CN114752543A

CN114752543A - Gluconobacter oxydans for synthesizing 2-keto-L-gulonic acid by one-step fermentation with glucose as substrate and application thereof

Info

Publication number: CN114752543A
Application number: CN202210514258.8A
Authority: CN
Inventors: 周景文; 陈坚; 李光; 曾伟主; 余世琴; 李江华
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2022-05-11
Filing date: 2022-05-11
Publication date: 2022-07-15
Anticipated expiration: 2042-05-11
Also published as: CN114752543B

Abstract

The invention discloses gluconobacter oxydans for synthesizing 2-keto-L-gulonic acid by one-step fermentation with glucose as a substrate and application thereof, belonging to the technical field of genetic engineering and biological engineering. According to the invention, aldone reductase bdhAB is knocked out from gluconobacter oxydans ATCC9937, 2,5-DKG transport proteins KgtpA and 2,5-DKG reductase dkgA are expressed in a heterologous manner, so that recombinant gluconobacter oxydans ZL 01-delta bdhAB-dkgA-KgtpA capable of directly synthesizing 2-KLG through glucose is obtained, the strain can be used for synthesizing 2-KLG through one-step fermentation by taking glucose as a substrate, and the strain has important significance for realizing industrial production of 2-keto-L-gulonic acid or vitamin C in the fields of cosmetics, textiles, foods and the like.

Description

Gluconobacter oxydans for synthesizing 2-keto-L-gulonic acid by one-step fermentation with glucose as substrate and application thereof

Technical Field

The invention relates to gluconobacter oxydans for synthesizing 2-keto-L-gulonic acid by one-step fermentation with glucose as a substrate and application thereof, belonging to the technical field of genetic engineering and biological engineering.

Background

Vitamin C, also known as L-ascorbic acid, is a water-soluble vitamin with strong reducibility and is one of the essential vitamins for human body. The global annual vitamin C demand is about 13-15 million tons, wherein 13 million tons are exported every year in China, and account for more than 80% of world energy production. The yield of vitamin C in China is about 20 million tons every year, which is higher than the global demand, so that the vitamin C industry faces a serious excess production problem. Therefore, how to further reduce the production cost of vitamin C is vital to vitamin production enterprises, and meanwhile, as other functions of vitamin C are continuously explored, the later-stage demand of vitamin C is bound to be further increased, so that as a large demand product of the national world, the further increase of the capacity of vitamin C plays an important role in economic promotion of related industries.

The main synthesis methods of vitamin C include a Lee's method and a two-step fermentation method. The Lei's method is the earliest method applied to the production of vitamin C, and has the advantages of mature process and higher product yield, but has the defects of complex production procedure, high labor intensity and serious environmental pollution caused by using a large amount of organic solvent in the production process. The two-step fermentation method is proposed by the scientist Yi Guanlin of China in the 70 th century, and the chemical synthesis step in the Lee's method is replaced by a microbial fermentation method. Firstly, converting glucose into sorbitol by a high-pressure hydrogenation mode, then converting the sorbitol into the sorbose by gluconobacter oxydans fermentation, converting the sorbose into the 2-keto-L-gulonic acid by mixed bacteria fermentation, and finally carrying out lactonization reaction to generate the vitamin C. In addition, there are also two-step fermentation process, one-step fermentation process and other technological processes. Glucose can be converted into 2, 5-diketo-D-gluconic acid by microorganisms of various genera including Erwinia, Rahnella, Serratia, Tatmum and Pantoea, and then 2, 5-diketo-D-gluconic acid is converted into 2-keto-L-gulonic acid by 2, 5-diketo-D-gluconic acid reductase derived from Corynebacterium. In 1982, Sonoyama, a Japanese Yanye pharmacy, fermented in series with a strain of Erwinia capable of producing 2, 5-diketo-D-gluconic acid and Corynebacteria, and realized the production of 2-keto-L-gulonic acid by a new two-step fermentation method without high-pressure hydrogenation of glucose. In 1985, 2, 5-diketo-D-gluconic acid reductase from corynebacteria is introduced into Erwinia capable of producing 2, 5-diketo-D-gluconic acid for the first time in Anderson laboratories in America, and an engineering bacterium is constructed to realize the direct production of 2-keto-L-gulonic acid from glucose by one-step fermentation. Similar engineering bacteria were constructed in Hardy of Switzerland in 1988, but the conversion rate of glucose to 2-keto-L-gulonic acid was low.

In order to solve the problems, the method aims to excavate and analyze the main speed-limiting link of the 2-keto-L-gulonic acid generated by one-step fermentation of glucose so as to construct a complete one-step synthesis path of the 2-keto-L-gulonic acid, and has potential guiding value and guiding significance for the development of synthetic biology and the improvement of vitamin industry.

Disclosure of Invention

The invention provides a recombinant gluconobacter oxydans, which is improved by at least one of the following improvements on the basis of an original strain:

(1) 2, 5-diketo-D-gluconic acid reductase derived from Gluconobacter oxydans (Gluconobacter oxydans) is overexpressed;

(2) expresses a gene which is derived from the Tatumella citricola and codes the 2, 5-diketone-D-gluconic acid transporter;

(3) the aldehyde ketone reductase gene bdhAB is knocked out or deleted; the nucleotide sequence of the bdhaB is shown in SEQ ID NO. 4.

In one embodiment, the amino acid sequence of the 2, 5-diketo-D-gluconate reductase is set forth in SEQ ID No. 1; the gene for coding the 2, 5-diketo-D-gluconic acid reductase comprises a nucleotide sequence shown in SEQ ID NO. 2.

In one embodiment, the amino acid sequence of the 2, 5-diketo-D-gluconic acid transporter is as set forth in Genbank accession no: WP _ 087487376.1; the nucleotide sequence of the kgtpA for coding the 2, 5-diketo-D-gluconic acid transporter is shown in SEQ ID NO. 3.

In one embodiment, the nucleotide sequence of the aldone reductase gene bdhAB is shown as SEQ ID No. 4.

In one embodiment, the recombinant gluconobacter oxydans expresses the 2,5-DKG reductase using a shuttle plasmid.

In one embodiment, the gene encoding the 2, 5-diketo-D-gluconate reductase is provided by promoter P₇Initiating transcription; the promoter P₇The nucleotide sequence of (A) is shown in SEQ ID NO. 5.

In one embodiment, the gene encoding the 2, 5-diketo-D-gluconate transporter is encoded by the promoter P₁₅Initiating transcription; the promoter P₁₅The nucleotide sequence of (A) is shown as SEQ ID NO. 6.

In one embodiment, the starting strain is gluconobacter oxydans having the ability to synthesize 2, 5-diketo-D-gluconic acid.

In one embodiment, the recombinant gluconobacter oxydans has gluconobacter oxydans ATCC9937 as the starting strain.

The invention also provides a method for producing 2-keto-L-gulonic acid by using the recombinant gluconobacter oxydans.

In one embodiment, the method uses glucose as a substrate and ferments to produce 2-keto-L-gulonic acid.

In one embodiment, the method comprises fermenting the recombinant gluconobacter oxydans in a glucose-containing medium at 28-30 ℃ for at least 96 hours.

In one embodiment, the method is to culture the recombinant gluconobacter in a sorbitol culture medium for a period of time to obtain a seed solution, and then transfer the seed solution to a fermentation culture medium for fermentation.

In one embodiment, fermentation is for 96-120 hours.

In one embodiment, the sorbitol medium contains 50g/L sorbitol and 10g/L yeast powder.

In one embodiment, each L of fermentation medium contains 20g/L glucose, 10g/L yeast powder, MgSO₄·7H₂O 0.25g/L。

The invention also claims the use of the recombinant gluconobacter oxydans or the method for the preparation of products containing 2-keto-L-gulonic acid.

The invention also claims the application of the recombinant gluconobacter oxydans or the method in the preparation of products containing vitamin C.

In one embodiment, the use is of the gluconobacter oxydans or the process for the production of 2-keto-L-gulonic acid, followed by lactonization of the 2-keto-L-gulonic acid to produce vitamin C or a vitamin C-containing product.

Has the advantages that:

(1) the invention deduces and excavates the transport protein necessary for synthesizing 2-keto-L-gulonic acid based on the main speed-limiting factor of synthesizing 2-keto-L-gulonic acid by glucose, clearly resolves the key speed-limiting link necessary for the path of generating 2-keto-L-gulonic acid by one-step fermentation of glucose, and screens related shuttle plasmids to express the key transport protein kgtpA;

(2) the invention constructs a recombinant plasmid pBBRMCS2-2,5DKGR overexpression 2,5-DKG reductase based on a synthetic approach of 2-keto-L-gulonic acid; deducing and excavating 2-keto-L-gulonic acid metabolism competition related enzyme based on a side reaction path of 2-keto-L-gulonic acid, knocking out competition gene bdhaB based on a SacB technology, successfully constructing a synthetic path of the 2-keto-L-gulonic acid in gluconobacter oxydans ATCC9937, realizing the one-step synthesis of the 2-keto-L-gulonic acid by taking glucose as a raw material, and fermenting to obtain a unit OD₆₀₀The yield of the 2-keto-L-gulonic acid can reach 0.53g/L、1.63g/L、2.15g/L。

Drawings

FIG. 1 is a diagram of the metabolic pathway for synthesizing 2-keto-L-gulonic acid and ascorbic acid in one step by using glucose as a substrate.

FIG. 2 is a SDS-PAGE pattern of 2,5-DKG reductase.

FIG. 3 is a graph showing the change in the concentration of 2,5-DKG and 2-KLG in the in vitro catalysis of 2,5-DKG reductase.

FIG. 4 is a prediction map of the transmembrane domain of KgtpA of the 2,5-DKG transporter.

FIG. 5 is a graph showing the effect of 2,5-DKG transport by a transporter.

FIG. 6 is a schematic diagram of the construction of recombinant plasmid pBBR1 MCS-2-dkgA-kgtpA.

FIG. 7 is a graph showing the results of the fermentation production of 2-keto-L-gulonic acid by different strains.

Detailed Description

(I) culture Medium

Sorbitol culture medium: 50g/L of sorbitol and 10g/L of yeast powder. When preparing the solid culture medium, 20g/L agar strips are added.

Glucose fermentation medium: glucose 20g/L, yeast powder 10g/L, MgSO₄·7H₂O 0.25g/L。

HPLC detection of (di) 2-keto-L-gulonic acid: the eluate was eluted using a column (250X 4.6mm, 5 μm, Aminex HPX-87H column (Bio-Rad, CA., USA) with a mobile phase of 50mm/L dilute sulfuric acid at a flow rate of 0.5mL/min using a differential refractometer detector.

(III) a gluconobacter oxydans transformation method: about 100ng of successfully constructed plasmid was added to 100. mu.L of G.oxydans ATCC9937 competent cells, mixed well, iced on ice for about 10min, added to a 1mm cuvette, and subjected to electroporation at 1800V, 25. mu.F, 200. omega. Immediately after the electric shock is finished, 1mL of sorbitol liquid seed culture medium is added into the electric shock cup, and the mixture is uniformly mixed and then is completely transferred into a 14mL shake culture tube to be cultured for 6 h. After the culture is finished, the cells are centrifuged, and about 100 mu L of the culture medium is reserved to mix the cells evenly and spread the cells on corresponding resistant plates. Inverted culturing at 30 ℃ for about 20h, and picking out a single colony for colony PCR verification.

(IV) Gibson Assembly method: the reaction system was as follows, 50ng of DNA fragment was added, 100ng of vector was added, 5ul of Gibson mix was added, and 10ul of sterile ultrapure water was added to the system. The reaction was carried out at 50 ℃ for 60min under the following conditions, and immediately after completion of the reaction, the reaction mixture was placed on ice. 10ul of the strain was transformed into E.coli competent JM 109.

(V) Gluconobacter oxydans gene knockout means: the g.oxydans ATCC9937 genome was edited based on the SacB system. Specific methods are described in Qin Z, Yu S, Liu L, et al.A SacB-based system for direct and multiplex genome editing in Gluconobacter oxydans [ J ]. Journal of Biotechnology,2021.

(VI) 2 Xhigh fidelity PCR Mix premix was purchased from Biotechnology, Inc.

Example 1: gluconobacter oxydans ATCC9937 endogenous 2,5-DKG reductase catalytic ability verification

Using gluconobacter oxydans ATCC9937 genome as a template, designing a primer pair dkgA-F1/dkgA-R1, carrying out PCR amplification by using the primer pair, and carrying out 2X high-fidelity PCR Mix premix for 5min under the condition of pre-denaturation 95 ℃; the amplification stage is performed for 30 cycles at 95 ℃, 15s, 57 ℃, 15s, 72 ℃ and 30 s; extending for 5min at 72 ℃, and purifying the PCR product to obtain a fragment dkgA shown in SEQ ID NO. 2; the product was PCR amplified with primers to Duet-F/Duet-R using vector pCDFDuet as template and purified. Recombining the fragment dkgA and the vector pCDFDuet by a Gibson assembly method to obtain a recombinant vector, transforming the recombinant vector into Escherichia coli JM109, extracting a plasmid and performing sequencing verification to obtain the correct recombinant vector pCDFDuet-dkgA. The correctly verified recombinant plasmid was transformed into E.coli BL21(DE3) to obtain recombinant strain BL 21-dkgA.

The recombinant strain BL21-dkgA was transferred to 10ml LB containing 50mg/L kanamycin sulfate and cultured overnight to prepare a seed solution. Transferring the cultured seed solution into 50ml TB culture medium containing 50mg/L kanamycin sulfate at 2% until the thallus concentration reaches OD₆₀₀When the temperature is reduced to 20 ℃ at 0.8 ℃, IPTG is added to a final concentration of 0.5mM for induction to express 2,5-DKG reductase, and cells are collected for 16-20 hours of induction. And (4) centrifuging the expressed fermentation liquor at 4000rpm for 10min, discarding supernatant, and collecting thalli. The mycelia were treated with PBS bufferResuspending, the resuspension ratio is 1g of wet thallus: 5mL PBS buffer (OD of bacterial suspension 15). The cells were disrupted by a homogenizer, and the disrupted solution was centrifuged at 12000rpm for 1 hour. Supernatants were collected, assayed for enzyme activity and analyzed by SDS-PAGE (FIG. 2). The result shows that the specific enzyme activity is 1673U/mg.

At room temperature, 50. mu.L of the cell disruption solution was added to 450. mu.L of 25mmol/L Tris-HCl buffer (pH6.0), 50. mu.L of 5mmol/L NADPH solution and 50. mu.L of 2, 5-DKG-containing solution were further added, and the change in the concentration of 2,5-DKG and 2-KLG in the system was measured, as shown in FIG. 3, and 2,5-DKG was completely converted to 2-KLG in a reaction time of 35min, and the concentration of 2-KLG obtained after the measurement was 1.0715 g/L.

Primers used in Table 1

Primer and method for producing the same	The sequence 5 '-3' (the underlined part is the homology arm region)
		dkgA-F1	CTTTAATAAGGAGATATACCATGTCGTCACAGGTTCCATCCG
dkgA-R1	CTTTCTGTTCGACTTAAGCATCAGAATTTCGCCGTATTCGGATCA
		Duet-F	TGCTTAAGTCGAACAGAAAGTAATCGT
Duet-R	GGTATATCTCCTTATTAAAGTTAAACAAAATTATTTCTACAGGGG

Example 2: verification of transport effect of transport protein KgtpA

The transmembrane domain of the KgtpA sequence was predicted using online software, and the prediction results are shown in FIG. 4. Taking a synthesized 2, 5-diketone-D-gluconic acid transporter gene kgtpA from the Tatumella citrea shown in SEQ ID NO.3 as a template, designing a primer pair kgtpA-F1/kgtpA-R1, carrying out PCR amplification by using the primer pair, and carrying out pre-denaturation by using 2 XHi-Fi PCR Mix premix for 5min under the condition of 95 ℃; the amplification stage is performed for 30 cycles at 95 ℃, 15s, 57 ℃, 15s, 72 ℃ and 30 s; extending for 5min at 72 ℃, and purifying the PCR product to obtain a fragment kgtpA; the vector pCOLADuet is used as a template, PCR amplification is carried out on pCOLA-F/pCOLA-R by using primers, and the product is purified. Recombining the fragment kgtpA and the vector pCOLADuet by a Gibson assembly method to obtain a recombinant vector, transforming the recombinant vector into Escherichia coli JM109, extracting a plasmid, and performing sequencing verification to obtain the correct recombinant vector pCOLADuet-kgtpA. The recombinant plasmid with correct verification is transformed into escherichia coli BL21(DE3) to obtain a recombinant strain BL 21-kgtpA.

The recombinant strain BL21-kgtpA was transferred to 10ml LB containing 50mg/L kanamycin sulfate and cultured overnight to prepare a seed solution. Transferring the cultured seed solution into 50ml TB culture medium containing 50mg/L kanamycin sulfate at 2% until the thallus concentration reaches OD₆₀₀At 0.8, the temperature was decreased to 20 ℃ and induced by adding IPTG to a final concentration of 0.5mM to express the 2,5-DKG transporter kgtpA. After 20h of induction, 2,5-DKG solution is added into the culture medium, so that the final concentration of 2,5-DKG in the culture medium is 3g/L, the culture is continued for 12h at 20 ℃, and the change of the concentration of 2,5-DKG in the culture medium is detected, so that the result is shown in figure 5, WT is a control group which does not express the transport protein, after the 2,5-DKG is added, the reduction of the 2,5-DKG in the control group is 0.51g/L, while the content of the 2,5-DKG in the fermentation liquor after the transport protein is expressed is reduced by about 0.91g/L, and the transport capacity is increased by 78.4%.

Primers used in Table 2

Example 3: knockout of bdhAB in Gluconobacter oxydans ATCC9937 genome based on SacB technology

Using gluconobacter oxydans ATCC9937 genome as a template, designing a primer pair bdhaB-up-F/bdhaB-up-R to knock out a bdhaB gene shown as SEQ ID NO.4, carrying out PCR amplification by using the primer pair, and carrying out 2 Xhigh fidelity PCR Mix premix for 5min under the condition of pre-denaturation 95 ℃; the amplification stage is performed for 30 cycles at 95 ℃, 15s, 57 ℃, 15s, 72 ℃ and 30 s; extending for 5min at 72 ℃, and purifying the PCR product to obtain a fragment bdhAB upstream homology arm; using gluconobacter oxydans ATCC9937 genome as a template, designing a primer pair bdhaB-down-F/bdhaB-down-R, carrying out PCR amplification by using the primer pair, and carrying out 2 Xhigh fidelity PCR Mix premix for 5min under the condition of pre-denaturation 95 ℃; the amplification stage is carried out for 30 cycles at 95 ℃, 15s, 57 ℃, 15s, 72 ℃ and 30 s; and (5) extending the temperature of 72 ℃ for 5min, and purifying the PCR product to obtain a downstream homology arm of the bdhAB fragment. And (3) performing PCR amplification on pK-F/pK-R by using the vector pK18mobsacb as a template and purifying a product. Recombining the upstream homology arm of the bdhaB fragment, the downstream homology arm of the bdhaB fragment and the vector pK18mobsacb by a Gibson assembly method to obtain a recombinant vector, transforming the recombinant vector into Escherichia coli JM109, extracting a plasmid and carrying out sequencing verification to obtain a correct knockout vector pK 18-bdhaB.

The gluconobacter oxydans ATCC9937 was transformed with pK18-bdhAB knock-out vector using electrotransformation, the electrotransformed strain was immediately added to a pre-cooled liquid sorbitol medium and thawed at 30 ℃ and 220rpm for 4 hours to cause the first homologous recombination. Thereafter, it was spread on a kanamycin-resistant solid sorbitol medium and cultured at 30 ℃. After 2 days, colonies were picked and inoculated into liquid sorbitol medium without resistance and cultured overnight for a second homologous recombination. Then, 50. mu.L of the bacterial suspension was applied to a solid sorbitol medium containing 10% sucrose and cultured at 30 ℃. After 2 days, colonies were picked for colony PCR and sequenced to verify the mutant strains. After the verification, the recombinant strain ZL 01-delta bdhAB is obtained.

Primers used in Table 3

Primer and method for producing the same	The sequence 5 '-3' (homology arm region is underlined)
		bdhAB-up-F	ATTCGAGCTCGGTACCCGGGCAAAGCGCGTTTTCGCGTTG
bdhAB-up-R	TGTGATTAATATTTAGGCAGATCCATCAGGCTCCTTCTTGCT
		bdhAB-down-F	CTGCCTAAATATTAATCACAGGCCGC
bdhAB-down-F	CCTGCAGGTCGACTCTAGAGGGGCTTGATGAGGTTAGACGCAT
		pK-F	CCCGGGTACCGAGCTCGAATTC
pK-R	CTCTAGAGTCGACCTGCAGGCAT

Example 4: gluconobacter oxydans ATCC9937 expression vector construction

Using gluconobacter oxydans ATCC9937 genome as a template, designing a primer pair dkgA-F2/dkgA-R2, carrying out PCR amplification on the dkgA gene shown in SEQ ID NO.2 by using the primer pair, and carrying out 2 Xhigh fidelity PCR Mix premix for 5min under the condition of pre-denaturation 95 ℃; the amplification stage is carried out for 30 cycles at 95 ℃, 15s, 57 ℃, 15s, 72 ℃ and 30 s; extending the temperature of 72 ℃ for 5min, and purifying the PCR product to obtain a fragment dkgA; taking a gluconobacter oxydans ATCC9937 genome as a template, designing a primer pair P7-F/P7-R, carrying out PCR amplification by using the primer pair, and carrying out 2 Xhigh-fidelity PCR Mix premixed solution under the conditions of pre-denaturation at 95 ℃ and 5 min; the amplification stage is performed for 30 cycles at 95 ℃, 15s, 57 ℃, 15s, 72 ℃, 10 s; extending the temperature for 5min at 72 ℃, and purifying the PCR product to obtain a promoter fragment P7 with the nucleotide sequence shown as SEQ ID NO. 5. The promoter P7 fragment was ligated to dkgA using fusion PCR amplification of primer pair P7-F/dkgA-R2. PCR amplification is carried out on pBBR-F/pBBR-R by using a primer pair with a vector pBBR1MCS-2 as a template, and a product is purified. Recombining the fragment P7-dkgA vector pBBR1MCS-2 by a Gibson assembly method to obtain a recombinant vector, transforming the recombinant vector into escherichia coli JM109, extracting a plasmid and performing sequencing verification to obtain a correct knockout vector pBBR1 MCS-2-dkgA.

Taking a synthetic sequence kgtpA shown as SEQ ID NO.4 as a template, designing a primer pair kgtpA-F2/kgtpA-R2, carrying out PCR amplification by using the primer pair, and carrying out 2 Xhigh-fidelity PCR Mix premix for 5min under the conditions of pre-denaturation 95 ℃; the amplification stage is performed for 30 cycles at 95 ℃, 15s, 57 ℃, 15s, 72 ℃ and 30 s; extending for 5min at 72 ℃, and purifying the PCR product to obtain a fragment kgtpA; using gluconobacter oxydans ATCC9937 genome as a template, designing a primer pair P15-F/P15-R, carrying out PCR amplification by using the primer pair, and carrying out 2 Xhigh fidelity PCR Mix premix under the conditions of pre-denaturation at 95 ℃ and 5 min; the amplification stage is performed for 30 cycles at 95 ℃, 15s, 57 ℃, 15s, 72 ℃, 10 s; and (3) extending the temperature of 72 ℃ for 5min, and purifying the PCR product to obtain a promoter fragment P15 (the nucleotide sequence is shown as SEQ ID NO. 6). The promoter P15 fragment was ligated to kgtpA using fusion PCR amplification of primer pair P15-F/kgtpA-R2. PCR amplification was performed using the vector pBBR1MCS-2-dkgA as a template and the primer set pBBR-F2/pBBR-R2, and the product was purified. The fragment P15-kgpA and the vector pBBR1MCS-2-dkgA are recombined to obtain a recombinant vector by a Gibson assembly method, the recombinant vector is transformed into Escherichia coli JM109, and plasmids are extracted and sequenced to verify to obtain the correct recombinant vector pBBR1 MCS-2-dkgA-kgpA (shown in figure 6).

Primers used in Table 4

Example 5: recombinant strain is used for producing 2-KLG by one-step fermentation with glucose as substrate

The pBBR1MCS-2-dkgA and pBBR1 MCS-2-dkgA-kgpA recombinant plasmids with correct sequencing verification are transferred into the recombinant strain ZL 01-delta bdhAB constructed in the example 3 in an electrotransformation mode respectively, and the electrotransformed strain is immediately added with a precooled liquid sorbitol culture medium and is revived at 30 ℃ and 220rpm for 4 hours and then is spread on a solid sorbitol culture medium containing kanamycin resistance. After culturing for 48h at 30 ℃, single colony is picked, and colony pcr verification is carried out on pBBR-F3/pBBR-R3 by designing primer. The correct strains were verified to be ZL01- Δ bdhAB-dkgA, ZL01- Δ bdhAB-dkgA-KgtpA, respectively. The seed solutions were obtained by transferring ZL01- Δ bdhAB-dkgA and ZL01- Δ bdhAB-dkgA-KgtpA to liquid sorbitol medium containing kanamycin resistance, respectively, and culturing the medium at 30 ℃ for 24 hours. The seed liquid is transferred into a glucose fermentation culture medium (the recombinant bacteria containing the plasmid needs to be added with kanamycin resistance) according to the inoculation amount of 10 percent, the 2-KLG yield is compared after the seed liquid is cultured for 120 hours at the temperature of 30 ℃ (the result is shown in figure 7), and gluconobacter oxydans ATCC9937, ZL 01-delta bdhAB are used as controls. The results show that the original strains, namely gluconobacter oxydans ATCC9937, the recombinant strains ZL 01-delta bdhAB, ZL 01-delta bdhAB-dkgA and ZL 01-delta bdhAB-dkgA-KgtpA unit OD₆₀₀Yield (total yield divided by fermentation OD)₆₀₀Values) were 0, 0.53g/L, 1.63g/L, 2.15g/L, respectively.

Primers used in Table 5

Primer and method for producing the same	The sequence 5 '-3' (the underlined part is the homology arm region)
		pBBR-F3	CGTTGTAAAACGACGGCCAGTG
pBBR-R3	TACACTTTATGCTTCCGGCTCGT

Comparative example:

the specific implementation scheme is shown in example 4, except that plasmids pBBR1MCS-2, p13-Kana and p2-Kana are replaced by p13-Kana or p2-Kana plasmids as expression vectors respectively, and are disclosed in the article "2-keto-L-gulonic acid synthesized by Gluconobacter oxydans dehydrogenase system". The results show that the recombinant bacteria constructed by using the p13-Kana or p2-Kana plasmid as an expression vector can not grow in a culture medium using glucose as a carbon source.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by one skilled in the art without departing from the spirit and scope of the invention as defined by the appended claims.

SEQUENCE LISTING

<110> university in south of the Yangtze river

<120> gluconobacter oxydans for synthesizing 2-keto-L-gulonic acid by one-step fermentation with glucose as substrate and

applications of

<130> BAA220416A

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 279

<212> PRT

<213> Gluconobacter oxydans

<400> 1

Met Ser Ser Gln Val Pro Ser Ala Glu Ala Gln Thr Val Ile Ser Phe

1 5 10 15

His Asp Gly His Thr Met Pro Gln Ile Gly Leu Gly Val Trp Glu Thr

20 25 30

Pro Pro Asp Glu Thr Ala Glu Val Val Lys Glu Ala Val Lys Leu Gly

35 40 45

Tyr Arg Ser Val Asp Thr Ala Arg Leu Tyr Lys Asn Glu Glu Gly Val

50 55 60

Gly Lys Gly Leu Glu Asp His Pro Glu Ile Phe Leu Thr Thr Lys Leu

65 70 75 80

Trp Asn Asp Glu Gln Gly Tyr Asp Ser Thr Leu Arg Ala Tyr Glu Glu

85 90 95

Ser Ala Arg Leu Leu Arg Arg Pro Val Leu Asp Leu Tyr Leu Ile His

100 105 110

Trp Pro Met Pro Ala Gln Gly Gln Tyr Val Glu Thr Trp Lys Ala Leu

115 120 125

Val Glu Leu Lys Lys Ser Gly Arg Val Lys Ser Ile Gly Val Ser Asn

130 135 140

Phe Glu Ser Glu His Leu Glu Arg Ile Met Asp Ala Thr Gly Val Val

145 150 155 160

Pro Val Val Asn Gln Ile Glu Leu His Pro Asp Phe Gln Gln Arg Ala

165 170 175

Leu Arg Glu Phe His Glu Lys His Asn Ile Arg Thr Glu Ser Trp Arg

180 185 190

Pro Leu Gly Lys Gly Arg Val Leu Ser Asp Glu Arg Ile Gly Lys Ile

195 200 205

Ala Glu Lys His Ser Arg Thr Pro Ala Gln Val Val Ile Arg Trp His

210 215 220

Leu Gln Asn Gly Leu Ile Val Ile Pro Lys Ser Val Asn Pro Lys Arg

225 230 235 240

Leu Ala Glu Asn Leu Asp Val Phe Gly Phe Val Leu Asp Ala Asp Asp

245 250 255

Met Gln Ala Ile Glu Gln Met Asp Arg Lys Asp Gly Arg Met Gly Ala

260 265 270

Asp Pro Asn Thr Ala Lys Phe

275

<210> 2

<211> 1308

<212> DNA

<213> Gluconobacter oxydans

<400> 2

tttggcatca tgaatacgtg gggtgaaatt ctgctgccgt gcctctgccg ggcgcagatc 60

acactgcgct ggcagtaatg ccgcaataat cccggcaatg atcagagagc ctgccagagt 120

gacaacggct gcattctgcc cgtacaggta gatcattaat ccgaccaacc aggggccaca 180

gaaaccgccc agattcccta gtccgttaat tacaccacgg gcactaccgg ctgcctccgg 240

cggtgcaata cgtcccggaa tactccagaa cgggctggtg gctgctttca ggaaaaagcc 300

gcaagccacc agagccagat aagcagccac cacaaattca cgtagcagga ctgaggccaa 360

cagacaggcc gcaaaacaga acagagaaat catcacccat tgccgacgtt tgccggtttt 420

atcgctcagg taagagacga cataaatccc tgataacgtc gcgataaaag gtagcactgt 480

cagcaaaccg acgttaccaa tactggctcc ggtcaggttt tttataatag tcggcagcca 540

cagagtgtat ccgtaatcac ctgtctgata gaaaaagttc agaatcacta acttcatcag 600

gcccgggtta tggaaaacct cttgcagggg agcatgactg atcggaggga gtttgctccg 660

ctcggccttg tcacgggcca tttcgcgcag cagatattcc cgttctgctg ccggcagcca 720

acgggcatct tcagggcggt cactgaccat cagccaccag actgccagaa ccactaccga 780

cagtaatcct tcgataataa ataaccagcg ccagtctagc agtgcaataa tccatccgga 840

gacaggggcg gtaatcattc cgccaagcgg ggcgaacatc atgacaaatg cattagcacg 900

ccccagctct ttttcaggaa accagttgct gaccattgtc agaactaccg gcaacatccc 960

accttcagag acccccagtg caaaacgtaa aatcaacagc tggtactgat gagtcacaaa 1020

cccggtagcg accgaaacta cggcccaggc aacaagcgac caggcaataa agcgtttacc 1080

actgccacgt actgcgatat gcccaccagg aacctgcaaa aacagataac caataaagaa 1140

aataccgcta actaccccgg ccatctggct ggacatcagc agatcctgct ccataccgcc 1200

cggcaatgcg aaactgatat ttacccgatc cataaacgac atgatgcagg ctatcaggat 1260

cggcacaata atccgaaacc agcgggttcc cggctgtgat ttttgcat 1308

<210> 3

<211> 840

<212> DNA

<213> Artificial sequence

<400> 3

atgtcgtcac aggttccatc cgccgaagcc cagaccgtga tttcctttca tgacggtcac 60

accatgcccc agatcgggct gggtgtgtgg gaaacgccgc cggatgagac ggccgaggtc 120

gtgaaggaag ccgtgaagct cggttaccgg tctgtcgata cggcgcgtct gtacaagaac 180

gaggaaggtg tcggcaaagg tctggaagac catccggaaa tcttcctgac gaccaagctc 240

tggaatgacg agcagggcta tgacagcacc ctgcgggcgt atgaagaaag cgcgcgcctg 300

ctgcgtcgtc cggtgctgga cctgtatctg atccactggc cgatgccggc tcaggggcag 360

tatgtcgaga cgtggaaggc actcgtcgag ctgaagaaat ccggtcgtgt gaagtccatc 420

ggcgtgtcca atttcgagtc ggagcatctg gagcggatca tggatgccac gggtgtcgtg 480

ccggtcgtca accagatcga gctgcatccc gatttccagc agcgcgccct gcgggaattc 540

cacgagaagc acaacatccg caccgagtcc tggcgcccgc tgggcaaggg gcgcgtcctg 600

agcgatgagc ggatcgggaa gatcgctgaa aagcacagcc ggactccggc gcaggtcgtg 660

atccgctggc atcttcagaa tggactgatc gtcattccga aatcggtcaa tcccaagcgt 720

ctggctgaaa atctggatgt gttcggcttc gtgctggatg cggatgacat gcaggccatc 780

gaacagatgg accgcaagga tggccggatg ggcgctgatc cgaatacggc gaaattctga 840

<210> 4

<211> 1080

<212> DNA

<213> Gluconobacter oxydans

<400> 4

atgcagtatc gtcagcttgg tcgctcgggc ctcaagattt cagcactcaa tttcggatcg 60

gtgacgttcg gcggacaggg caattttgcc gccacgggta aggtggacat cgccgaagcg 120

acgcgcatgg tggacatctg cgtcgagcac ggcgtgaaca tgttcgatac ggccgatgcc 180

tattccggcg gtgaagccga ggaaattctc ggccgcgtcc ttcaggggcg cagccgcgaa 240

ctgctcgtca ccagcaaggt gcgtttccca accggaaaag ggccgaacga acagggtctg 300

tcgcgtcacc atatcctcaa tgcctgcgac gacagtctgc gtcgcctggg gcgcgatcac 360

atcgatctct attatctgca tgaatgggat ggtctgacgc cggtcgagga gacgcttgag 420

gcgctccaga ccctgcgcga tcagggcaag atccgctatg cggggatttc caattttgcg 480

ggctggcagg ccatgaaact gctgggcgcc gccgagcggg accgtctgat cgcgccggtc 540

agtcagcagc tttattactc gctggaagcc cgcgacgccg aatatgaact gctgccgctc 600

gccgtcgatc agggattggg cgtgcaggtc tggagtccgc tcgcctgtgg gttgctgacg 660

gacaaatacc ggcgcggcaa gacggcgccg gaagattccc gccgcatttc cggctggcct 720

gagccggaag tccgggatct gaagaagctc tacgatacgg ttgaggttct ggtgcagatc 780

gccgaagagc acagcgtttc cgctgcccgt gtggcactgg cctggacgct gcacaagccg 840

gcgatcacgt cactggttct gggcgcacgc caggaaagcc agcttctgga taatctggcg 900

gccgcgtcgc tccgtctgac gcaggaacag gttcgccggc ttgacgatgt cagcgctccg 960

gatctcatct atccgtactg gcatcagaac cggaatgcct ttgatcgtct ctccaaggcg 1020

gatcttgttt tgcagggacc ggcaaaacgt catcgggagg cccttgaaac gaaaaaatga 1080

<210> 5

<211> 310

<212> DNA

<213> Artificial sequence

<400> 5

cacgatcgtc ggcaaagtga tcgaaggcat ggaatacgtg gaccagatca agcgcggttc 60

gggcgcaggt ggcgtggtca aggaccctga caccattctc aaggcttatg tcgaagcctg 120

agtcccgctg aaaagcagga acgcggaaag gccggtgcag gaatgcaccg gcctttttta 180

ttgccttttc ccggacaagc gcatcatatc cccattcata agcggcgctt atgaaaagat 240

agaaacataa gatttcactc tcctttttca gaatcgtatg gtcgtcacga tcagaaaagg 300

aagaataaca 310

<210> 6

<211> 310

<212> DNA

<213> Artificial sequence

<400> 6

ttaaaattcc gtcacatggc agctaaatgc ctgttttgct tccatttttg catagctgat 60

ttcttctccc gcctctggct tctgctggaa ccatgagcta aagcaacgta gacgcgaggc 120

gtagatcgtg aagcgggcga aatggactgt ggcttttatg tcactcccct accccgagta 180

gagcctgaag accctgactg gctttgtctc ggggaactct gcgttctata tgcgcttatg 240

catcgcgctg ggtccgttgg tgaaagcatt ttccaacggc tcgaacgtta gtcactaaga 300

ggacgaaaac 310

Claims

1. The recombinant gluconobacter oxydans is characterized in that 2-keto-L-gulonic acid can be synthesized by one-step fermentation with glucose as a substrate; on the basis of an original strain, the recombinant gluconobacter oxydans knocks out or deletes an aldone reductase gene bdhAB, and at least one of the following improvements is carried out:

(1) overexpresses 2, 5-diketo-D-gluconate reductase derived from Gluconobacter oxydans (Gluconobacter oxydans);

(2) expresses 2, 5-diketo-D-gluconic acid transporter from the bacteria of the genus Tatumella (Tatumella citrifolia).

2. The recombinant gluconobacter oxydans according to claim 1 wherein the 2, 5-diketo-D-gluconate reductase is expressed using a shuttle plasmid.

3. The recombinant gluconobacter oxydans according to claim 1 or 2 wherein said 2, 5-diketo-D-gluconic acidThe gene coding for the reductase is encoded by the promoter P₇Transcription is initiated.

4. The recombinant gluconobacter oxydans according to any of claims 1 to 3 wherein the gene encoding the 2, 5-diketo-D-gluconate transporter is encoded by the promoter P₁₅Transcription is initiated.

5. The recombinant gluconobacter oxydans according to any one of claims 1 to 4 wherein the starting strain has the ability to synthesize 2, 5-diketo-D-gluconic acid.

6. A method for improving the yield of 2-keto-L-gulonic acid of gluconobacter oxydans is characterized by overexpressing 2, 5-diketo-D-gluconic acid reductase derived from gluconobacter oxydans, expressing 2, 5-diketo-D-gluconic acid transporter derived from Tatarim citreum and knocking out aldone reductase gene bdhAB.

7. The method for producing 2-keto-L-gulonic acid by using the recombinant gluconobacter oxydans as claimed in any one of claims 1 to 6, characterized in that glucose is used as a substrate and fermentation is carried out at 28 to 30 ℃ for at least 96 hours.

8. The method of claim 7, wherein the recombinant gluconobacter oxydans is cultured in a sorbitol-containing medium for a period of time to obtain a seed solution, and the seed solution is transferred to a fermentation medium for fermentation.

9. The method according to claim 7 or 8, wherein the medium for fermentation contains glucose, yeast powder and MgSO₄。

10. Use of the recombinant gluconobacter oxydans according to any one of claims 1 to 6 or the method according to any one of claims 7 to 9 for the preparation of a product containing 2-keto-L-gulonic acid or vitamin C.