CN115806925A - Genetic engineering bacterium for high yield of L-cysteine, construction method and application - Google Patents

Abstract

The invention relates to a genetic engineering bacterium for highly producing L-cysteine, a construction method and application thereof in preparing L-cysteine by microbial fermentation. The invention constructs a multifunctional QSI dynamic regulation and control system by integrating an Esa quorum sensing system and a lactose operation subsystem, realizes the coupling of target gene expression and cell growth, is applied to the biosynthesis of L-cysteine, and obtains an Escherichia coli genetic engineering strain with high L-cysteine yield. In addition, the QSI dynamic control system constructed by the invention utilizes the quorum sensing system to dynamically control the lactose manipulation subsystem, replaces the addition of the traditional inducer IPTG, effectively saves the cost of industrial production, reduces the toxic influence of the inducer IPTG on cells, and has good production application value.

Description

Genetically engineered bacterium capable of highly producing L-cysteine, construction method and application

(I) technical field

The invention belongs to the field of metabolic engineering, and particularly relates to a genetic engineering bacterium for high yield of L-cysteine, a construction method and application thereof in preparation of L-cysteine by microbial fermentation.

(II) background of the invention

L-cysteine (L-Cys) is a common sulfur source donor in organisms, and the L form of the L-cysteine has biological activity. L-Cys is an important component of common substances in organisms such as methionine, thiamine and glutathione. L-Cys plays an important role in protein folding, assembly, and signal transduction through disulfide bond formation and protein persulfation. Furthermore, L-Cys protects the cells under oxidative stress. L-Cys, an important amino acid in organisms, is widely used in the industries of medicines, foods, cosmetics and feeds. For example, the L-cysteine derivative medicine has the functions of relieving cough and reducing fever, diminishing inflammation and reducing phlegm, inhibiting bacteria and growing, preventing and treating skin diseases, improving injuries caused by chemotherapy and the like. L-Cys can also be used as food additive such as bread additive, flavoring agent and coloring agent.

Compared with the complicated steps of producing L-Cys by an industrial method and the pollution to the environment, the microbial fermentation method has become a production technology with great prospect. The method of fermentation using microorganisms still faces a great challenge due to the fact that bacteria strictly regulate the cytoplasmic level of L-Cys due to its toxicity to cells and due to the physicochemical properties of reduced iron and driving Fenton chemistry, which results in low levels of original L-Cys accumulation in wild-type E.coli. The biosynthetic pathway and the regulatory mechanisms of L-Cys have been extensively studied. Therefore, the L-Cys production strain is modified by biotechnology such as genetic engineering, metabolic engineering and the like so as to reduce the toxicity of the L-Cys on cells and improve the flux of the metabolic pathway of the L-Cys, and the method is an effective strategy for obtaining the L-Cys high-yield strain.

Metabolic engineering controls the cellular metabolism of microorganisms to maximize the production of value-added products, and may also result in an imbalance in the cellular metabolic network, thereby reducing productivity and yield. Metabolic flux can be rebalanced by dynamic regulation, and the Quorum Sensing (QS) system is considered to be an auto-induction system regulated by cell density. Accumulation of specific small signaling molecules in cells, which induce activation of the QS circuit, can be used to dynamically regulate expression of target genes. Quorum sensing functions control cell density-dependent processes in bacteria and have been applied to induce recombinant protein expression, control of lysine, and balance of multiple cell populations, among others. The Esa quorum sensing system is used to down-regulate competing metabolic pathways as well as to control lacI expression. Small molecule AHLs are produced by the AHL synthase EsaI. Under the condition of low AHL concentration level, a transcription regulatory factor EsAR can be combined with a promoter P _esaS Binds to and activates its transcription. As the cells grow, AHL gradually accumulates and EsaR is able to bind to AHL to form a complex. The formation of the complex can cause the loss of the activation effect of EsAR on a promoter Pesa S, so that the transcription of the promoter Pesa S cannot be activated, and the down regulation of the expression level is realized.

In many engineered strains, the promoter P _Trc Are commonly used to drive gene overexpression. P _Trc Is a common hybrid promoter whose transcription is inhibited by LacI protein. Under IPTG induction, the repressor protein LacI can be combined with IPTG to form a complex, and cannot continue to react with P _Trc Lactose operon binding site on the promoter, resulting in P _Trc Transcription of the promoter. However, the gene expression method using an inducer has some defects, such as high cost of using the inducer in large-scale industrial production, irreversibility of the induction, long-term existence in the medium after addition, and only single control effect. This is achievedIn addition, it is troublesome to determine the optimal induction time by periodically monitoring the growth of cells. These drawbacks pose a certain barrier to the industrialization of conventional synthetic biology.

Disclosure of the invention

Aiming at the problems, a QSI dynamic regulation and control system is constructed and applied to an escherichia coli engineering strain for producing L-cysteine to obtain a genetic engineering strain with high L-cysteine yield.

In order to achieve the above purpose, the invention adopts the technical scheme that:

a genetically engineered bacterium for high yield of L-cysteine is constructed by the following method:

(1) Replacing lacI gene on genome of strain E.coil W3110 as chassis strain with transcription regulator esaR _I70V And AHL synthetase esaI, in the gene esaR _I70V Post-addition terminator T _lpd Addition of terminator T after gene esaI _rpoC Obtaining the strain E.coil W3110:: esaR _I70V ::esaIΔlacI；

(2) The strain E.coil W3110:: esaR _I70V Replacement of the promoters of the cysM gene and the nrdH gene of esaI. DELTA.lacI by P _Trc Promoter to obtain the strain E.coilW3110EYC:: esaR _I70V ::esaI::cysM::nrdHΔlacI；

(3) Plasmid pTrc99a-P _Trc Replacement of the promoter of the gene lacI on-cysE-ydeD-serC-cysB by P _esaS Adding LAA degradation label before the stop codon of the gene lacI to construct a fermentation plasmid pTrc99a-P _esaS -lacI(LAA)-P _Trc -cysE-ydeD-serC-cysB, which was introduced into the strain obtained in step (2) to give E.coilW3110:: esaR _I70V ::esaI::P _Trc -cysM::P _Trc -nrdHΔlacI/pTrc99a-P _esaS -lacI(LAA)-P _Trc -cysE-ydeD-serC-cysB, namely the genetically engineered bacterium for high yield of L-cysteine.

The strain constructed by the invention can dynamically activate the receptor P according to the cell density of the strain _Trc Expression of the target gene under the control of the promoter, the following objectives are achieved: in the early stage of cell growth, the cell thallusThe density is low, the expression of genes involved in L-cysteine synthesis is inhibited under the control of QSI system, and the cell metabolic flow is mainly used for cell growth; along with the growth of cells, the thallus density begins to increase, the expression of genes involved in L-cysteine synthesis is gradually activated under the control of a QSI system, and the fermentation begins to enter a production stage, so that the dynamic separation of cell growth and product generation is realized, and the dynamic regulation strategy has positive influence on the performance of engineering strains for producing toxic compounds.

The transcription regulator esaR _I70V The sequence of the AHL synthetase (esaI) is shown as SEQ ID NO.1, and the sequence of the AHL synthetase (esaI) is shown as SEQ ID NO. 2. In particular, the promoter P _esaS The sequence of (A) is shown as SEQ ID NO.3, the sequence of the degradation label LAA is shown as SEQ ID NO.4, and the terminator T _rpoC The sequence of (A) is shown as SEQ ID NO.5, T _lpd The sequence of the terminator is shown as SEQ ID NO. 6.

The invention also relates to a method for constructing the genetic engineering bacteria for high yield of L-cysteine, which comprises the following steps:

(1) The strain E.coil W3110 is taken as a chassis strain, and the lacI gene on the genome of the strain is replaced by a transcription regulator esaR by applying CRISPR-Cas9 gene editing technology _I70V And AHL synthetase esaI, in the gene esaR _I70V Post-addition terminator T _lpd Addition of terminator T after the gene esaI _rpoC The strain E.coil W3110 is obtained _I70V ::esaIΔlacI；

(2) Applying CRISPR-Cas9 gene editing technology to strain E.coil W3110:: esaR _I70V Replacement of promoters of the cysM gene and nrdH gene of esaI. DELTA. LacI by P _Trc Promoter to obtain the strain E.coilW3110EYC:: esaR _I70V ::esaI::cysM::nrdHΔlacI；

(3) Plasmid pTrc99a-P _Trc Replacement of the promoter of the gene lacI on-cysE-ydeD-serC-cysB by P _esaS And adding LAA degradation label in front of the stop codon of the gene lacI to construct and obtain the fermentation plasmid pTrc99a-P _esaS -lacI(LAA)-P _Trc -cysE-ydeD-serC-cysB, which was introduced into the strain obtained in step (2) to give E.coilW3110:: esaR _I70V ::esaI::P _Trc -cysM::P _Trc -nrdHΔlacI/pTrc99a-P _esaS -lacI(LAA)-P _Trc -cysE-ydeD-serC-cysB, namely the genetically engineered bacterium for high yield of L-cysteine.

The transcription regulator esaR _I70V The sequence of (A) is shown in SEQ ID NO.1, and the sequence of the AHL synthetase esaI is shown in SEQ ID NO. 2.

In particular, the promoter P _esaS The sequence of (A) is shown as SEQ ID NO.3, the sequence of the degradation label LAA is shown as SEQ ID NO.4, and the terminator T _rpoC Has a sequence shown as SEQ ID NO.5, T _lpd The sequence of the terminator is shown as SEQ ID NO. 6.

The invention also relates to application of the genetic engineering bacteria in preparation of L-cysteine by microbial fermentation.

Specifically, the application is as follows: inoculating the genetic engineering bacteria into a fermentation culture medium, fermenting and culturing for 60-72 h at 26-37 ℃ and 200-800 rpm, and separating and purifying the supernatant of the fermentation liquid after the fermentation is finished to obtain the L-cysteine.

The fermentation medium comprises the following components: glucose 30g/L, (NH) ₄ ) ₂ SO ₄ 10g/L、KH ₂ PO ₄ 1g/L、Na ₂ S ₂ O ₃ 10g/L, 5g/L yeast extract, na ₂ HPO ₄ 1g/L of trace element solution, 1g/L of peptone and 1ml/L of trace element solution, wherein the solvent is deionized water, and the pH value is natural; the trace element solution comprises the following components: 0.15g/L Na ₂ MoO ₄ ·2H ₂ O，2.5g/L H ₃ BO ₃ ，0.7g/L CoCl ₂ ·6H ₂ O，0.25g/L CuSO ₄ ·5H ₂ O，1.6g/L MnCl ₂ ·4H ₂ O，0.3g/L ZnSO ₄ ·7H ₂ And O, the solvent is deionized water.

Before the fermentation of the genetically engineered bacteria, the genetically engineered bacteria are generally inoculated into a 10ml LB medium test tube, cultured for 12 hours on a shaking table at 37 ℃ and 180rpm, then inoculated into 100ml of a secondary seed solution fermentation medium at 1% of volume concentration, cultured for 12 hours on the shaking table at 30 ℃ and 180rpm, and then inoculated into the fermentation medium of a fermentation tank for culture at 10% of volume concentration.

The invention has the following beneficial effects: by integrating the Esa quorum sensing system and the lactose manipulation subsystem, a multifunctional QSI dynamic regulation system is constructed, the coupling of target gene expression and cell growth is realized, and the QSI dynamic regulation system is applied to the biosynthesis of L-cysteine, so that the Escherichia coli genetic engineering strain with high L-cysteine yield is obtained. In addition, the QSI dynamic control system constructed by the invention utilizes the quorum sensing system to dynamically control the lactose manipulation subsystem, replaces the addition of the traditional inducer IPTG, effectively saves the cost of industrial production, reduces the toxic influence of the inducer IPTG on cells, and has good production application value.

(IV) description of the drawings

FIG. 1 is a diagram of the construction of the strain E.coil W3110:: esaR in example 2 _I70V ::esaIΔlacI/pTrc99a-P _esaS OD of eGFP ₆₀₀ And a fluorescence intensity variation curve;

FIG. 2 is a diagram of the construction of the strain E.coil W3110:: esaR in example 3 _I70V ::esaIΔlacI/pTrc99a-P _esaS OD of eGFP (LVA) ₆₀₀ And a fluorescence intensity variation curve;

FIG. 3 is the construction of the strain E.coil W3110:: esaR in example 4 _I70V ::esaIΔlacI/pTrc99a-P _esaS -lacI(LAA)-T _lpd -P _esaS -eGFP(LVA)-T _rpoC -P _Trc mCherry and E.coil W3110:: esaR _I70V ::esaIΔlacI/pTrc99a-ΔlacI-P _esaS -eGFP(LVA)-T _rpoC -P _Trc OD of-mCherry ₆₀₀ And a fluorescence intensity variation curve;

FIG. 4 shows the engineered bacterium E.coil W3110EYC/pTrc99a-P constructed in example 5 _Trc -cysE-ydeD-serC-cysB and E.coil W3110EYC:: esaR _I70V ::esaIΔlacI/pTrc99a-P _esaS -lacI(LAA)-P _Trc OD of-cysE-ydeD-serC-cysB ₆₀₀ And the content of L-cysteine in the supernatant of the fermentation liquor;

FIG. 5 shows that esaR is a strain obtained by constructing engineering bacteria E.coil W3110EYC in example 6 _I70V ::esaI::cysMΔlacI/pTrc99a-P _esaS -lacI(LAA)-P _Trc OD of-cysE-ydeD-serC-cysB ₆₀₀ And fermentationThe L-cysteine content in the liquid supernatant;

FIG. 6 shows that esaR is a strain obtained by constructing engineering bacteria E.coil W3110EYC in example 7 _I70V ::esaI::cysM::nrdHΔlacI/pTrc99a-P _esaS -lacI(LAA)-P _Trc OD of-cysE-ydeD-serC-cysB ₆₀₀ And the content of L-cysteine in the supernatant of the fermentation liquor.

(V) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of protection of the invention is not limited thereto:

the parent E.coli W310 EYC strain of the invention is from China center for type culture Collection, and the preservation number is CCTCC NO: m20191026, disclosed in CN 111019877A.

Coli W3110 is from Yale university CGSC Collection (Coli Genetic Stock Center), with a collection date of 1975, 8/5, with a collection number CGSC #4474, disclosed in U.S. Pat. No. 2009/0298135A1, US2010/0248311A 1.

In the examples, the final concentration of kanamycin in the medium was 0.05g/L, the final concentration of spectinomycin in the medium was 0.05g/L, and the final concentration of ampicillin in the medium was 0.1g/L.

LB medium composition: 10g/L of peptone, 5g/L of yeast powder and 5g/L of sodium chloride, wherein the solvent is deionized water, and the pH value is natural. The LB solid medium is prepared by adding agar powder with the final concentration of 2g/L into an LB liquid medium.

Example 1: determination of the L-cysteine content

(1) And (3) treating fermentation liquor: 1mL of the cell suspension was centrifuged at 12000rpm for 1min in a 2mL EP tube, and the supernatant and the precipitate were separated. The supernatant was used for detection of L-cysteine and other metabolites.

(2) And (3) a derivatization reaction system: 0.27g of 4-chloro-3, 5-dinitrobenzotrifluoride (1, 3-Dinitro-2-chloro-5-trifluoromethylbenzene, CNBF) was weighed and dissolved in 10mL of liquid-phase special grade pure acetonitrile to obtain a solution I; A0.2M boric acid solution and a 0.05M borax solution are used as mother solutions, and a standard buffer solution with the pH =9.0 is prepared by mixing 4. The sample was diluted to a concentration of 0 to 5g/L, mixed in a ratio of 100. Mu.L of the sample, 300. Mu.L of the solution I and 500. Mu.L of the solution II, and reacted at 60 ℃ for 1 hour at 600rpm in a constant temperature shaker. And filling the sample after the reaction into a liquid phase bottle through a membrane to be tested.

(3) Liquid phase detection: the instrument is a Saimeishafi UPLC ultrahigh-pressure liquid chromatograph. The chromatographic column is a C18 column (4.6X 250mm,5 μm); the detection wavelength of the ultraviolet detector is 260nm; the sample volume is 10 mu L; the column temperature is 30 ℃; the flow rate is 0.8mL/min; the mobile phase used AB two phases, A phase pure acetonitrile, B phase 50mM HAc-NaAc buffer: acetonitrile: triethylamine =82.8:17:0.2,ph =4.9. The gradient elution procedure is shown in table 1.

Table 1: gradient elution procedure

Example 2: construction of Esa quorum sensing system

Coli W3110 as a starting strain, and the gene lacI gene of the genome is replaced by a transcription regulatory factor esaR by using a CRISPR-Cas9 mediated gene editing technology _I70V And AHL synthetase esaI.

(1) Construction of pTarget plasmid: PCR amplification was performed using pTarget F Plasmid (Addgene Plasmid # 62226) as a template and QSI pT TB F and QSI pT TB R as primers. The PCR product was digested with DpnI. Transforming the digestion product into E.coli DH5 alpha, coating on a Spectinomycin (SD) plate, picking out a single colony, performing sequencing verification by using verification primers PTD YZ F and PTD YZ R, and screening the pTarget-QSI plasmid with successful mutation. The plasmid pTarget-QSI was linearized using the primers pTarget line F and pT line R, using the pTarget-QSI plasmid as template.

(2) Construction of pTD plasmid: taking E.coli W3110 genome as a template, and QSI up F and QSI up R as primers to amplify to obtain upstream homologous arm part Donor-up; using QSI down F and QSI down R as primers to amplify to obtain downstream homologous arm part Donor-down; amplifying to obtain a terminator rrnBT12 fragment Donor-rrnBT12 by taking a plasmid pTrc99a as a template and QSI rrnBT 12F and QSI rrnBT 12R as primers;

the DNA fragment esaI was obtained by gene synthesis. The sequence of the gene esaI is shown in SEQ ID NO. 2. Using the segment esaI as a template, QSI esaI F and QSI esaI R as primers, amplifying to obtain esaI segment Donor-esaI (the gene esaI promoters apFAB296 and RBS apFAB700 are designed on the primers QSI rrnBT 12R and QSI esaI F, and the gene esaI terminator T is designed on the primers QSI rrnBT 12R and QSI esaI F) _rpoC Designed on primer QSI esaR F); DNA fragment esaR by Gene Synthesis _I70V . Gene esaR _I70V The sequence is shown in SEQ ID NO. 1. With the fragment esaR _I70V As a template, QSI esaR F and QSI esaR R R are used as primers, and the esaR is obtained by amplification _I70V Fragment Donor-esaR _I70V (Gene esaR _I70V Promoter P _esaR (apFAB 104), RBS design on primers QSI esaI R and QSI esaR F, gene esaR _I70V Terminator T _lpd Designed on primers QSI esaR R and QSI down F). The PCR product was detected by 1.0% agarose gel electrophoresis and the PCR fragment was purified. The 5 recovered DNA fragments Donor-up, donor-down, donor-rrnBT12, donor-esaI and Donor-esaR _I70V And fusing into a complete Donor fragment by fusion PCR according to the sequence. The fragment was detected by 1.0% agarose gel electrophoresis and recovered and purified by cutting the gel. The linearized pTarget-QSI plasmid was ligated to the Donor fragment according to the instructions of the One-step cloning kit (One step cloning kit, vazyme Biotech, nanjing, china), transformed into E.coli DH 5. Alpha. And spread on SD plates, and single colonies were picked up and screened for successful cloning pTD-QSI plasmids by sequencing verification using the verification primers PTD YZ F and PTD YZ R.

(3) Electroconversion competence preparation: pCas Plasmid (Addgene Plasmid # 62225) was introduced into e. The detailed procedure is described in (Molecular Cloning: A Laboratory Manual,3ed edition, 99-102). Selecting a single clone to a 10ml LB test tube containing 0.05g/L kanamycin, and culturing overnight at 30 ℃; inoculating into 250mL shake flask containing 50mLLB culture medium at volume concentration of 1%, adding 500 μ L1 mol/L-arabinose, culturing at 150rpm and 30 deg.C to OD ₆₀₀ 0.4 to 0.6; the cells were collected by centrifugation at 4000rpm at 4 ℃ for 10min to prepare electrotransformation competent cells, as described in detail (Molecular Cloning: A Laboratory Manual,3ed Edition,99-102).

(4) Electric shock conversion: slowly mixing 150ng of pTD-QSI plasmid and 200. Mu.l of E.coli W3110 electrotransferase competent cells, transferring the mixture into a precooled 2mm electric shock cup, carrying out ice bath for about 1min, carrying out electric shock transformation by using an electroporator (MicroPluser TM, BIO-RAD), immediately adding 1mL of LB culture medium after the electric shock is finished, immediately and gently sucking the mixture out, transferring the mixture into a 1.5mL centrifugal tube, recovering the mixture for 2-3 h at 30 ℃, coating a double-resistant LB flat plate containing 0.05g/L of kanamycin and 0.05mg/L of spectinomycin, carrying out inverted culture for 18-20 h at 30 ℃, carrying out colony PCR (polymerase chain reaction) verification by using QSI VF and QSI VR as genome verification primers, screening E.coilW3110:: esaR _I70V Δ lacI positive colonies.

(5) pTD and pCas plasmid elimination: the positive single colony is selected and inoculated into an LB test tube containing 1mM IPTG and 0.05g/L kanamycin, cultured overnight at 30 ℃, streaked on an LB plate containing 0.05mg/L kanamycin by using a bacterial liquid, cultured for 24 hours at 30 ℃, the single colony is selected and lightly spotted on the LB plate containing 0.05g/L kanamycin to preserve the bacteria, streaked on the LB plate containing 0.05g/L spectinomycin to verify that the single colony which cannot grow on the LB plate containing 0.05g/L spectinomycin can successfully eliminate the pTD-QSI plasmid. Selecting a single colony successfully eliminated by pTD-QSI plasmid in an LB test tube, culturing at 37 ℃ overnight, streaking a secondary day bacterium liquid on an LB plate, culturing at 37 ℃ for 12 hours, selecting a single colony, lightly doting the single colony on the LB plate without anti-LB plate for bacteria preservation, streaking the single colony on the LB plate containing 0.05g/L kanamycin, not streaking the single colony on the LB plate containing 0.05g/L kanamycin, successfully eliminating pCas plasmid, and finally obtaining a plasmid-free strain E.coilW3110:: esaI:: esaR _I70V ΔlacI。

(6) Construction of pTrc99a-P _esaS -eGFP plasmid: DNA fragment P obtained by Gene Synthesis _esaS . Promoter P _esaS The sequence is shown as SEQ ID NO. 3. With segment P _esaS As template, pR 1P _esaS F and pR 1P _esaS R is a primer, and the Donor-P is obtained by amplification _esaS A fragment; using pET28a-eGFP plasmid as a template and pR1 eGFP F and pR1 eGFP R as primers, and amplifying to obtain an eGFP fragment; the linearized pTrc99a is obtained by amplification using pTrc99a as a template and pR1 pline F and pR1 pline R as primers. The PCR product was detected by 1.0% agarose gel electrophoresis and the PCR fragment was purified. The recovered 2 DNA fragments were fusedSynthesis of a complete P by PCR _esaS -an eGFP fragment. The fragment was detected by 1.0% agarose gel electrophoresis and recovered and purified by cutting. Linearized pTrc99a plasmid and target fragment P are cloned by using one-step cloning kit _esaS eGFP ligation, transformation into E.coli DH5 alpha, plating on Amp plates, picking single colonies, sequencing with the verification primers pR1 VF and pR1 VR to verify the success of the selected pTrc99a-P clones _esaS -an eGFP plasmid.

(7) Introduction of a verification plasmid: preparation of E.coilW3110:: esaI:: esaR _I70V Deltalci is competent for chemical transformation, the detailed procedure is described in (Molecular Cloning: A Laboratory Manual,3ed edition, 99-102). The constructed plasmid pTrc99a-P _esaS eGFP-introduced Strain E.coilW3110:: esaR: (esaR) _I70V Δ lacI, resulting in E.coilW3110:: esaR _I70V ΔlacI/pTrc99a-P _esaS -eGFP。

(8) Fluorescence detection: E.coilW3110: esaI: esaR _I70V ΔlacI/pTrc99a-P _esaS Single colonies of eGFP were inoculated into 5mL of LB medium and cultured overnight at 37 ℃ and 200 rpm. The following day, the cells were cultured in 10mL of LB medium at 37 ℃ and 200rpm for 12 hours. 1mL of the preculture was inoculated into a 500mL shake flask containing 50mL of SM medium and fermentation was carried out at 30 ℃ and 220 rpm. During the fermentation process, 1mL of bacterial liquid is taken every 2h in an EP tube, and centrifuged for 1min under the condition of 12000 Xg, and the supernatant and the precipitate are separated. Reselecting with PBS solution for 2 times, and detecting thallus OD with suspension ₆₀₀ . At the same time, 200. Mu.l of the suspension was added to a 96-well Plate (Cell Culture Plate, shanghai Wohong Biotechnology C., ltd.) for eGFP fluorescence value detection; detection of excitation wavelength: 488nm; emission wavelength: fluorescence intensity at 520nm, OD ₆₀₀ And the fluorescence intensity change curve is shown in FIG. 1.

The promoter apFAB296 sequence is shown as SEQ ID NO.7, the RBS apFAB700 sequence is shown as SEQ ID NO.8, the promoter apFAB104 sequence is shown as SEQ ID NO.9, and the terminator rrnBT12 sequence is shown as SEQ ID NO. 10.

As can be seen from FIG. 1, the heterologous expression of genes esaRI70V and esaI in E.coli promotes promoter P _esaS Transcription of. However, as the cell density increased, the intensity of the green fluorescent protein decreased less significantly. A possible reason for this is that although the increase in cell density inhibits P _esaS Transcription from the promoter, but at lower cell densities, P _esaS The fluorescent protein produced by the expression of the promoter is still present in the cell. The green fluorescent protein has longer half-life, so that the down regulation effect of the gene is not obvious. It is then desirable to shorten the half-life of the target protein to allow down-regulation of the expression level of the target gene.

Table 2: example 2 primers

Example 3: plasmid pTrc99a-P _esaS Adding degradation tag LVA to the C terminal of eGFP in eGFP to obtain reporter plasmid pTrc99a-P _esaS -eGFP(LVA)

(1) Construction of pTrc99a-Pesas-eGFP (LVA) plasmid: using plasmid pTrc99a-P _esaS PCR mutation amplification with pR1 TB F and pR1 TB R as template to obtain pTrc99a-P _esaS -eGFP (LVA). The PCR product was digested with DpnI at 37 ℃ for 3h and then transformed into DH 5. Alpha. Competent cells by chemical transformation. Colony PCR with primers pR1 VF and pR1 VR to select positive clones, and sequencing to obtain pTrc99a-P _esaS -the eGFP (LVA) plasmid. The primers are shown in Table 3.

(2) Introduction of a plasmid: preparation of E.coilW3110:: esaR _I70V esaI. DELTA. LacI chemoconversion competence, detailed procedures are described in (Molecular Cloning: A Laboratory Manual,3ed edition, 99-102). The constructed plasmid pTrc99a-P _esaS Transformation of eGFP (LVA) into the Strain E.coilW3110:: esaR by chemical transformation _I70V In esaI delta lacI competence, the E.coilW3110 _I70V ::esaIΔlacI/pTrc99a-P _esaS -eGFP(LVA)。

(3) Fluorescence detection: the constructed production strain E.coilW3110:: esaR _I70V ::esaIΔlacI/pTrc99a-P _esaS Single colonies of eGFP (LVA) were inoculated into 10mL of LB medium, and the fermentation was verified in the same manner as in example 2 (8), the OD thereof ₆₀₀ And the fluorescence intensity change curve is shown in FIG. 2.

The sequence of the degradation label LVA is shown in SEQ ID NO. 11.

As shown in fig. 2, the fluorescence intensity of the cells was significantly reduced with the growth of the cells by adding degradation tag LVA to the end of green fluorescent protein. The above results demonstrate that the use of a degradation tag significantly reduces the half-life of green fluorescent protein and that it is feasible to down-regulate the expression level of genes by quorum sensing systems.

Table 3: example 3 primers

Name of primer	Sequence (5 '-3')
		pR1*TB F	cgacgaaaactacgctctggttgctTGAGGCTGTTTTGGCGG
pR1*TB R	gagcgtagttttcgtcgttagcagcCTTGTACAGTTCGTCCATACCCAG
		pR1 VF	ccaatgcttctggcgtcaggc
pR1 VR	TCGCATGGGGAGACCCCACACTACC

Example 4: construction of effective strains

E.coilW3110::esaR _I70V ::esaIΔlacI/pTrc99a-P _esaS -lacI(LAA)-T _lpd -P _esaS -eGFP(LVA)-T _rpoC -P _Trc -mCherry

(1) Construction of plasmid pTrc99a-P _esaS -lacI(LAA)-T _lpd -P _esaS -eGFP(LVA)-T _rpoC -P _Trc -mCherry: pR2 pline F and pR2 pline R were used as primers to linearize pTrc99a, and the PCR product was digested with DpnI at 37 ℃ for 3 hours, followed by recovery of a DNA fragment using a Clean up kit. With pR 2P _esaS (lacI) F and pR 2P _esaS (lacI) R is used as a primer, and P is obtained by amplification _esaS (lacI) fragment, using pR2 lacI F and pR2 lacI R as primer, amplifying to obtain lacI fragment (lacI terminator T) _lpd And the degradation peptide LAA was designed on pR2 lacI R and pR2 eGFP F); pR2 eGFP F and pR2 eGFP R are used as primers, pTrc99a-P _esaS -eGFP (LVA) as template, amplifying to obtain P _esaS An eGFP (LVA) fragment, and pR2 mCherry F and pR2 mCherry R are used as primers to amplify to obtain an mCherry fragment. The 5 recovered DNA fragments were fused into a complete P by fusion PCR _esaS -lacI(LAA)-T _lpd -P _esaS -eGFP(LVA)-T _rpoC -P _Trc -a mCherry fragment. The fragment was detected by 1.0% agarose gel electrophoresis and recovered and purified by cutting the gel. And (3) connecting the linearized pTrc99a plasmid with a target fragment by using a one-step cloning kit, transforming the linearized pTrc99a plasmid into E.coli DH5 alpha, coating the E.coli DH5 alpha on an Amp plate, and selecting a single colony to carry out sequencing verification by using a verification primer so as to screen the successfully cloned plasmid. The primers are shown in Table 4.

(2) Introduction of plasmid: preparation of E.coilW3110:: esaR _I70V The esaI delta lacI is chemoconversion competent and introduced into the plasmid pTrc99a-P _esaS -lacI(LAA)-T _lpd -P _esaS -eGFP(LVA)-T _rpoC -P _Trc -mCherry, obtaining the strain E.coilW3110:: esaR _I70V ::esaIΔlacI/pTrc99a-P _esaS -lacI(LAA)-T _lpd -P _esaS -eGFP(LVA)-T _rpoC -P _Trc -mCherry。

(3) Fluorescence detection: the constructed production strain E.coilW3110:: esaR _I70V ::esaIΔlacI/pTrc99a-P _esaS -lacI(LAA)-T _lpd -P _esaS -eGFP(LVA)-T _rpoC -P _Trc Single colonies of mCherry were inoculated into 10mL of LB medium and cultured as in example 2 (8). mCherry fluorescence detection excitation wavelength: 587nm; emission wavelength: 610nm. OD thereof ₆₀₀ And the fluorescence intensity curve in the supernatant of the fermentation broth are shown in FIG. 3. A

As can be seen from the results in FIG. 3, the green fluorescent protein was used in promoter P _esaS Driven by (3), the expression level achieves dynamic down-regulation. At the same time, the expression of LacI gene is also affected by P _esaS And driving of a promoter. Changes in the intensity of green fluorescent protein were therefore used to characterize the down-regulation of the lacI gene. At the same time, the expression of the red fluorescent protein mCherry produces a significant lag. After 6 hours of culture, the red fluorescent protein began to be expressed when the cells were in late log phase. This is mainly due to the fact that the expression level of lacI starts to decrease in mid-log phase. The results show that the QSI dynamic control system consisting of the Esa quorum sensing system and the lactose manipulation subsystem can well realize the self-induction of the strain, and the P can be realized without adding an inducer IPTG _Trc Expression of the target gene driven by the promoter.

Table 4: example 4 primers

Example 5: engineered bacterial strains

E.coilW3110EYC::esaR _I70V ::esaIΔlacI/pTrc99a-P _esaS -lacI(LAA)-P _Trc Construction of-cysE-ydeD-serC-cysB and fermentation thereof

E.coli W3110EYC as the starting strain, using CRISPR-Cas 9-mediated gene Editing technology (Yu Jiang et al.2015Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas 9SApplied Environmental microbiology 81: 2506-2514) by replacing the lacI gene of its genome with the transcriptional regulator esaR _I70V And AHL synthetase esaI.

(1) Electroconception preparation: the pCas Plasmid (Addge Plasmid # 62225) was introduced into E.coilW3110EYC, and single clones were selected and cultured overnight at 30 ℃ in 10ml LB tubes containing 0.05g/L kanamycin; inoculating into 250mL shake flask containing 50mLLB culture medium at volume concentration of 1%, adding 500 μ L1 mol/L-arabinose, culturing at 150rpm and 30 deg.C to OD ₆₀₀ Equal to 0.4 to 0.6; cells were harvested by centrifugation at 4000rpm at 4 ℃ for 10min, and electroporation competent cells were prepared, as described in detail (Molecular Cloning: A Laboratory Manual,3ed edition, 99-102).

(2) Electric shock conversion: 150ng of plasmid pTD-QSI in example 2 (3) was slowly mixed with 200. Mu.l of E.coilW3110EYC/pCas electroporation competent cells, transferred into a pre-cooled 2mm cuvette, ice-cooled for about 1min, transformed by electroporation using an electroporator (MicroPluser TM, BIO-RAD), immediately added with 1mL of LB medium after the completion of the electroporation and immediately gently aspirated, transferred into a 1.5mL centrifuge tube, revived at 30 ℃ for 2-3 h, coated with a double-resistant LB plate containing 0.05g/L of kanamycin and 0.05mg/L of spectinomycin, inverted cultured at 30 ℃ for 18-20 h, single colony was picked for colony PCR validation, E.coilW0EYC was screened _I70V Δ lacI positive colonies.

(3) plasmid elimination for pTD and pCas: a positive single colony is selected and inoculated into an LB test tube containing 1mM IPTG and 0.05g/L kanamycin, the mixture is cultured overnight at 30 ℃, an LB plate containing 0.05mg/L kanamycin is streaked by using bacterial liquid, the mixture is cultured for 24 hours at 30 ℃, the single colony is selected and lightly spotted on the LB plate containing 0.05g/L kanamycin to preserve bacteria, and the streaking on the LB plate containing 0.05g/L spectinomycin is carried out to verify that the single colony which cannot grow on the LB plate containing 0.05g/L spectinomycin has the pTD-QSI plasmid successfully eliminated. Selecting a single colony of successfully eliminated pTD-QSI plasmid in an LB test tube, culturing at 37 ℃ overnight, streaking a secondary bacteria liquid on an LB plate, culturing at 37 ℃ for 12h, selecting a single colony which is lightly spotted on the non-resistance LB plate for preserving bacteria, streaking on an LB plate containing 0.05g/L kanamycin but cannot be singly spotted on an LB plate containing 0.05g/L kanamycin, successfully eliminating the pCas plasmid,finally obtaining the plasmid-free strain E.coilW3110EYC:: esaR _I70V ::esaIΔlacI。

(4) Construction of fermentation plasmid pTrc99a-P _esaS -lacI(LAA)-P _Trc -cysE-ydeD-serC-cysB: pF pline F and pF pline R are used as primers to prepare fermentation plasmid pTrc99a-P _Trc -cysE-ydeD-serC-cysB linearization, digesting the PCR product by DpnI at 37 ℃ for 3h, and recovering the DNA fragment by using a Clean up kit. In pF P _esaS LacI (LAA) F and pF P _esaS -LacI (LAA) R is used as a primer, and P is obtained by amplification _esaS -LacI (LAA) fragment, linearized P using a one-step cloning kit _Trc -cysE-ydeD-serC-cysB plasmid and P of interest _esaS connecting-LacI (LAA) fragment, transforming into E.coli DH5 alpha, coating on Amp plate, picking single colony, sequencing by using verification primer, and screening pTrc99a-P with successful clone _esaS -lacI(LAA)-P _Trc -cysE-ydeD-serC-cysB plasmid. The primers are shown in Table 5.

(5) Introducing a fermentation plasmid: the fermentation plasmid pTrc99a-P _Trc -cysE-ydeD-serC-cysB and pTrc99a-P _esaS -lacI(LAA)-P _Trc Transformation of-cysE-ydeD-serC-cysB into E.coilW3110EYC, respectively, yielded a plasmid-containing strain E.coilW3110EYC/pTrc99a-P _Trc -cysE-ydeD-serC-cysB and E.coilW3110EYC:: esaR _I70V ::esaIΔlacI/pTrc99a-P _esaS -lacI(LAA)-P _Trc -cysE-ydeD-serC-cysB. The procedure was as in example 2 (7).

(6) Fermentation verification: the constructed E.coilW3110EYC/pTrc99a-P _Trc -cysE-ydeD-serC-cysB and E.coilW3110EYC:: esaR _I70V ::esaIΔlacI/pTrc99a-P _esaS -lacI(LAA)-P _Trc the-cysE-ydeD-serC-cysB-producing strain was inoculated in a single colony in 10mL of LB medium and cultured overnight at 37 ℃ and 180 rpm. 1mL of the preculture was inoculated into a 500mL shake flask containing 100mL of SM medium and incubated at 30 ℃ and 200rpm for 12h. Inoculating 100mL of the preculture to a fermenter containing 1L of SM medium, performing fermentation culture at 25-37 deg.C and 200-800 rpm, and performing OD ₆₀₀ When the ratio is not less than 10 and not more than 30, the ratio is E.coilW3110EYC/pTrc99a-P _Trc the-cysE-ydeD-serC-cysB strain was further cultured with the addition of IPTG at a final concentration of 0.1mM for 60h. After fermentation, measurementDetermination of fermentation broth OD ₆₀₀ Then, 1mL of the fermentation broth was centrifuged at 12000rpm for 3min at room temperature, and the OD measured according to the method of example 1 was determined ₆₀₀ And the L-cysteine content in the supernatant of the fermentation broth are shown in FIG. 4.

As can be seen from FIG. 4, the production of L-cysteine was significantly improved by applying the QSI dynamic control system to the engineered L-cysteine E.coli W3100EYC/pEACB strain produced by E.coli. Strain E.coilW3110EYC:: esaR _I70V ::esaIΔlacI/pTrc99a-P _esaS -lacI(LAA)-P _Trc the-cysE-ydeD-serC-cysB achieved an L-cysteine accumulation of 9.183g/L, relative to the strain E.coilW3110EYC/pTrc99a-P _Trc The increase in-cysE-ydeD-serC-cysB was 9%. While OD of the novel strain ₆₀₀ The product reaches 25.92 and is improved by 6 percent. The above results indicate that the application of QSI dynamic control system can effectively increase the production of L-cysteine and facilitate the growth of cells.

Table 5: example 5 primers

Example 6: construction of effective strains

E.coilW3110::esaR _I70V ::esaI::P _Trc -cysMΔlacI/pTrc99a-P _esaS -lacI(LAA)-P _Trc -cysE-ydeD-serC-cysB and fermentation thereof

(1) Construction of pTarget plasmid: a pTarget-cysM plasmid capable of expressing sgRNA targeting the cysM sequence of the gene of interest was constructed. The construction method was the same as in example 2 (1). The circular plasmid pTarget-cysM was linearized using the primers pT line F and pT line R, using the pTarget-cysM plasmid as template.

(2) Construction of pTD plasmid: coli W3110 genome as template, cysM up F and cysM up R, cysM down F and cysM down R as primers (Trc promoter designed on cysM up R and cysM down F), the construction procedure was the same as in example 2 (2), to obtain pTD-cysM plasmid. The primers are shown in Table 6.

(3) Electroconversion competence preparation: the pCas Plasmid (Addge Plasmid # 62225) was introduced into E.coilW3110EYC:: esaR _I70V Preparation of E.coilW3110EYC in esaI.DELTA.lacI _I70V The preparation method of esaI delta lacI/pCas electrotransferase competence is the same as that of example 5 (1).

(4) Electric shock conversion: plasmid pTD-cysM was shock-transformed into E.coilW3110EYC:: esaR _I70V After the electric conversion competence of esaI delta lacI/pCas, E.coilW3110:: esaR is obtained by screening _I70V ::esaI::P _Trc The construction of-cysM.DELTA.lacI-positive colonies was the same as in example 5 (2).

(5) plasmid elimination for pTD and pCas: the procedure was as in example 5 (3), to obtain P _Trc Plasmid-free Strain E.coilW3110:: esaR with promoter overexpressing the cysM Gene _I70V ::esaI::P _Trc -cysMΔlacI。

(6) Introducing a fermentation plasmid: the fermentation plasmid pTrc99a-P _esaS -lacI(LAA)-P _Trc Transformation of-cysE-ydeD-serC-cysB into E.coilW3110:: esaR _I70V ::esaI::P _Trc in-cysM. DELTA. LacI, the plasmid-containing strain E.coilW3110:: esaR _I70V ::esaI::P _Trc -cysMΔlacI/pTrc99a-P _esaS -lacI(LAA)-P _Trc -cysE-ydeD-serC-cysB. The procedure was as in example 5 (5).

(7) Fermentation verification: the E.coilW3110:: esaR to be constructed _I70V ::esaI::P _Trc -cysMΔlacI/pTrc99a-P _esaS -lacI(LAA)-P _Trc the-cysE-ydeD-serC-cysB-producing strain was subjected to fermentation test and examined in accordance with the method of example 5 (6). OD ₆₀₀ And the content of L-cysteine in the supernatant of the fermentation broth are shown in FIG. 5.

In order to further increase the yield of the L-cysteine-producing E.coli engineered strain using the QSI dynamic control system, the cysM gene was overexpressed. The cysM gene is involved in the thiosulphate assimilation pathway of L-cysteine anabolism. As can be seen from FIG. 5, the promoter P was used _Trc After the cysM gene is over-expressed, the yield of L-cysteine is remarkably improved. Strain E.coilW3110:: esaR _I70V ::esaI::P _Trc -cysMΔlacI/pTrc99a-P _esaS -lacI(LAA)-P _Trc the-cysE-ydeD-serC-cysB achieved an L-cysteine accumulation of 10.82g/L, compared to the control strain E.coilW3110EYC:: esaR _I70V ::esaIΔlacI/pTrc99a-P _esaS -lacI(LAA)-P _Trc The increase in-cysE-ydeD-serC-cysB was 17%. Since the gene of cysM is subjected to P _Trc The promoter, and thus its expression, is also under the control of the QSI dynamic control system. The above results indicate that under the control of QSI dynamic control system, overexpression of cysM gene can effectively increase the yield of L-cysteine.

Table 6: example 6 primers

Example 7: construction of effective strains

E.coilW3110::esaR _I70V ::esaI::P _Trc -cysM::P _Trc -nrdHΔlacI/pTrc99a-P _esaS -lacI(LAA)-P _Trc -cysE-ydeD-serC-cysB and fermentation thereof

(1) Construction of pTarget plasmid: a pTarget-nrdH plasmid capable of expressing sgRNA targeting the nrdH sequence of the gene of interest was constructed. The construction method was the same as in example 2 (1).

(2) Construction of pTD plasmid: coli W3110 genome was used as a template, nrdH up F and nrdH up R, and nrdH down F and nrdH down R were used as primers (Trc promoter was designed on nrdH up R and nrdH down F), and the construction procedure was the same as in example 2 (2), to obtain pTD-nrdH plasmid. The primers are shown in Table 7.

(3) Electroconception preparation: the pCas Plasmid (Addgene Plasmid # 62225) was introduced into E.coilW3110:: esaR _I70V ::esaI::P _Trc E.coilW3110: esaR in-cysM. DELTA. LacI _I70V ::esaI::P _Trc The electrical transduction competence of-cysM.DELTA.lacI/pCas was prepared in the same manner as in example 5 (1).

(4) Electric shock conversion: plasmid pTD-nrdH was electroporated into E.coilW3110:: esaR _I70V ::esaI::P _Trc Screening after electrotransformation competence of-cysM delta lacI/pCas to construct E.coilW3110:: esaR _I70V ::esaI::P _Trc -cysM::P _Trc -nrdH Δ lacI positive colonies were constructed as in example 5 (2).

(5) plasmid elimination for pTD and pCas: the procedure was carried out in the same manner as in example 5 (3), obtaining the product of utilization P _Trc Plasmid-free E.coilW3110 for promoters overexpressing the nrdH Gene:: esaR _I70V ::esaI::P _Trc -cysM::P _Trc -nrdHΔlacI。

(6) Introducing a fermentation plasmid: fermenting plasmid pTrc99a-P _esaS -lacI(LAA)-P _Trc Transformation of-cysE-ydeD-serC-cysB into E.coilW3110:: esaR _I70V ::esaI::P _Trc -cysM::P _Trc in-nrdH. DELTA.lacI, the plasmid-containing strain E.coilW3110:: esaR _I70V ::esaI::P _Trc -cysM::P _Trc -nrdHΔlacI/pTrc99a-P _esaS -lacI(LAA)-P _Trc -cysE-ydeD-serC-cysB. The procedure is as in example 5 (5).

(7) Fermentation verification: the constructed production strain E.coilW3110:: esaR _I70V ::esaI::P _Trc -cysM::P _Trc -nrdHΔlacI/pTrc99a-P _esaS -lacI(LAA)-P _Trc -cysE-ydeD-serC-cysB fermentation tests and assays were carried out as described in example 5 (6). OD ₆₀₀ And the content of L-cysteine in the supernatant of the fermentation broth are shown in FIG. 6.

NrdH is the major pathway enzyme in the L-cysteine thiosulfate assimilation pathway in E.coli. Can convert the metabolic intermediate product S-Sulfocysteine into L-cysteine. As can be seen from FIG. 6, with P _Trc After overexpression of nrdH Gene by the promoter, the engineered Strain E.coilW3110:: esaR _I70V ::esaI::P _Trc -cysM::P _Trc -nrdHΔlacI/pTrc99a-P _esaS -lacI(LAA)-P _Trc The L-cysteine yield of cysE-ydeD-serC-cysB reached 11.86g/L, relative to the control strain E.coilW3110:: esaR _I70V ::esaI::P _Trc -cysMΔlacI/pTrc99a-P _esaS -lacI(LAA)-P _Trc The yield of the-cysE-ydeD-serC-cysB is improved by 10 percent. The results show that the expression of the L-cysteine synthetic gene is regulated by utilizing a QSI dynamic control system, the accumulation of the L-cysteine can be effectively improved, and an inducer IPTG is not required to be additionally added in the fermentation process. The QSI dynamic control strategyHas a wide prospect in engineering application.

Table 7: example 7 primers

Claims (7)

1. A genetically engineered bacterium for high yield of L-cysteine is constructed by the following method:

(1) Replacing lacI gene on genome of strain E.coil W3110 as chassis strain with transcription regulator esaR _I70V And AHL synthetase esaI, in the gene esaR _I70V Post-addition terminator T _lpd Addition of terminator T after the gene esaI _rpoC Obtaining the strain E.coil W3110:: esaR _I70V ::esaIΔlacI；

(2) The strain E.coil W3110 is recorded as esaR _I70V Replacement of the promoters of the cysM gene and the nrdH gene of esaI. DELTA.lacI by P _Trc Promoter to obtain the strain E.coilW3110EYC:: esaR _I70V ::esaI::cysM::nrdHΔlacI；

(3) Plasmid pTrc99a-P _Trc Replacement of the promoter of the gene lacI on cysE-ydeD-serC-cysB by P _esaS And adding LAA degradation label in front of the stop codon of the gene lacI to construct and obtain the fermentation plasmid pTrc99a-P _esaS -lacI(LAA)-P _Trc -cysE-ydeD-serC-cysB, in which LAA is a degradation tag, which was introduced into the strain obtained in step (2) to give E.coilW3110:: esaR _I70V ::esaI::P _Trc -cysM::P _Trc -nrdHΔlacI/pTrc99a-P _esaS -lacI(LAA)-P _Trc -cysE-ydeD-serC-cysB, namely the genetically engineered bacterium for high yield of L-cysteine.

2. Genetically engineered bacterium producing high yields of L-cysteine according to claim 1, characterised in that the transcription regulator esaR _I70V The sequence of the AHL synthetase (esaI) is shown as SEQ ID NO.1, and the sequence of the AHL synthetase (esaI) is shown as SEQ ID NO. 2.

3. A method for constructing a genetically engineered bacterium with high L-cysteine yield according to claim 1, which is characterized by comprising the following steps:

(1) The strain E.coil W3110 is taken as a chassis strain, and the lacI gene on the genome of the strain is replaced by a transcription regulator esaR by applying CRISPR-Cas9 gene editing technology _I70V And AHL synthetase esaI, in the gene esaR _I70V Post-addition terminator T _lpd Addition of terminator T after gene esaI _rpoC Obtaining the strain E.coil W3110:: esaR _I70V ::esaIΔlacI；

(2) The strain E.coil W3110 is recorded as esaR by applying CRISPR-Cas9 gene editing technology _I70V Replacement of promoters of the cysM gene and nrdH gene of esaI. DELTA. LacI by P _Trc Promoter to obtain the strain E.coilW3110EYC:: esaR _I70V ::esaI::cysM::nrdHΔlacI；

(3) Plasmid pTrc99a-P _Trc Replacement of the promoter of the gene lacI on-cysE-ydeD-serC-cysB by P _esaS Adding LAA degradation label before the stop codon of the gene lacI to construct a fermentation plasmid pTrc99a-P _esaS -lacI(LAA)-P _Trc -cysE-ydeD-serC-cysB, which was introduced into the strain obtained in step (2) to give E.coilW3110:: esaR _I70V ::esaI::P _Trc -cysM::P _Trc -nrdHΔlacI/pTrc99a-P _esaS -lacI(LAA)-P _Trc -cysE-ydeD-serC-cysB, namely the genetically engineered bacterium for high yield of L-cysteine.

4. The method of claim 3, wherein the transcription regulator esaR _I70V The sequence of the AHL synthetase (esaI) is shown as SEQ ID NO.1, and the sequence of the AHL synthetase (esaI) is shown as SEQ ID NO. 2.

5. The method of claim 3, wherein said promoter P _esaS The sequence of (A) is shown as SEQ ID NO.3, the sequence of the degradation label LAA is shown as SEQ ID NO.4, and the terminator T _rpoC The sequence of (A) is shown as SEQ ID NO.5, and a terminator T _lpd The sequence of (A) is shown in SEQ ID NO. 6.

6. The use of the genetically engineered bacterium of claim 1 in the preparation of L-cysteine by microbial fermentation.

7. The use according to claim 6, characterized in that the use is: inoculating the genetic engineering bacteria into a fermentation culture medium, fermenting and culturing for 60-72 h at 26-37 ℃ and 200-800 rpm, and separating and purifying the supernatant of the fermentation liquid after the fermentation is finished to obtain the L-cysteine.

Images