 1 or 2, wherein the gene encoding the 2, 5-diketo-D-gluconic acid transporter passes the promoter P 15 Transcription is initiated.
4. 2-keto-L-gulon for improving Gluconobacter oxydansA method for acid production, characterized by overexpressing a 2, 5-diketo-D-gluconic acid reductase derived from Gluconobacter oxydans, expressing a 2, 5-diketo-D-gluconic acid transporter derived from Tatarium citri, and knocking out an aldehyde ketone reductase genebdhAB；
The starting strain is Gluconobacter oxydans ATCC9937; the vector for expressing 2, 5-diketo-D-gluconic acid reductase and/or 2, 5-diketo-D-gluconic acid transporter is pBBRMCS2; the aldehyde ketone reductase genebdhABThe gene sequence of (2) is shown as SEQ ID NO. 4; the amino acid sequence of the 2, 5-diketo-D-gluconic acid reductase is shown as SEQ ID NO.1; the amino acid sequence of the 2, 5-diketo-D-gluconic acid transporter is as in Genbank accession No.: wp_ 087487376.1.
5. The method for producing 2-keto-L-gulonic acid by using the recombinant Gluconobacter oxydans of any one of claims 1 to 3, which is characterized in that glucose is used as a substrate and fermentation is carried out at 28 to 30 ℃ for at least 96 hours.
6. The method according to claim 5, wherein the recombinant Gluconobacter oxydans is cultured in a sorbitol-containing medium for a period of time to obtain a seed solution, and the seed solution is transferred to a fermentation medium for fermentation.
7. The method according to claim 5 or 6, wherein the medium for fermentation contains glucose, yeast powder and MgSO 4 。
8. Use of a recombinant gluconobacter oxydans of any one of claims 1 to 3 or a method of any one of claims 4 to 7 for the preparation of a product comprising 2-keto-L-gulonic acid or vitamin C.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210514258.8A CN114752543B (en) | 2022-05-11 | 2022-05-11 | Gluconobacter oxydans for synthesizing 2-keto-L-gulonic acid by taking glucose as substrate through one-step fermentation and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210514258.8A CN114752543B (en) | 2022-05-11 | 2022-05-11 | Gluconobacter oxydans for synthesizing 2-keto-L-gulonic acid by taking glucose as substrate through one-step fermentation and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114752543A CN114752543A (en) | 2022-07-15 |
| CN114752543B true CN114752543B (en) | 2023-07-18 |
Family
ID=82335730
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210514258.8A Active CN114752543B (en) | 2022-05-11 | 2022-05-11 | Gluconobacter oxydans for synthesizing 2-keto-L-gulonic acid by taking glucose as substrate through one-step fermentation and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114752543B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104673736A (en) * | 2015-03-11 | 2015-06-03 | 江南大学 | Method for improving gluconobacter oxydans for producing 2-keto-L-gulconic acid |
| CN112111505A (en) * | 2020-09-17 | 2020-12-22 | 江南大学 | Method for gene knockout in gluconobacter oxydans |
| CN112430560A (en) * | 2019-08-26 | 2021-03-02 | 中国科学院分子植物科学卓越创新中心 | 2-keto-L-gulonic acid production strain and construction method thereof |
| CN112852857A (en) * | 2021-02-06 | 2021-05-28 | 江南大学 | Method for knocking out multiple genes in gluconobacter oxydans |
-
2022
- 2022-05-11 CN CN202210514258.8A patent/CN114752543B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104673736A (en) * | 2015-03-11 | 2015-06-03 | 江南大学 | Method for improving gluconobacter oxydans for producing 2-keto-L-gulconic acid |
| CN112430560A (en) * | 2019-08-26 | 2021-03-02 | 中国科学院分子植物科学卓越创新中心 | 2-keto-L-gulonic acid production strain and construction method thereof |
| CN112111505A (en) * | 2020-09-17 | 2020-12-22 | 江南大学 | Method for gene knockout in gluconobacter oxydans |
| CN112852857A (en) * | 2021-02-06 | 2021-05-28 | 江南大学 | Method for knocking out multiple genes in gluconobacter oxydans |
Non-Patent Citations (3)
| Title |
|---|
| 2-酮基-L-古龙酸一步发酵生产菌株发酵过程优化;杨燕花等;食品与发酵工业;第42卷(第7期);第60-64页 * |
| 普通生酮基古龙酸菌2-酮基-L-古龙酸合成途径在氧化葡萄糖酸杆菌中的整合表达与强化;陈吉铭等;食品与生物技术学报;第35卷(第6期);第611-616页 * |
| 高浓度2-KLG对氧化葡萄糖酸杆菌WSH-003中2-KLG合成 途径关键基因表达的影响;万慧等;微生物学报;第56卷(第10期);第1656-1663页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114752543A (en) | 2022-07-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112391372B (en) | Glutamic acid decarboxylase mutant, genetically engineered bacterium and application thereof | |
| CN108795789A (en) | A kind of high-yield itaconic acid Yarrowia lipolytica engineered strain and its construction method, zymotechnique and application | |
| CN113755354B (en) | Recombinant saccharomyces cerevisiae for producing gastrodin by utilizing glucose and application thereof | |
| CN111593014B (en) | Method for co-production of 1, 3-propylene glycol and D-1,2, 4-butanetriol | |
| CN105002204B (en) | One plant height produces the Gluconobater oxydans genetic engineering strain and its preparation method and application of 5-KGA | |
| CN113444654B (en) | Saccharomyces cerevisiae engineering bacterium for producing dihydroartemisinic acid and construction method and application thereof | |
| CN111996157B (en) | Gene engineering bacterium for efficiently producing 1, 3-propylene glycol and construction method and application thereof | |
| CN114262702A (en) | Application of ergothioneine synthesis gene in reconstruction of ergothioneine metabolic pathway in corynebacterium glutamicum and method thereof | |
| CN113913400A (en) | L-sorbosone dehydrogenase mutant with improved catalytic activity | |
| CN112430560B (en) | 2-keto-L-gulonic acid production strain and construction method thereof | |
| CN114752543B (en) | Gluconobacter oxydans for synthesizing 2-keto-L-gulonic acid by taking glucose as substrate through one-step fermentation and application thereof | |
| Hassanin et al. | Facile synthesis of bioactive allitol from D-psicose by coexpression of ribitol dehydrogenase and formate dehydrogenase in Escherichia coli | |
| CN114480237B (en) | Two-stage fermentation method for improving yield of 2-KLG in gluconobacter | |
| CN115725484A (en) | Enzyme mutation expression engineering bacterium for synthesizing D-psicose and application thereof | |
| KR20200040585A (en) | A recombinant microorganism into which a high activity malate dehydrogenase for producing succinic acid and a method for producing succinic acid using the same | |
| CN110499259B (en) | Yarrowia lipolytica YW100-1 and application thereof | |
| CN110257312B (en) | Recombinant gene engineering bacterium and application thereof in producing vanillin by fermentation | |
| KR20100092190A (en) | Recombinant microorganism having enhanced glycerol metabolism and succinic acid-productivity and method for preparing succinic acid using the same | |
| CN114806899B (en) | Trichoderma reesei engineering bacteria for producing L-malic acid and application thereof | |
| CN114806982B (en) | Modified 1, 3-propanediol producing strain and application thereof | |
| CN116948925A (en) | Construction and application of gluconobacter oxydans capable of efficiently synthesizing 2-KLG by utilizing glucose | |
| CN114806910B (en) | Candida tropicalis engineering bacteria for producing L-limonene and construction method thereof | |
| CN111718948B (en) | Gene and application thereof in production of mannich | |
| CN107338263B (en) | Construction method for producing itaconic acid by fermenting xylose based on pichia stipitis synthetic strain | |
| CN114934027B (en) | L-sorbose dehydrogenase mutant capable of improving 2-KLG yield |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |