CN116445514A - High-yield L-cysteine gene engineering bacterium based on cysB mutant and application thereof - Google Patents

High-yield L-cysteine gene engineering bacterium based on cysB mutant and application thereof Download PDF

Info

Publication number
CN116445514A
CN116445514A CN202310059265.8A CN202310059265A CN116445514A CN 116445514 A CN116445514 A CN 116445514A CN 202310059265 A CN202310059265 A CN 202310059265A CN 116445514 A CN116445514 A CN 116445514A
Authority
CN
China
Prior art keywords
cysb
yhao
cysteine
mutant
strain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310059265.8A
Other languages
Chinese (zh)
Inventor
柳志强
李世蓉
张博
潘佳园
郑裕国
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang University of Technology ZJUT
Original Assignee
Zhejiang University of Technology ZJUT
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang University of Technology ZJUT filed Critical Zhejiang University of Technology ZJUT
Priority to CN202310059265.8A priority Critical patent/CN116445514A/en
Publication of CN116445514A publication Critical patent/CN116445514A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245—Escherichia (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/12—Methionine; Cysteine; Cystine

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention relates to a cysB mutant, a genetically engineered bacterium with high yield of L-cysteine constructed based on the cysB mutant, and application of the genetically engineered bacterium in microbial fermentation preparation of L-cysteine. According to the invention, the sulfate binding pocket of CysB is randomly mutated, and meanwhile, a high-throughput screening is carried out through a constructed fluorescence reporting system, so that a CysB mutant with better sulfur source binding capacity is screened, and a genetically engineered bacterium which can produce L-cysteine with better expression strength and better performance for the CysB is constructed based on the mutant, so that the growth efficiency of the genetically engineered bacterium in unit time is improved by 32.7% compared with that of a starting strain, and finally the titer of the L-cysteine is improved by 3.3%.

Description

High-yield L-cysteine gene engineering bacterium based on cysB mutant and application thereof
Field of the art
The invention relates to a cysB mutant, a genetically engineered bacterium with high yield of L-cysteine constructed based on the cysB mutant, and application of the genetically engineered bacterium in microbial fermentation preparation of L-cysteine.
(II) background art
In E.coli, the expression of sulfate transporter, sulfate reducing enzyme and cysteine synthesizing enzyme is controlled by transcription regulating factor cysB, which CysB protein is used as molecular sensor for sulfate metabolism and cysteine biosynthesis to monitor the intracellular level of metabolic intermediate continuously. The transcription regulating factor cysB belongs to LysR type transcription regulating factors (LTTRs), has a molecular weight of 36kDa, is a DNA binding protein for positively regulating and controlling the transcription of target genes, and simultaneously inhibits the expression of the target genes.
CysB regulatory proteins generally function in dimeric or tetrameric forms. Wherein the LBD (i.e., ligand binding domain) consists of about 70 amino acids and the DBD (i.e., DNA binding domain) consists of about 228 amino acids, which are joined by a flexible linker. Therein, LBD comprises two RD domains (RDI and RDI) connected by two small polypeptide fragments, as shown by the crystal structure of CysB in Salmonella typhimurium. Wherein RDI (i.e., site-1) specifically binds to both sulfide and NAS, RDII (i.e., site-2) specifically binds to NAS and OAS, and OAS alters the structure of site-1 through binding to site-2, but mutation of site-1 has no effect on site-2 mediated OAS activation.
In the production of L-cysteine by microbial fermentation of E.coli, the utilization rate of sulfur source is not improved all the time, so that it is desired to enhance assimilation with sulfide to some extent by structural change of CysB. However, the existing biological method for producing L-cysteine has defects, such as low utilization rate of sulfur in the production process, slow growth rate and the like. Thus, it remains a challenge to construct a higher yielding and stable strain of L-cysteine.
(III) summary of the invention
The invention aims to provide a cysB mutant, a genetically engineered bacterium with high yield of L-cysteine constructed based on the cysB mutant, and application of the genetically engineered bacterium in microbial fermentation preparation of L-cysteine.
The technical scheme adopted by the invention is as follows:
a cysB mutant has a nucleotide sequence shown in SEQ ID No. 10.
The invention also relates to application of the cysB mutant in constructing genetic engineering bacteria for high-yield L-cysteine.
The invention also relates to a genetically engineered bacterium for high-yield L-cysteine constructed based on cysB mutant, which is constructed by the following method: mutation of the sulfate binding pocket of the transcription factor cysB is regulated to obtain a mutant cysB having a nucleotide sequence shown as SEQ ID No.10 Q128L Over-expression of the strain in Chaetomium EYC:DKSAC-1 to obtain EYC:DKSAC-1/pEB Q128L Namely the genetically engineered bacterium for producing the L-cysteine at high yield.
Specifically, the genetically engineered bacterium is constructed and obtained according to the following method: constructing a fluorescence reporting system, randomly mutating a sulfate binding pocket of a transcription regulatory factor CysB, then screening with high flux, screening CysB mutation points with good effect according to fluorescence intensity, and using a gene editing technology to make the CysB mutation points in Chassis bacteria E.colli W3110: 3110 EYC:P by using medium-high copy plasmids pTrc99a-pEB yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO Overexpression in apFAB689-tolC/pE (i.e., EYC: DKSAC-1, described in 202211335028.1) gives EYC: DKSAC-1/pEB Q128L Namely the genetically engineered bacterium for producing the L-cysteine at high yield.
The invention constructs an L-cysteine production strain with better performance by means of metabolic engineering transformation, enzyme transformation, biosensor optimization and the like based on DKSAC-1 which is constructed in the early laboratory and is free of plasmids and inducer.
CysB is taken as a transcription regulating factor, is combined with a DNA promoter region in a tetramer form under natural conditions, and performs activation/inhibition after combination, and currently known genes cysK, cysPUWA, cysM, cysJIH and the like are CysB forward activation genes, and the CysB can inhibit the expression of genes, so that the system is sensitive to the expression intensity of the cysB by constructing a fluorescence reporting system and connecting the promoter region of the activation genes with eGFP fluorescence expression proteins, and the change of the expression intensity of the CysB is directly reflected by the expression intensity of the fluorescence intensity. According to the invention, error-prone PCR is carried out on the first pocket of CysB, the pocket can be combined with sulfate molecules and NAS, so that the uptake efficiency of sulfur sources in the L-cysteine synthesis pathway can be directly influenced.
According to the invention, a CysB mutant library is constructed by utilizing 96 deep-hole plate screening, 3 mutants are firstly selected according to the expression intensity of fluorescence intensity, gene sequencing is carried out on the mutant, then the mutant with better fluorescence intensity expression is further selected through shaking fermentation, and finally the mutant is integrated with a production strain, so that the titer of L-cysteine is improved by 3.3%, and the growth efficiency of the genetically engineered bacterium in unit time is improved by 32.7%.
The construction method of the genetic engineering strain is specifically as follows:
mutation of cysB in EYC:DKSAC-1 by gene editing technique gave EYC:DKSAC-B1 strain, while cysB was introduced Q128L Ligating to pE plasmid to obtain pEB Q128L Plasmid, which was then overexpressed in Chassis strain EYC:: DKSAC-B1, gave EYC:: DKSAC-B1/pEB Q128L Namely the genetically engineered bacterium based on cysB mutant high-yield L-cysteine.
The invention also relates to application of the genetically engineered bacterium in microbial fermentation preparation of L-cysteine.
Specifically, the application is as follows: inoculating the genetically engineered strain into a fermentation culture medium containing Amp resistance, fermenting and culturing at 25-30 ℃ and 100-200 rpm until the OD600 = 0.8-1.0, adding IPTG with the final concentration of 0.1mM, then transferring to 30 ℃ and continuously culturing at 150-200rpm for 48 hours, and taking a fermentation liquor supernatant after fermentation is finished, and separating and purifying to obtain the L-cysteine.
The shake flask fermentation medium comprises the following components: glucose 30-50g/L, (NH) 4 ) 2 SO 4 5-20g/L, yeast extract 3-10g/L, peptone 1-5g/L, KH 2 PO 4 0.5-5g/L，Na 2 HPO 4 0.5-5g/L，Na 2 S 2 O 3 5-15g/L, trace element solution 0.5-2mL/L, deionized water as solvent, and natural pH. Separately weigh 0.01g/mL CaCO 3 Subpackaging in shake flasks to adjust pH.
The microelement solution comprises the following components: mnSO 4 ·8H 2 O 2-10g/L，MgSO 4 ·7H 2 O 300-700g/L，FeSO 4 ·7H 2 O 2-15g/L，ZnSO 4 2-10g/L, deionized water as solvent, and natural pH value.
Typically, the genetically engineered bacteria are inoculated into LB medium before fermentation, cultured overnight on a shaker at 37℃and 150-200rpm, and then inoculated into fermentation medium at 1% by volume of inoculum size for fermentation culture.
The beneficial effects of the invention are mainly as follows:
according to the invention, the sulfate binding pocket of CysB is randomly mutated, and meanwhile, a high-throughput screening is carried out through a constructed fluorescence reporting system, so that a CysB mutant with better sulfur source binding capacity is screened, and a genetically engineered bacterium which can produce L-cysteine with better expression strength and better performance for the CysB is constructed based on the mutant, so that the growth efficiency of the genetically engineered bacterium in unit time is improved by 32.7% compared with that of a starting strain, and finally the titer of the L-cysteine is improved by 3.3%.
(IV) description of the drawings
FIG. 1 shows the variation of fluorescence intensity of different gene promoters in M9 medium;
FIG. 2 shows the change in fluorescence intensity of different gene promoters in M9 modified medium;
FIG. 3 shows a fluorescence reporting system pTrc99a-cysB-P cysK -eGFP construction schematic;
FIG. 4 shows the strain W3110/pTrc99a-cysB-P cysK -eGFP inGrowth curve and fluorescence intensity variation in M9 medium;
FIG. 5 shows the strain W3110-. DELTA.cysB/pTrc 99a-cysB-P cysK -growth curve and fluorescence intensity variation of eGFP in M9 medium;
FIG. 6 is a high throughput screening of cysB mutants in 96 deep well plates using a fluorescence reporting system;
FIG. 7 shows the change of fluorescence intensity of 3 screening mutants in M9 medium;
FIG. 8 shows the change in fluorescence intensity of 3 screening mutants in M9 modified medium;
FIG. 9 is a diagram of EYC:: DKSAC-B1/pEB in 500mL shake flask fermentation Q128L OD of (d) 600 And a potency change of L-cysteine;
FIG. 10 shows a diagram of EYC:: DKSAC-B1/pEB in a 5L fermenter Q128L OD of (d) 600 And a potency change of L-cysteine;
(fifth) detailed description of the invention
The invention will be further described with reference to the following specific examples, but the scope of the invention is not limited thereto:
in the following examples, the final concentration of ampicillin in the medium was 0.1mg/L, kanamycin in the medium was 0.05mg/L, and vitamin B1 in the medium was 0.005mg/L.
The parent strain E.coli W3110 of the invention is from the university of Yersinia CGSC collection (Coli Genetic Stock Center), the 8 th month 5 th day of the collection date 1975, the collection number CGSC#4474, which is disclosed in patent US 2009/0298135 A1,US 2010/0248311.
The primer sequence information used in examples 1-5 is shown in Table 2,
table 1: gene involved in gene editing and corresponding pathway
Gene Involves the approach
cysB Cysteine synthesis pathway
Table 2: primer sequences
Example 1: HPLC determination of L-cysteine content
The detection method comprises the following steps:
(1) The chromatographic method comprises the following steps: c18 column (250X 4.6mm,particle size 5 μm, agilent technologies Co., santa Clara, calif., USA), detection wavelength: 200nm, column temperature: 30 ℃;
and (3) fermentation liquid treatment: taking 1mL of bacterial liquid in a 2mL EP tube, and centrifuging for 1-4min under the condition of 10000-15000 rpm/min; the supernatant is separated from the precipitate and then treated separately for detection of L-cysteine and other metabolites.
(2) Derivatization reaction system: CNBF 0.27g was weighed and dissolved in 10mL of acetonitrile as solution A, stored in a brown light-shielding bottle, and stored at 4℃for ready use. The standard buffer solution with pH=9.0 is prepared by mixing 0.2M boric acid solution and 0.05M borax solution as mother solutions according to the volume ratio of 4:1, and is denoted as solution B. The fermented sample is diluted to 0-5g/L concentration, mixed according to the proportion of 100 mu L of supernatant, 500 mu L of boric acid buffer solution B and 300 mu L of derivatization reagent A, and subjected to metal bath reaction at 600rpm at 60 ℃ for 1 hour, and then subjected to film coating treatment in a brown liquid phase bottle for detection.
(3) The detection method comprises the following steps: the instrument is a Siemens flight UPLC ultra-high pressure liquid chromatograph. The chromatographic column was a C18 column (4.6X105 nm,5 μm); the ultraviolet detector detects the wavelength of 260nm; the sample injection amount is 10 mu L; column temperature is 30 ℃; the flow rate is 0.8mL/min; the mobile phase uses AB two phases, and the A phase is pure acetonitrile; phase B was 50mM HAc-NaAc buffer, acetonitrile=83.0:17.0, pH adjusted to 4.9 with HAc.
Data acquisition time: 23min.
Example 2: screening and shake flask verification of promoters in fluorescence reporting system
E.coli W3110 was used as the chassis strain by constructing recombinant plasmid pTrc99a-p cysK -eGFP、pTrc99a-p cysJIH -eGFP、pTrc99a-p cysP eGFP, transduced into Chassis strain E.coli W3110, was used to verify the effect of different promoters on the change in fluorescence intensity.
(1) Construction of pTrc99a plasmid linearization vector: the original pTrc99a plasmid was used as a template, and the primers pTrc99a-F and pTrc99a-R were used to carry out a linearization ring-opening treatment. And (3) after the PCR product is verified by nucleic acid gel electrophoresis, performing digestion treatment on the residual template for 1-3 hours at 37 ℃ by using DPNI, purifying the product after digestion, and measuring the concentration of nucleic acid to finally obtain the pTrc99a linearization vector fragment.
(2) Fragment amplification of several original promoters: the promoter corresponding to cysK, cysP, cysJIH gene or gene cluster was searched using https:// www.ecocyc.org website, the wild E.coli W3110 genome was used as template, and the primer cysK was used Ec -F and cysK Ec -R、cysP Ec -F and cysP Ec -R、cysJIH Ec -F and cysJIH Ec R PCR-amplifying the target fragments and subjecting them to T rpoC Attached to P cysK Before. After the product is verified by nucleic acid gel electrophoresis, the product is purified and the concentration of the nucleic acid is measured, and finally the amplified cysK, cysP, cysJIH promoter fragment (see SEQ ID NO. 1-3) is obtained.
(3) Construction of green fluorescent protein expression cassette eGFP: the gene is synthesized, PCR amplification verification is carried out on the gene by using primers eGFP-F and eGFP-R, and after the product is verified by nucleic acid gel electrophoresis, the product is purified and the concentration of nucleic acid is measured, so that the amplified eGFP fragment (see SEQ ID NO. 4) is finally obtained.
(4) Plasmid pTrc99a-p cysK -eGFP、pTrc99a-p cysJIH -eGFP、pTrc99a-p cysP eGFP construction: the pTrc99a linearization vector, amplified cysK, cysP, cysJIH promoter fragment and eGFP fragment are used as templates, a reaction system is added according to the specification of a one-step cloning kit (ClonExpress Ultra One Step Cloning Kit), the kit is placed at 50 ℃ for 15-20min, the kit is taken out and immediately placed on ice for cooling, the promoter fragment of cysK, cysPUWAM, cysJIH and the eGFP fragment gene fragment are respectively integrated on the pTrc99a (K) plasmid polyclonal site, then the connection products are converted into DH5 alpha conversion competence, after colony PCR verification is successful, the recombinant plasmid pTrc99a-p can be obtained by picking up bacteria and inoculating to a test tube cysK -eGFP、pTrc99a-p cysP -eGFP、pTrc99a-p cysJIH eGFP (see SEQ ID NOS.5-7).
(5) The four recombinant plasmids are transformed into chassis bacteria E.coli W3110, and three groups of recombinant plasmids are set in parallel by taking E.coli W3110/pTrc99a as a control strain and are respectively inoculated into M9 basic salt culture medium for culture at 37 ℃ and 150-200rpm to be used as precultures; after 18 to 24 hours, 1mL of the preculture is inoculated into a 500mL shaking flask filled with 50mL of two M9 culture media with different sulfur sources added, and then the culture is carried out at 25 to 30 ℃ and 150 to 200rpm until the concentration of the thalli reaches OD 600 When=0.8-1.0, IPTG was added at a final concentration of 0.1mM and incubation was continued for 24h; after the culture is finished, 1mL of bacterial liquid is taken, the concentration and the fluorescence intensity of bacterial cells are detected by using an ultraviolet spectrophotometer and an enzyme-labeled instrument, and a strain growth curve and a fluorescence intensity change curve are drawn as shown in figures 1 and 2.
As can be seen from the figure, by constructing recombinant plasmids pTrc99a-p of different gene promoters cysK -eGFP、pTrc99a-p cysP -eGFP、pTrc99a-p cysJIH The effect of eGFP on fluorescence intensity was different, wherein the recombinant plasmid pTrc99a-p cysK The relative fluorescence intensity of eGFP is higher. This indicates that the sensitivity of the different promoters to cysB expression is different.
M9 medium (with added disulfide source): na (Na) 2 HPO 4 6g/L，KH 2 PO 4 3g/L，NH 4 Cl 1g/L，VB 1 0.5g/L，MnCl 2 0.01g/L，FeCl 3 0.2mg/L，Glucose 10g/L，NaCl 0.5g/L，MgCl 2 ·6H 2 O 0.2g/L，Na 2 S 2 O 3 4.74g/L，Na 2 SO 4 ·10H 2 O19.33 g/L, deionized water as solvent and natural pH value.
M9 modified medium (with added disulfide source): glucose 10g/L, na 2 HPO 4 6g/L，KH 2 PO 4 3g/L，Na 2 S 2 O 3 4.74g/L，Na 2 SO 4 ·10H 2 O 19.33g/L，NH 4 Cl 1g/L，MnCl 2 ·4H 2 O 0.01g/L，NaCl 0.5g/L，MgCl 2 ·6H 2 O 0.2g/L，FeCl 3 0.2mg/L，VB 1 5mg/L, 5g/L of yeast extract, 10g/L of peptone, deionized water as solvent and natural pH value.
LB medium: 10g/L peptone, 5g/L yeast extract, 10g/L NaCl, deionized water as solvent, and natural pH.
Example 3: construction of fluorescence reporting system and shake flask verification
E.coli W3110-deltacysB is used as a chassis strain, and the recombinant plasmid pTrc99a-cysB-pcysK-eGFP is constructed and is transformed into the chassis strain E.coli W3110-deltacysB, so that the influence of the recombinant plasmid on the change of fluorescence intensity in the growth process of the strain is verified.
(1) Construction of pTrc99a-p cysK -eGFP plasmid linearization vector: by pTrc99a-p cysK The eGFP recombinant plasmid is used as a template, and the primer cysB-xxh-F and cysB-xxh-R are used for carrying out linearization ring opening treatment. After the PCR product is verified by nucleic acid gel electrophoresis, DPNI is used for digesting the residual template for 1h at 37 ℃, after the digestion is finished, the product is purified, and the concentration of the nucleic acid is measured, thus finally pTrc99a-p is obtained cysK -eGFP linearized vector fragment.
(2) Original cysB fragment amplification: using the wild E.coli W3110 genome as template, primer cysB was used Ec -F and cysB Ec PCR amplifying target fragment by R, purifying the product after the verification of nucleic acid gel electrophoresis, and measuring the nucleic acid concentration to finally obtain amplified cysB fragment (see SEQ ID)No. 8). (3) Plasmid pTrc99a-cysB-p cysK eGFP construction: by pTrc99a-p cysK The eGFP linearization vector and the amplified cysB fragment are used as templates, a reaction system is added according to the specification of a one-step cloning kit (ClonExpress Ultra One Step Cloning Kit), the mixture is placed at 50 ℃ for 15 to 20 minutes, and then the mixture is immediately taken out and placed on ice for cooling, so that the cysB gene fragment can be integrated into pTrc99a-p cysK On the multi-cloning site of the-eGFP (K) plasmid, the connection product is then transformed into DH5 alpha conversion competence, and after colony PCR verification is successful, pTrc99a-cysB-p can be obtained by picking up bacteria and inoculating into a test tube cysK An eGFP recombinant plasmid as shown in FIG. 3 (see SEQ ID NO. 9).
(4) The fluorescence reporter system pTrc99a-cysB-p was used cysK EGFP was transformed into Chassis strains E.coli W3110 and E.coli W3110- ΔcysB, respectively, and expressed as E.coli W3110/pTrc99a-cysB-p cysK eGFP as a control strain, three groups of replicates were set and inoculated into M9 minimal salt medium, respectively, and cultured at 37℃and 150-200rpm for preculture; after 18-24h, 1mL of the preculture was inoculated into a 500mL shaking flask containing 50mL of M9 medium, and then cultured at 25-30℃and 150-200rpm until the cell concentration reached OD 600 When=0.8-1.0, IPTG was added at a final concentration of 0.1mM, and culture was continued; sampling is carried out regularly in the culture process, an ultraviolet spectrophotometer and an enzyme-labeled instrument are used for detecting the concentration and fluorescence intensity of the bacterial strain, and a strain growth curve and a fluorescence intensity change curve are drawn as shown in figures 4 and 5.
As can be seen from FIGS. 4 and 5, E.coli W3110-. DELTA.cysB/pTrc 99a-cysB-p cysK The eGFP strain is superior to E.coli W3110/pTrc99a-cysB-p cysK The growth rate of the eGFP strain is slowed down, the fluorescence intensity is weakened to a certain extent, but a certain green fluorescence can be observed under a fluorescence microscope, so that the constructed fluorescence reporting system, namely pTrc99a-cysB-p, can be proved cysK The eGFP plasmid is able to sensitively respond to the intensity of expression of the cysB gene.
Example 4: sulfate binding pocket of error-prone PCR random mutation cysB and high-throughput screening mutant
With E.coli W3110-. DELTA.cysB/pTrc 99a-cysB-p cysK The eGFP strain is used as an initial strain, and the original cysB protein of the escherichia coli is used as a target strainThe sulfate binding pocket was randomly mutated and cysB positive mutants were screened at high throughput by variation of the fluorescence intensity of each mutant.
(1) Error-prone PCR was performed on the sulfate binding pocket of cysB: the method comprises the steps of taking an original cysB gene of escherichia coli as a template, adding a reaction system according to an instruction book of an Instant Error-prone PCR Kit (Instant Error-protein PCR Kit), randomly mutating a sulfate binding pocket of cysB protein by using primers Error PCR-F and Error PCR-R, and detecting the concentration of nucleic acid after the PCR product after random mutation is subjected to nucleic acid gel electrophoresis verification and recovery, thereby finally obtaining the cysB Error-prone PCR fragment.
(2) Plasmid pTrc99a-cysB error PCR -p cysK eGFP construction: plasmid pTrc99a-cysB error PCR -p cysK The eGFP is subjected to ring opening linearization by using primers Error XXH-F and Error XXH-R, after the eGFP is verified by nucleic acid gel electrophoresis, the residual template is subjected to 1h digestion treatment at 37 ℃ by using DPNI digestive enzyme, and after digestion, the product is subjected to clean up purification and nucleic acid concentration measurement, so that a ring-opened plasmid is finally obtained; then taking the linearization vector and cysB random mutant fragments as templates, referring to a one-step cloning kit (ClonExpress Ultra One Step Cloning Kit) instruction book, adding a reaction system, standing at 50 ℃ for 15-20min, immediately standing on ice for cooling, integrating the mutant fragments onto the linearization vector, and then converting the connection product of the mutant fragments into W3110-deltacysB conversion competence.
(3) High throughput screening of cysB mutants on 96 deep-well plates: picking the transformation transformant into a 96-deep well plate with 1 mL/well M9 culture medium added with a disulfide source, adding IPTG with a final concentration of 0.1mM to induce the transformation transformant, and culturing at 25-30deg.C and 150-200rpm until the thallus concentration reaches OD 600 When about 0.3-0.5, centrifuging at 4 deg.C and 4000-5000rpm in a low temperature centrifuge for 10-20min, re-suspending with phosphate buffer of 1 XPBS (pH=8.0), centrifuging again under the above conditions, repeating the steps twice, re-suspending with phosphate buffer of 1 XPBS (pH=8.0), taking 200 μl of each well, measuring cell concentration and corresponding fluorescence intensity in 96 ELISA plates, and finally plotting the relative fluorescence intensities of different mutantsAs shown in fig. 5.
As can be seen, by randomly mutating the sulfate binding pocket of protein CysB, the relative expression intensity of some mutant strains compared to the control strain was higher than that of the control strain, and after sequencing the mutant strains according to the relative fluorescence intensity, 3 mutant strains were selected for further shake flask verification, i.e., 3 mutants No. 44, 48, 73.
Example 5: shake flask validation of 3 mutants
(1) Shake flask validation of 3 mutants: streaking the 3 mutants into a plate culture dish containing kanamycin resistance, culturing overnight in a constant temperature incubator at 37 ℃, selecting single colonies, culturing in a test tube filled with 10mL M9 culture medium at 25-30 ℃ and 150-200rpm, and activating; after 18-20h of cultivation, 1mL of the bacterial liquid is inoculated into two modified 500mL shake flasks containing 50mL of M9 medium, three strains are arranged in parallel, IPTG with the final concentration of 0.1mM is added into the bacterial liquid, and the bacterial liquid is sampled after 24h of cultivation in 150-200rpm at 25-30 ℃; 1mL of the bacterial liquid was centrifuged, and the culture medium was washed with phosphate buffer solution of 1 XPBS (pH=8.0), and 200. Mu.L of the resuspended bacterial liquid was then used for concentration measurement and fluorescence intensity measurement, respectively, and finally the relative fluorescence intensities of the different mutants were plotted, as shown in FIGS. 7 and 8.
As can be seen from FIGS. 7 and 8, the relative fluorescence intensity of the 44 th mutant among the 44 th, 48 th and 73 th mutants is highest, which is improved by 54.7% compared with the control group, and the relative fluorescence intensity is 17622.1. The mutant bacterial lysate 44 is used as a template, primers TB-YZ-F and TB-YZ-R are used for PCR amplification, then the PCR amplification is verified by nucleic acid gel electrophoresis, and the PCR amplified bacterial lysate is sent to the Optimaceae company for sequencing to obtain mutant sequence details, thus obtaining cysB Q128L (see SEQ ID NO. 10).
Phosphate buffer: naCl 8g/L, KCl 0.2g/L, na 2 HPO 4 1.1g/L，KH 2 PO 4 0.27g/L, deionized water as solvent, and adjusting pH to 8.0.
Example 6: construction of Chaetomium EYC DKSC-1
Engineering bacteria E.coliW3110EYC:: P yhaO -construction of ydeD:
(1) The gRNA was subjected to site-directed mutagenesis by PCR amplification (primers pTTB-F and pTTB-R) using the pTarget Plasmid (Addgene Plasmid # 62226) as template. The PCR product was digested with DpnI. The digestion products were transferred to E.coli DH 5. Alpha. And plated on a spectinomycin plate, single colonies were picked for sequencing verification (primers pTTB-VF and pTTB-VR), and successfully mutated pTarget-ydeD plasmids were selected.
(2) Using E.coli W3110 genome as a template, 500bp sequences upstream and downstream of the ydeD promoter of the gene and the promoter P were amplified by PCR yhaO Obtaining DNA fragments, down-ydeD-Up (primers Up-F and Up-R), down-ydeD-Down (primers Down-F and Down-R) and Down-P yhaO (ydeD) (primer P yhaO -F and P yhaO -R). The three DNA fragments were fused by fusion PCR to obtain a DNA fragment Donor-ydeD.
(3) The strain E.coli W3110EYC (CCTCC NO: M20191026, disclosed in CN 111019877A) was prepared as a transformation competent, and the pCas Plasmid (Addgene Plasmid # 62225) was transformed into E.coli W3110EYC transformation competent by a chemical transformation method, and applied to a kanamycin resistance plate to obtain the strain E.coli W3110EYC/pCas.
(4) Strain e.coli w3110eyc/pCas was made electrotransducent. After the plasmid pTarget-ydeD and the fragment Donor-ydeD are electrotransferred to W3110EYC/pCas electrotransferred competence, the plasmid is coated on a kanamycin and spectinomycin double-resistance plate, single colony is selected for PCR verification (primers ydeDJYZ-VF and ydeDJYZ-VR), and successfully edited strains are screened to obtain E.coli W3110EYC:: P yhaO ydeD. The primers are shown in Table 3.
Table 3: primer sequences
And (II) engineering strain E.coliW3110EYC:: P yhaO -ydeD::P yhaO Construction of yfiK/pE (cry:: DK):
(1) The gRNA was subjected to site-directed mutagenesis (primers pTTB-F and pTTB-R) by PCR amplification using the pTarget Plasmid (Addgene Plasmid # 62226) as template. The PCR product was digested with DpnI. The digestion products were transferred to E.coli DH 5. Alpha. And plated on a spectinomycin plate, single colonies were picked for sequencing verification (primers pTTB-VF and pTTB-VR), and the mutant pTarget-yfiK plasmid was selected.
(2) Using E.coli W3110 genome as template, 500bp sequence upstream and downstream of gene yfiK promoter and promoter P were amplified by PCR yhaO Obtaining DNA fragments, down-yfiK-Up (primers Up-F and Up-R), down-yfiK-Down (primers Down-F and Down-R) and Down-P yhaO (yfiK) (primer-P yhaO -F and P yhaO -R). The three DNA fragments were fused by fusion PCR to obtain a DNA fragment Donor-yfiK.
(3) The strain E.coli W3110EYC:: P yhaO Preparation of the ydeD to become competent, the pCas Plasmid (Addgene Plasmid # 62225) was transformed into E.coli W3110EYC:: P by chemical transformation yhaO In the ydeD transformation competence, the strain E.coli W3110EYC:: P was obtained by coating on a kanamycin resistance plate yhaO -ydeD/pCas。
(4) The strain E.coli W3110EYC:: P yhaO The ydeD/pCas was prepared as electrotransport competent. The plasmid pTarget-yfiK, fragment Donor-yfiK was electrotransferred to W3110EYC:: P yhaO after-ydeD/pCas electrotransformation competence, the bacterial strain is coated on a kanamycin and spectinomycin double-resistance plate, single bacterial colony is selected for PCR verification (primers yfikJYZ-VF and yfikJYZ-VR), and an edited strain is screened to obtain E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK. The primers are shown in Table 4.
Table 4: primer sequences
(III) engineering bacteriaStrain E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO Construction of yeaS/pE (EYC:: DKS):
(1) The gRNA was subjected to site-directed mutagenesis (primers pTTB-F and pTTB-R) by PCR amplification using the pTarget Plasmid (Addgene Plasmid # 62226) as template. The PCR product was digested with DpnI. The digestion products were transferred to E.coli DH 5. Alpha. And plated on a spectinomycin plate, single colonies were picked for sequencing verification (primers pTTB-VF and pTTB-VR), and the mutated pTarget-yeaS plasmid was selected.
(2) The E.coli W3110 genome was used as template to amplify the 500bp sequence upstream and downstream of the gene yeaS promoter, and the promoter P by PCR yhaO Obtaining DNA fragments, down-yeaS-Up (primers Up-F and Up-R), down-yeaS-Down (primers Down-F and Down-R) and Down-P yhaO (yeaS) (primer P yhaO -F and P yhaO -R). The three DNA fragments were fused by fusion PCR to obtain the DNA fragment Donor-yeaS.
(3) The strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO Preparation of the yfiK to become competent, the pCas Plasmid (Addgene Plasmid # 62225) was transformed into E.coli W3110EYC:: P by chemical transformation yhaO -ydeD::P yhaO In the transformation competence of yfiK, the strain E.coli W3110EYC:: P was obtained by coating on a kanamycin resistance plate yhaO -ydeD::P yhaO -yfiK/pCas。
(4) The strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK/pCas was prepared as electrotransport competent. The plasmid pTarget-yeaS, fragment Donor-yeaS was electrotransferred to W3110EYC:: P yhaO -ydeD::P yhaO After the-yfiK/pCas electrotransformation competence, the bacterial strain is coated on a kanamycin and spectinomycin double-resistance plate, single colony is selected for PCR verification (primers yeaSJYZ-VF and yeaSJYZ-VR), and the successfully edited bacterial strain is screened to obtain E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO yeaS. The primers are shown in Table 5.
Table 5: primer sequences
(IV) engineering bacteria E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO Construction of alaE:
(1) The gRNA was subjected to site-directed mutagenesis (primers pTTB-F and pTTB-R) by PCR amplification using the pTarget Plasmid (Addgene Plasmid # 62226) as template. The PCR product was digested with DpnI. The digestion products were transferred to E.coli DH 5. Alpha. And plated on a spectinomycin plate, single colonies were picked for sequencing verification (primers pTTB-VF and pTTB-VR), and the mutant pTarget-alaE plasmid was selected.
(2) Using E.coli W3110 genome as template, 500bp sequence upstream and downstream of the alaE promoter of gene and promoter P were amplified by PCR yhaO Obtaining DNA fragments, down-alaE-Up (primers Up-F and Up-R), down-alaE-Down (primers Down-F and Down-R) and Down-P yhaO (alaE) (primer P yhaO -F and P yhaO -R). The three DNA fragments were fused by fusion PCR to obtain a DNA fragment Donor-alaE.
(3) The strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO Preparation of YeaS to become competent, the pCas Plasmid (Addgene Plasmid # 62225) was transformed into E.coli W3110EYC:: P by chemical transformation yhaO -ydeD::P yhaO -yfiK::P yhaO In the transformation competence of yeaS, the strain E.coli W3110EYC:: P was obtained by coating on kanamycin resistance plates yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS/pCas。
(4) The strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO Preparation of yeaS/pCas to electrotransport competence. The plasmid pTarget-alaE, fragment Donor-alaE was electrotransferred to W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO After the electrotransformation competence of yeaS/pCas, the mixture was plated on kanamycin and spectinomycin double-resistance plates, and single colonies were picked for PCR verification (primers alaEJYZ-VF and alaE)JYZ-VR), and screening the editing success strain to obtain E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE. The primers are shown in Table 6.
Table 6: primer sequences
Primer name Sequence (5 '-3')
pTTB-F TAATACTAGTGTACAAAAAACGAGCCGTTAGTTTTAGAGCTAGAAATAGC
pTTB-R GCTCTAAAACTAACGGCTCGTTTTTTGTACACTAGTATTATACCTAGGAC
Up-F ATGTTATTTAAACTTTGTAACATTACGGAC
Up-R gcggcgtttactgctttcATATGATTTATTTTTAATTAAATCAATTAGATATGG
P yhaO -F atGAAAGCAGTAAACGCCGCG
P yhaO -R GGTCTGTTTCCTGTGTGAAATCCAGCACGACCCGCCGG
Down-F tcgtgctggaTTTCACACAGGAAACAGACCATGTTCTCACCGCAGTCACGC
Down-R GCGAAGCCAGTTAAAGACGC
pTTB-VF GTCAGTGAGCGAGGAAGCGG
pTTB-VR TAGCACGATCAACGGCACTG
alaEJYZ-VF TCATCAGCTCCAGCCAGGTG
alaEJYZ-VR AATGGCCAGTCCTCCGCGTGATG
And (V) engineering bacteria E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO Construction of-apFAB 689-tolC
(1) DNA fragment was obtained by PCR amplification using E.coli W3110 genome as a template, 500bp sequences (primers Up-F and Up-R, primers Down-F (689) and Down-R) upstream and downstream of the tolC promoter, and promoter P yhaO (primer P) yhaO -F and P yhaO -R) and RBS apFAB689 (primers RBS689-R and RBS-F). The four DNA fragments were fused by fusion PCR to obtain the DNA fragment Donor-apFAB689-tolC.
(2) The strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO Preparation of alaE to become competent, the pCas Plasmid (Addgene Plasmid # 62225) was transformed by chemical transformation into E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO In the alaE transformation competence, the strain E.coli W3110EYC:: P was obtained by coating on a kanamycin resistance plate yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE/pCas。
(3) The strain E.coli W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO alaE/pCas was prepared as electrotransport competence. The fragment Donor-apFAB689-tolC was electrotransferred to W3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO After alaE/pCas electrotransformation competence, the strain is coated on a kanamycin and spectinomycin double-resistance plate, single colony is selected for PCR verification (primers tolCJYZ-VF and tolCJYZ-VR), and successfully edited strains are screened to obtain E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO apFAB689-tolC. The primers are shown in Table 7.
Table 7: primer sequences
Primer name Sequence (5 '-3')
pTTB-F TAATACTAGTCACGTAACGCCAACCTTTTGGTTTTAGAGCTAGAAATAGC
pTTB-R GCTCTAAAACCAAAAGGTTGGCGTTACGTGACTAGTATTATACCTAGGAC
Up-F TGCCAGGAAACTTAACACCGG
Up-R ttactgctttcCATAGGGCGTTAATGTGCCTC
P yhaO -F cgccctatgGAAAGCAGTAAACGCCGCG
P yhaO -R ttaagtgaacttgggcccTCCAGCACGACCCGCCGG
RBS-F gaGGGCCCAAGTTCACTTAAAAAG
RBS689-R tCATTAGAAACACTCCCCCGC
Down-F(689) cgggggagtgtttctaatgATGAAGAAATTGCTCCCCATTC
Down-R TTAAAACGTTGGGTGGTTTGATC
pTTB-VF GTCAGTGAGCGAGGAAGCGG
pTTB-VR TAGCACGATCAACGGCACTG
tolCJYZ-VF ATGAACGCGAATATCTTCG
tolCJYZ-VR AATGGCCAGTCCTCCGCGTGATG
(4) Picking positive single colony, inoculating into LB test tube containing 1mM IPTG and 0.05mg/L kanamycin, culturing at 30deg.C overnight, streaking onto LB plate containing 0.05mg/L kanamycin, culturing at 30deg.C for 24 hr, picking single colonyColonies streaked on LB plates containing 0.05mg/L spectinomycin failed to successfully eliminate the pTarget-tolC plasmid on single colonies on LB plates containing 0.05mg/L spectinomycin. Picking single colony successfully eliminated by pTarget-tolC plasmid, culturing overnight at 37 ℃, streaking the next day bacterial solution on LB plate, culturing for 12h at 37 ℃, picking single colony streaked on LB plate containing 0.05mg/L kanamycin, unable to successfully eliminate pCas plasmid on single colony of LB plate containing 0.05mg/L kanamycin, finally obtaining plasmid-free E.coliW3110EYC:: P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB689-tolC。
(5) The aseptic strain is prepared into transformation competence, the fermentation plasmid pE is transformed into the transformation competence of the strain and coated on an ampicillin resistance plate to obtain a strain E.coliW3110EYC:: P containing the fermentation plasmid yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO APFAB689-tolC/pE (i.e. EYC:: DKSAC-1).
Example 7: construction of fermentation strain and fermentation verification
(1) Construction of the fermentation strain: the plasmid pTrc99a-pE (pE) was used as a template, and the primers pEB-lj-F and pEB-lj-R were used to carry out a linearized ring-opening treatment. And (3) after the PCR product is verified by nucleic acid gel electrophoresis, performing digestion treatment on the residual template for 1-3 hours at 37 ℃ by using DPNI, purifying the product after digestion, and measuring the concentration of nucleic acid to finally obtain the pE linearization vector fragment. With cysB Q128L Fragment was used as template, primer cysB was used Q128L -F and cysB Q128L And (3) carrying out PCR on the PCR product, purifying the PCR product after the PCR product is verified by nucleic acid electrophoresis, and measuring the concentration of nucleic acid to finally obtain the fragment which can be connected with the pE linearization carrier.
(2) Plasmid pTrc99a-pEB Q128L (pEB Q128L ) And (3) construction: linearizing the vector with pE and amplified cysB Q128L The fragment is used as a template, a reaction system is added according to the instruction book of the one-step cloning kit (ClonExpress Ultra One Step Cloning Kit), the mixture is placed at 50 ℃ for 15-20min, and then the mixture is immediately taken out and placed on ice for cooling, thus the cysB can be obtained Q128L Gene fragmentIntegrating into pE plasmid polyclonal site, then converting the connection product into DH5 alpha conversion competence, after colony PCR is verified successfully, inoculating into test tube by picking bacteria so as to obtain pEB Q128L Recombinant plasmid (see SEQ ID NO. 11)
After obtaining the linearized vector fragment, it was transformed into Chaetomium EYC:: DKSAC-1 (E.coli W3110EYC:: P) yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yha O-alaE::P yhaO -apFAB 689-tolC/pE) to obtain EYC:DKSAC-B1/pEB Q128L Strains.
(3) Strain EYC DKSAC-B1/pEB Q128L Shake flask verification of (2): EYC DKSAC-1/pEB is used as a control strain, EYC DKSAC-B1/pEB is used as a reference strain Q128L For experimental strains, respectively inoculating the strains into 10mL of LB culture medium, culturing for 15-17h in a constant temperature shaking table at 37 ℃ and 150-200rpm, transferring the strains into a 500mL shaking bottle filled with 50mL of fermentation culture medium at an inoculum size of 1%, culturing for 4-6h in the constant temperature shaking table at 25-30 ℃ and 150-200rpm, adding 0.1mM IPTG at a final concentration when OD=0.6-0.8, and continuously culturing for 48h to obtain a fermentation sample.
Centrifuging 1mL of fermentation broth at 10000-12000rpm at room temperature for 1-4min, separating supernatant and precipitate, performing HPLC detection and OD detection on fermentation broth according to example 1 600 And the L-cysteine content in the supernatant of the fermentation broth is shown in FIG. 9.
As shown in FIG. 9, a recombinant plasmid pEB was constructed by mutating cysB Q128L Compared with EYC, DKSAC-1 strain, the L-cysteine titer is improved by 0.066g/L.
(4) Strain EYC DKSAC-B1/pEB Q128L Is verified by the fermentation tank: EYC DKSAC-1/pEB is used as a control strain, EYC DKSAC-B1/pEB is used as a reference strain Q128L For experimental strains, the strain is inoculated into 10mL of LB culture medium respectively, cultured for 15-17h in a constant temperature shaking table at 37 ℃ and 150-200rpm, then transferred into a 500mL shaking bottle filled with 100mL of fermentation culture medium with the inoculum size of 1%, and cultured for 12h in a constant temperature shaking table at 25-30 ℃ and 150-200rpm, thus obtaining seed liquid. The 5L fermentation tank is subjected to empty and solid digestion, and is connected with a pH electrode, an oxygen dissolving electrode, an alkali bottle, a feed supplementing bottle and an additional amino acid solution, and is connected with seed liquid after the pH is regulated to 7.0-7.5, so that the oxygen dissolving electricity is generatedThe pole was adjusted to 100%. And then controlling the rotation speed and dissolved oxygen together, stabilizing the pH value to 7.0-7.5, adding IPTG with the final concentration of 0.1M when the fermentation tank starts to feed after culturing for 12-14h, and controlling the feed and the pH value together, wherein the pH value is controlled to be 7.0-7.5. Sampling at intervals of 4-6 hr, collecting 1mL fermentation broth, and determining OD 600 At the same time, 1mL of the fermentation broth was centrifuged at 10000-12000rpm at room temperature for 1-4min, and the supernatant was separated from the precipitate, and the fermentation broth was subjected to HPLC detection and OD according to example 1 600 And the L-cysteine content in the supernatant of the fermentation broth is shown in FIG. 10.
As can be seen from FIG. 10, a recombinant plasmid pEB was constructed by mutating cysB Q128L Compared with EYC, the DKSAC-1 strain has the advantages that the cystine precipitation time is 4-6 hours earlier, the titer is improved by 0.26g/L, and the growth efficiency per unit time is improved by 32.7 percent compared with that of a control strain.
Shake flask medium: glucose 40g/L; (NH) 4 ) 2 SO 4 15g/L, yeast extract 5g/L, peptone 3g/L, KH 2 PO 4 2g/L，Na 2 HPO 4 2g/L，Na 2 S 2 O 3 10g/L, trace element solution 1mL/L, deionized water as solvent, and natural pH. Separately weigh 0.01g/mL CaCO 3 Subpackaging in shake flasks to adjust pH.
The microelement solution comprises the following components: mnSO 4 ·8H 2 O 5g/L，MgSO 4 ·7H 2 O 500g/L，FeSO 4 ·7H 2 O10g/L，ZnSO 4 5g/L, deionized water as solvent and natural pH value.
Fermentation tank medium: glucose 30g/L, (NH) 4 ) 2 SO 4 10g/L，Na 2 S 2 O 3 10g/L，KH 2 PO 4 3g/L；Na 2 HPO 4 3g/L, 10g/L of peptone, 6g/L of yeast powder, 2g/L of anhydrous betaine, 1mL/L of additional salt ion solution, 1mL/L of iron ion solution, 500 mu L/L of iron standard solution, 1mL/L of defoamer, deionized water as solvent and natural pH value.
Feed medium: glucose 300g/L, (NH) 4 ) 2 SO 4 15g/L，Na 2 S 2 O 3 12.5g/L，KH 2 PO 4 1g/L，Na 2 HPO 4 1g/L, trace element solution 1mL/L, deionized water as solvent, and natural pH value.
Alkali bottle: ammonia water is prepared, the volume ratio of deionized water is 1:1, and the pH value is natural.
Amino acid solution: l-cysteine 1g/L, L-threonine 1g/L and L-isoleucine 1g/L, deionized water as solvent, and natural pH value.
Solution: mnSO 4 ·8H 2 O 5g/L，MgSO 4 ·7H 2 O 500g/L，FeSO 4 ·7H 2 O 5g/L，ZnSO 4 5g/L, deionized water as solvent and natural pH value.
Iron ion solution: feSO 4 ·7H 2 O2.5 g/L, deionized water as solvent and natural pH value.

Claims (6)

1. A cysB mutant has a nucleotide sequence shown in SEQ ID No. 10.
2. The use of cysB mutants according to claim 1 for constructing genetically engineered bacteria which produce L-cysteine in high yield.
3. A high-yield L-cysteine genetic engineering bacterium constructed based on cysB mutant is constructed by the following method: mutation of the sulfate binding pocket of the transcription factor cysB is regulated to obtain a mutant cysB having a nucleotide sequence shown as SEQ ID No.10 Q128L Over-expression in Chaetomium EYC:DKSAC-1/pE gave EYC:DKSAC-B1/pEB Q128L Namely the genetically engineered bacterium for producing the L-cysteine at high yield.
4. The use of the genetically engineered bacterium of claim 2 in the preparation of L-cysteine by microbial fermentation.
5. The application according to claim 4, characterized in that the application is: inoculating the genetically engineered strain into a fermentation culture medium containing Amp resistance, fermenting and culturing at 25-30 ℃ and 100-200 rpm until the OD600 = 0.8-1.0, adding IPTG with the final concentration of 0.1mM, then transferring to 30 ℃ and continuously culturing at 150-180rpm for 48 hours, and taking a fermentation liquor supernatant after fermentation is finished, and separating and purifying to obtain the L-cysteine.
6. The use according to claim 5, characterized in that the fermentation medium consists of: glucose 30-50g/L, (NH) 4 ) 2 SO 4 5 to 20g/L, 5 to 10g/L of yeast extract, 0.5 to 2.0g/L of peptone and KH 2 PO 4 0.5～2.0g/L，Na 2 HPO 4 0.5～2.0g/L，Na 2 S 2 O 3 5-10 g/L, microelement solution 0.5-2.0 mL/L, deionized water as solvent, and natural pH. In addition, caCO is independently weighed 3 0.01g/mL, and the mixture is packaged in shake flasks to adjust pH.
CN202310059265.8A 2023-01-17 2023-01-17 High-yield L-cysteine gene engineering bacterium based on cysB mutant and application thereof Pending CN116445514A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310059265.8A CN116445514A (en) 2023-01-17 2023-01-17 High-yield L-cysteine gene engineering bacterium based on cysB mutant and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310059265.8A CN116445514A (en) 2023-01-17 2023-01-17 High-yield L-cysteine gene engineering bacterium based on cysB mutant and application thereof

Publications (1)

Publication Number Publication Date
CN116445514A true CN116445514A (en) 2023-07-18

Family

ID=87119025

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310059265.8A Pending CN116445514A (en) 2023-01-17 2023-01-17 High-yield L-cysteine gene engineering bacterium based on cysB mutant and application thereof

Country Status (1)

Country Link
CN (1) CN116445514A (en)

Similar Documents

Publication Publication Date Title
Wu et al. Enhancing β-carotene production in Escherichia coli by perturbing central carbon metabolism and improving the NADPH supply
CN113186143A (en) Construction and optimization method of engineering strain for producing tetrahydropyrimidine
WO2024045620A1 (en) Recombinant strain for producing 2'-fucosyllactose, construction method, and use
CN112501095B (en) Construction method and application of recombinant escherichia coli for synthesizing 3-fucose
US11098287B2 (en) 17β-hydroxysteroid dehydrogenase mutants and application thereof
CN108998401B (en) Method for producing 3-aminoisobutyric acid
CN110172435B (en) Recombinant bacterium for catalytic synthesis of 2, 5-dimethylpyrazine
CN109913515B (en) Method for increasing yield of poly gamma-glutamic acid by improving glycerol metabolism of bacillus
CN116445514A (en) High-yield L-cysteine gene engineering bacterium based on cysB mutant and application thereof
CN116355818A (en) Genetically engineered bacterium for producing L-leucine and application thereof
CN115927142A (en) Engineering bacterium for high yield of beta-alanine and application thereof
CN114891707A (en) Recombinant strain and method for producing bilirubin through whole-cell catalysis of recombinant strain
CN116622741A (en) CysB mutant, genetically engineered bacterium for high-yield L-cysteine and construction method and application thereof
CN114350586B (en) Genetically engineered bacterium for high-yield of L-cysteine, construction method and application
CN114606253B (en) Recombinant escherichia coli capable of high yield of L-methionine under action of no exogenous amino acid and application thereof
CN117844728B (en) L-valine production strain and construction method and application thereof
CN116064354A (en) Genetically engineered bacterium for high-yield of L-cysteine, construction method and application
CN116837015A (en) Genetically engineered bacterium for high-yield of L-cysteine as well as construction method and application thereof
CN117844838A (en) Construction of strain for high-yield L-phenylalanine and application thereof
CN115806925A (en) Genetic engineering bacterium for high yield of L-cysteine, construction method and application
CN117430717A (en) Multi-enzyme complex assembly system for high-yield L-cysteine and genetically engineered bacteria
CN116836904A (en) Genetically engineered bacterium for high-yield of L-cysteine, construction method and application
CN117904020A (en) Construction of E.coli acetylation mutant strain and application of E.coli acetylation mutant strain in production of 3-hydroxy propionic acid
CN116694657A (en) Method for changing cell growth and metabolic synthesis of escherichia coli based on sigma factor regulation
CN116926033A (en) Mutant for improving yield of beta-nicotinamide mononucleotide, coding gene, amino acid sequence and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination