CN116042570A

CN116042570A - Recombinant alkaline phosphatase mutant and preparation method thereof

Info

Publication number: CN116042570A
Application number: CN202310065230.5A
Authority: CN
Inventors: 蒋析文; 朱伟伟; 张伟; 王亿潘; 李茜茜; 陈颖欣
Original assignee: Guangzhou Da'an Gene Co ltd
Current assignee: Guangzhou Da'an Gene Co ltd
Priority date: 2023-01-31
Filing date: 2023-01-31
Publication date: 2023-05-02

Abstract

The application discloses a recombinant alkaline phosphatase mutant and a preparation method thereof. In the application, the alkaline phosphatase derived from Shewanella sp is used as a modification object to modify, the amino acid sequence is subjected to site-directed mutagenesis, so that the thermosensitive property of the alkaline phosphatase is improved, the alkaline phosphatase is suitable for detection of flight mass spectrum, and the enzyme can be deactivated by heating for a short time after the reaction is finished; the alkaline phosphatase mutant provided by the application is easy to express in a prokaryotic expression system, reduces the cost and is suitable for mass production.

Description

Recombinant alkaline phosphatase mutant and preparation method thereof

Technical Field

The invention relates to the field of gene detection, in particular to a recombinant alkaline phosphatase mutant and a preparation method thereof.

Background

Alkaline phosphatase (Alkaline phosphatase, AP, E3.1.3.1) is a class of nonspecific phosphomonolipases belonging to the homodimer metalloproteinases group; it can catalyze the hydrolysis of phosphoric monoester to produce inorganic phosphoric acid and corresponding alcohols, phenols or sugar, and in the presence of high concentration of phosphate group acceptors, AP catalyzes the transfer reaction of phosphate groups; alkaline phosphatase widely exists in organisms in nature, the molecular weight and the sequence of the AP enzymes from different sources are greatly different, but the active sites of different enzymes are highly conserved, each monomer of the AP enzyme has an active center, and an active center region of the AP enzyme is composed of an aspartic acid-serine-alanine triple, arginine, water molecules, metal ions and ligand amino acids thereof. The colibacillus AP enzyme is thoroughly researched, and the catalytic mechanism is clear, so that the substrate has a wide range of action, and is widely applied to the fields of medicine, immunology and analytical biotechnology as a signal enzyme.

In the human body, the AP enzyme is taken as an important hydrolase in a phosphate metabolic pathway, and can catalyze the hydrolysis and dephosphorylation processes of various phosphate in proteins, nucleic acids and small molecules; therefore, in clinical medicine, the detection of the activity of AP in serum is often used as an important means for diagnosing and detecting diseases, for example, the detection of serum bone-like AP enzyme can be used for early diagnosis of bone metabolic diseases, detection of therapeutic effect and prognosis of diseases; in the aspect of immunology research, an enzyme-linked immunosorbent assay (ELISA) reaction is performed by using an AP enzyme-labeled antibody, namely, a detected substance mainly interacts with a chromogenic substrate or a dephosphorylated substrate which can emit light after reacting with an alkaline phosphatase, so that the stability and the sensitivity are better; meanwhile, alkaline phosphatase can catalyze and remove the phosphate group at the 5' -end of the DNA molecule, thereby preventing the carrier from self-linking, and replacing isotope labeled nucleotide probes for molecular hybridization and the like.

Among alkaline phosphatase products commonly used in the market at present, bovine small intestine alkaline phosphatase (MAP) has the highest activity which is about 20-40 times of that of Escherichia coli alkaline phosphatase (EAP), but MAP has poor thermal stability, and needs Mg2+ activation, while Escherichia coli has low expression cost and good thermal stability, but the activity of the product is lower. Therefore, how to obtain high-activity EAP enzyme while maintaining good thermal stability is the main current modification direction. In the prior art, although some researchers improve the enzyme activity through mutation transformation, the transformation bacteria are not suitable for large-scale production, and after the transformation EAP enzyme engineering bacteria are subjected to volume expansion culture, the expression quantity of target proteins is greatly reduced, so that the production and the application of the AP enzyme are restricted. Therefore, how to develop an alkaline phosphatase with high activity and high thermostability is a problem to be solved.

Disclosure of Invention

The invention aims to provide a thermosensitive alkaline phosphatase mutant.

It is another object of the present invention to provide a nucleic acid molecule.

It is another object of the present invention to provide vectors that are adapted to polynucleotide sequences encoding alkaline phosphatase and mutants thereof.

It is another object of the present invention to provide a method for preparing alkaline phosphatase and mutants thereof.

Another object of the present invention is to provide a kit comprising a polynucleotide sequence encoding alkaline phosphatase and mutants thereof.

To solve the above technical problem, the first aspect of the present invention provides an alkaline phosphatase mutant having a mutation at one or more sites in a wild-type alkaline phosphatase sequence selected from the group consisting of: w348, Q349, V365, S369 and R372; wherein, the amino acid residue number adopts the number shown in SEQ ID NO. 7.

In some preferred embodiments, the wild-type alkaline phosphatase has an amino acid sequence as set forth in SEQ ID NO. 7.

In some preferred embodiments, the number of mutation sites is 1 to 5, e.g., 1, 2, 3, 4, or 5.

In some preferred embodiments, the amino acid sequence of the alkaline phosphatase mutant has at least 80% homology to SEQ ID No. 7; more preferably, it has a homology of at least 90%; most preferably, having at least 95% homology; such as having at least 96%, 97%, 98%, 99% homology.

In some preferred embodiments, the alkaline phosphatase mutant is mutated on the basis of the wild-type alkaline phosphatase as set forth in SEQ ID NO.7, and the alkaline phosphatase mutant comprises a mutation site selected from the group consisting of: W348A, Q349A, V365A, S369A and R372A.

In some preferred embodiments, the alkaline phosphatase mutant is selected from the group consisting of:

in some preferred embodiments, the amino acid sequence of the alkaline phosphatase is selected from the group consisting of:

(i) Amino acid sequences as shown in SEQ ID NO. 1-6; and

(ii) Polynucleotides having greater than 95% homology with the amino acid sequences shown in SEQ ID NO. 1-6.

In a second aspect of the invention there is provided a polynucleotide molecule encoding an alkaline phosphatase mutant according to the first aspect of the invention.

In a third aspect of the invention there is provided a vector comprising a nucleic acid molecule according to the second aspect of the invention.

In a fourth aspect of the invention there is provided a host cell comprising a vector or chromosome according to the third aspect of the invention incorporating a nucleic acid molecule according to the second aspect of the invention.

In some preferred embodiments, the host cell is a prokaryotic cell, or a eukaryotic cell.

In some preferred embodiments, the host cell is E.coli (Escherichia coli).

In some preferred embodiments, the host cell is an E.coli BL21 (DE 3) strain.

In some preferred embodiments, the eukaryotic cell is a yeast cell.

In a fifth aspect, the present invention provides a method for producing an alkaline phosphatase mutant according to the first aspect, comprising the steps of:

(i) Culturing the host cell of the fourth aspect of the invention under suitable conditions to express the alkaline phosphatase mutant; and

(ii) Isolating the alkaline phosphatase mutant.

In some preferred embodiments, the host cell is cultured in SB, TB, LB, SOC medium, more preferably in TB, and LB medium, most preferably in TB medium.

In some preferred embodiments, the host cell is cultured at a temperature of 16 to 19 ℃ or 35 to 39 ℃.

In a sixth aspect of the invention, there is provided a kit comprising an alkaline phosphatase mutant according to the first aspect of the invention.

Compared with the prior art, the invention has at least the following advantages:

(1) The invention uses the alkaline phosphatase from Shewanella sp as the transformation object to transform, and makes site-directed mutation to the amino acid sequence, which improves the heat sensitivity of the alkaline phosphatase, so that the alkaline phosphatase is suitable for the detection of flight mass spectrum, and the enzyme can be deactivated by heating in a short time after the reaction;

(2) The alkaline phosphatase mutant provided by the invention is easy to express in a prokaryotic expression system, reduces the cost and is suitable for mass production.

It is understood that within the scope of the present invention, the above-described technical features of the present invention and technical features specifically described below (e.g., in the examples) may be combined with each other to constitute new or preferred technical solutions. And are limited to a space, and are not described in detail herein.

Drawings

One or more embodiments are illustrated by way of example and not limitation in the figures of the accompanying drawings.

FIG. 1 is a schematic three-dimensional structure of Shewanella sp-derived alkaline phosphatase according to an embodiment of the present invention;

FIG. 2 is a schematic diagram of an alignment of Shewanella sp and E.coli derived alkaline phosphatase structures according to an embodiment of the present invention;

FIG. 3 is a partial enlarged view of the structural alignment of Shewanella sp-derived alkaline phosphatase according to an embodiment of the present invention;

FIG. 4 is a graph showing the results of identification of the small amount of E.coli expression of alkaline phosphatase in accordance with an embodiment of the present invention;

FIG. 5 is a diagram of an alkaline phosphatase nickel column purification electrophoresis in accordance with an embodiment of the present invention;

FIG. 6 is a diagram of QP column purification electrophoresis of alkaline phosphatase nickel column according to an embodiment of the invention;

FIG. 7 is a graph of alkaline phosphatase/mutant enzyme activity assay criteria according to an embodiment of the invention;

FIG. 8 is a heat sensitivity graph of alkaline phosphatase/mutants according to an embodiment of the invention.

Detailed Description

In the prior art, alkaline phosphatase with good heat resistance (inactivated by 5min at 65 ℃) is mainly a bovine small intestine source and a shrimp source. The alkaline phosphatase of bovine small intestine source is mostly extracted and purified from natural products, the alkaline phosphatase of shrimp source is mostly expressed by yeast, and the prokaryotic expression activities of escherichia coli source (E.coli) and marine efficient dephosphorization bacteria source (Shewanella sp) are higher, but the heat resistance is poor, and the heat inactivation at 65 ℃ is not ideal. The present inventors have found, through extensive and intensive studies, that mutants of alkaline phosphatase as described in the present invention are unexpectedly excellent in heat sensitivity while retaining good enzyme activity.

Alkaline phosphatase mutant

In the invention, the target protein is alkaline phosphatase derived from Shewanella sp (the amino acid sequence is shown as SEQ ID NO. 7), the mutant is obtained by mutating the alkaline phosphatase by a preset mutation mode, and the preset mutation mode comprises mutation at one or more positions selected from the following positions: w348, Q349, V365, S369 and R372. Preferably, the amino acid selected from the mutation site is mutated to alanine, and the predetermined mutation pattern includes any one or a combination of several of the following: W348A, Q349A, V365A, S369A and R372A. When at least two, more preferably at least three, more preferably at least four, more preferably all of the amino acids in these mutation sites are mutated and mutated to alanine (a).

In some embodiments of the invention, the amino acid sequence of the alkaline phosphatase mutant is selected from any one of,

(i) Amino acid sequences as shown in SEQ ID NO. 1-6; and

The protein of interest of the present invention can be obtained by methods conventional in the art, such as site-directed mutagenesis. And replacing one or more bases in the target nucleic acid fragment or plasmid with other bases by a Polymerase Chain Reaction (PCR) method and the like, transforming the plasmid containing the mutated nucleic acid fragment into escherichia coli to obtain a transformant, and culturing the transformant to obtain the mutant. And (3) carrying out site-directed mutagenesis by using a commercially available site-directed mutagenesis kit to obtain mutants.

Nucleic acid sequences encoding mutants of proteins of interest

In the present invention, the full-length nucleotide sequence of the mutant of the target protein or the element thereof or a fragment thereof can be usually obtained by PCR amplification, recombination or artificial synthesis. For the PCR amplification method, primers can be designed based on the disclosed nucleotide sequences, particularly open reading frame sequences, and amplified to obtain the relevant sequences using a commercially available cDNA library or a cDNA library prepared according to a conventional method known to those skilled in the art as a template. When the sequence is longer, it is often necessary to perform two or more PCR amplifications, and then splice the amplified fragments together in the correct order. Once the relevant sequences are obtained, recombinant methods can be used to obtain the relevant sequences in large quantities. This is usually done by cloning it into a vector, transferring it into a cell, and isolating the relevant sequence from the propagated host cell by conventional methods.

Furthermore, the sequences concerned, in particular fragments of short length, can also be synthesized by artificial synthesis. In general, fragments of very long sequences are obtained by first synthesizing a plurality of small fragments and then ligating them.

Methods of amplifying DNA/RNA using PCR techniques are preferred for obtaining the genes of the present invention. Primers for PCR can be appropriately selected according to the sequence information of the present invention disclosed herein, and can be synthesized by a conventional method. The amplified DNA/RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.

Synonymous codon bias optimization

To overcome the potential problem of reduced yield when expressing heterologous proteins in host cells, the present invention relates to synonymous codon-biased optimized polynucleotide sequences. And (3) optimizing the synonymous codon preference of the obtained target gene sequence, and adjusting the synonymous codon of the gene according to the codon preference of a host, so that rare codons are eliminated, and the expression efficiency of the heterologous gene is improved. The target gene sequence optimized for synonymous codon preference may express the same amino acid sequence as the target protein. Embodiments of the invention relate to optimized codon sequences obtained by codon optimization of the gene sequence encoding an alkaline phosphatase mutant, as shown in SEQ ID NOS.8-13, and polynucleotides having a homology of greater than 80%, preferably greater than 85%, more preferably greater than 90%, more preferably greater than 91%, more preferably greater than 95% to the sequences shown in SEQ ID NOS.8-13; and polynucleotides complementary to the sequences shown in SEQ ID NOS.8-13.

Vector of target gene

The invention also relates to vectors comprising the polynucleotides of the invention. "vector" in the present invention means a linear or circular DNA molecule comprising a fragment encoding a protein of interest operably linked to other fragments providing for its transcription. Such additional fragments may include promoter and terminator sequences, and may optionally include one or more origins of replication, one or more selectable markers, an enhancer, a polyadenylation signal, a vector, and the like. The vector fragment may be derived from the host organism, another organism, plasmid or viral DNA, or may be synthetic. The vector may be any expression vector, synthetic or conveniently subjected to recombinant DNA procedures, the choice of vector generally being dependent on the host cell into which the vector is to be introduced. Thus, the vector may be an autonomously replicating vector, i.e. a vector, which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid. Alternatively, the vector may be one that, when introduced into the host cell, integrates into the host cell genome and replicates with the chromosome with which it is integrated. In one embodiment, the vector of the invention is an expression vector. In one embodiment of the invention pET-28a (+) is selected as a vector to obtain higher expression efficiency.

Methods well known to those skilled in the art can be used to construct expression vectors containing the coding DNA sequences of the proteins of the invention and appropriate transcriptional/translational control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence may be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Illustratively, the insertion of the exogenous DNA fragment is accomplished by cleaving the vector DNA molecule with a DNA endonuclease into a linear molecule that can be linked to the exogenous gene, and then ligating the codon optimized fragment of the gene of interest to the vector, optionally with a single restriction site cohesive end ligation, double restriction site directional cloning, cohesive end ligation of different restriction sites, blunt end ligation, artificial linker ligation, or end ligation with an oligonucleotide.

Transformation of host cells with vectors containing genes of interest

The invention also relates to host cells genetically engineered with the vector or fusion protein coding sequences of the invention. The vector containing the codon-optimized gene of interest may be inserted, transfected or otherwise transformed into a host cell by known methods to obtain a transformant containing the codon-optimized gene of interest of the present invention and capable of expressing the protein of interest. A "host cell" in the present invention is a cell into which an exogenous polynucleotide and/or vector has been introduced. The host cell may be a eukaryotic host cell or a prokaryotic host cell, the host cell is preferably a bacterium, and is preferably E.coli, more preferably E.coli ROSETTA (DE 3) strain (Escherichia coli Rosetta (DE 3) strain).

Method for producing target protein

The invention also relates to a method for preparing the target protein, and the polynucleotide sequence can be used for expressing or producing recombinant protein. Generally, there are the following steps:

(1) Transforming or transducing a suitable host cell with a polynucleotide (or variant) encoding a protein of the invention, or with a recombinant expression vector comprising the polynucleotide;

(2) A host cell cultured in a suitable medium;

(3) Separating and purifying the protein from the culture medium or the cells.

Wherein, the transformation or transduction of the recombinant expression vector containing the polynucleotide of the step (1) into a suitable host cell can be performed by conventional techniques well known to those skilled in the art, and when the host is E.coli, a heat shock method, an electrotransformation method, etc. can be selected.

The transformant obtained can be cultured by a conventional method to express the polypeptide encoded by the gene of the present invention. Depending on the host cell used, the medium used in the culture may be selected from a variety of conventional media, preferably SB, TB, LB or SOC media. The culture is carried out under conditions suitable for the growth of the host cell. After the host cells have grown to the appropriate cell density, the selected promoters are induced by suitable means (e.g., temperature switching or chemical induction) and the cells are cultured for an additional period of time. In order to promote the expression of the target protein and to increase the expression level of the soluble protein, a preferred embodiment of the present invention uses a host cell cultured in TB or LB medium, and the medium used contains a kanamycin resistance gene.

To further promote soluble expression of the protein of interest, in a preferred embodiment of the invention, the host cell is cultured to OD ₆₀₀ After 0.6-0.8 induction with IPTG and further incubation at 17 to 19 ℃ or 35 to 39 ℃ for about 8 to 12 hours.

The protein in the above method may be expressed in the cell, or on the cell membrane, or secreted outside the cell. If desired, the proteins can be isolated and purified by various separation methods using their physical, chemical and other properties. Thus, in the present invention, after the successful culture to obtain the target protein, it also involves a step of separating and purifying it, for example, in step (3), separating and purifying the protein from the culture medium to obtain the target protein in high purity. Although methods for purifying the protein of interest may be conventional means well known to those skilled in the art, including but not limited to: conventional renaturation treatment, treatment with a protein precipitant (salting-out method), centrifugation, osmotic sterilization, super-treatment, super-centrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques and combinations of these methods.

Dialyzing the eluted and purified target protein product, and collecting a dialyzed sample. The dialysis samples were measured for concentration by BCA method and the yield was calculated.

In the present disclosure, any exemplary or exemplary language (e.g., ") provided for certain embodiments herein is used merely to better present the disclosure and does not limit the scope of the disclosure as otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

If the definition or use of a term in a reference is inconsistent or inconsistent with the definition of that term described herein, the definition of the term described herein applies and the definition of the term in the reference does not apply.

Various terms used herein are shown below. If a term used in a claim is not defined below, the broadest definition persons in the pertinent art have given that term are given as reflected in publications or issued patents that are printed at the time of application.

As used herein, the term "isolated" refers to a nucleic acid or polypeptide that is separated from at least one other component (e.g., a nucleic acid or polypeptide) that the nucleic acid or polypeptide is found in its natural source. In one embodiment, the nucleic acid or polypeptide is found to be present only (if any) in solvents, buffers, ions or other components that are normally present in its solution. The terms "isolated" and "purified" do not include nucleic acids or polypeptides that are present in their natural source.

As used herein, the terms "polynucleotide" and "polynucleotide sequence" may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. The DNA may be single-stranded or double-stranded. The DNA may be a coding strand or a non-coding strand.

The invention also relates to variants of the above polynucleotides which encode protein fragments, analogs and derivatives having the same amino acid sequence as the invention. Variants of the polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. Such nucleotide variants include substitution variants, deletion variants and insertion variants. As known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the encoded polypeptide.

As used herein, the term "codon optimization" refers to a manner of improving the efficiency of gene synthesis by avoiding the use of low-availability or rare codons according to codon usage differences exhibited by organisms (including e.coli, yeast, mammalian blood cells, plant cells, insect cells, etc.) that actually do protein expression or production.

As used herein, the terms "homology" and "identity" are used interchangeably to refer to the percentage of identical (i.e., identical) nucleotides or amino acids between two or more polynucleotides or polypeptides. Sequence identity between two or more polynucleotides or polypeptides can be measured by the following methods. The nucleotide or amino acid sequence of a polynucleotide or polypeptide is aligned, the number of positions in the aligned polynucleotide or polypeptide that contain the same nucleotide or amino acid residue is scored and compared to the number of positions in the aligned polynucleotide or polypeptide that contain a different nucleotide or amino acid residue. Polynucleotides may differ at one position, for example, according to the inclusion of different nucleotides (i.e., substitutions or variations) or deletions of nucleotides (i.e., insertions or deletions of one or two nucleotides in the polynucleotide). The polypeptides may differ at one position, for example, by containing an amino acid (i.e., substitution or variation) or a deletion of an amino acid (i.e., an amino acid or deletion of an amino acid inserted into one or both polypeptides). Sequence identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of amino acid residues in the polynucleotide or polypeptide. For example, percent identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of nucleotide or amino acid residues in the polynucleotide or polypeptide, and then multiplying by 100.

As used herein, the terms "sequence complementary" and "reverse sequence complementary" are used interchangeably to refer to a sequence that is opposite in direction to and complementary to the original polynucleotide sequence. For example, if the original polynucleotide sequence is actaac, then its reverse complement is GTTCAT.

As used herein, the term "expression" includes any step involving the production of a polypeptide in a host cell, including, but not limited to, transcription, translation, post-translational modification, and secretion. After expression, the host cells or expression products can be harvested, i.e.recovered.

The present invention will be further described with reference to specific embodiments in order to make the objects, technical solutions and advantages of the embodiments of the present invention more apparent. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental methods, in which specific conditions are not noted in the following examples, are generally conducted under conventional conditions or under conditions recommended by the manufacturer. Percentages and parts are weight percentages and parts unless otherwise indicated. The experimental materials and reagents used in the following examples were obtained from commercial sources unless otherwise specified.

Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs, it is to be noted that the terms used herein are used merely to describe specific embodiments and are not intended to limit the exemplary embodiments of this application.

Example 1

In this example, the modified region and modification strategy of alkaline phosphatase were determined by three-dimensional structural comparison, and several modified alkaline phosphatase mutants were obtained. The specific steps are as follows:

(1) Three-dimensional structure comparison and reconstruction strategy

And (3) selecting alkaline phosphatase from Shewanella sp as a modification object, carrying out three-dimensional structure modeling, and establishing a three-dimensional structure of Shewanella sp by adopting alpha fold2 (shown in figure 1). The structure of Shewanella sp-derived alkaline phosphatase and E.coli-derived alkaline phosphatase were aligned, and the results of the alignment are shown in FIG. 2.

From fig. 2, the following can be concluded:

first, R166 and D153 are active site amino acids. As shown in FIG. 2, orange is Shewanella sp-derived SAP, light cyan is E.coli-derived SAP, and green is substrate, including Zn, mg, and PO4 molecules. Structural alignment found that the active sites of Shewanella sp-derived and E.coli-derived alkaline phosphatases were highly conserved, wherein the two amino acids in red were R166 and D153, respectively, which bind to the substrate, and were initially identified as important active site amino acids.

Second, the four helices of amino acids 330-390 are the major engineering regions. As shown in FIG. 3, shewanella sp-derived SAP differs from E.coli-derived SAP primarily at the four helices of 330-390 amino acids (FIG. 3). Wherein multiple amino acids of two helices participate in the formation of intramolecular interactions, these sites are remote from the active center, and mutants thereof may attenuate or disrupt the formation of intramolecular helices, thereby achieving a reduction in thermal stability. The amino acid residues 330-390 are mutated respectively to construct mutants, and most of the mutants are found to have low expression activity and require further testing to determine mutation sites.

(2) Determination of mutation sites by testing

The partial mutants obtained after the test are shown in table 1 below:

TABLE 1

Amino acid position	Amino acid name	Mutable amino acids
			348	Trp(W)	Ala(A)
349	Gln(Q)	Ala(A)
			365	Val(V)	Ala(A)
369	Ser(S)	Ala(A)
			372	Arg(R)	Ala(A)

The test results showed that, of the mutation sites listed in Table 1, both Trp348 and Arg372 were extremely important, and thus, could be used as preferential engineering sites.

(3) Determination of alkaline phosphatase mutant sequences

As shown in Table 2, the sequence 1-5 is single point mutant of Trp348, gln 349, val365, ser 369 and Arg372, and the sequence 6 is multi-point mutant (Trp 348/Gln 349/Val365/Ser 369/Arg 372).

TABLE 2

Sequence number	Name of the name
		SEQ ID NO.1	Alkaline phosphatase mutant A-1
SEQ ID NO.2	Alkaline phosphatase mutant A-2
		SEQ ID NO.3	Alkaline phosphatase mutant A-3
SEQ ID NO.4	Alkaline phosphatase mutant A-4
		SEQ ID NO.5	Alkaline phosphatase mutant A-5
SEQ ID NO.6	Alkaline phosphatase mutant B-1
		SEQ ID NO.7	Alkaline phosphatase before mutation

SEQ ID NO.1:

MSVTKTSLLLLTIGLVFSASSKAAPELENGPMKPPSKPKNIVIMVGDGMGPSYTSAYRYFKDNPDTEEVEQTVFDRLLVGMASTYPASVSGYVTDSAAAATALATGVKSYNGAISVDTQKQHLPTMLEKAKALGLSTGVAVTSQINHATPAAFLAHNESRKNYDALALSYLDTNADVLLGGGQKYFSPELLEKFTAKGYQHISRFEDLATITQPKVIGLFAQVQLPWALDEKNANRLSTMTQKALDLLSQNEQGFVLLVEGSLIDWAGHSNDIANTMGEMDEFANALEVVEQFVRQHPDTLMVATADHNTGGLSIGAGGDYRWNPEILRNMSASTDTLALAALGGDQAQADLARGLGFELNADEVTQLSTARMQGLETMTEAIRKIIDKRTGTGWTTSGHTGTDVQVFAAGPAAELFNGHQDNTDIANKIFTLLPKPKKAKTE

SEQ ID NO.2:

MSVTKTSLLLLTIGLVFSASSKAAPELENGPMKPPSKPKNIVIMVGDGMGPSYTSAYRYFKDNPDTEEVEQTVFDRLLVGMASTYPASVSGYVTDSAAAATALATGVKSYNGAISVDTQKQHLPTMLEKAKALGLSTGVAVTSQINHATPAAFLAHNESRKNYDALALSYLDTNADVLLGGGQKYFSPELLEKFTAKGYQHISRFEDLATITQPKVIGLFAQVQLPWALDEKNANRLSTMTQKALDLLSQNEQGFVLLVEGSLIDWAGHSNDIANTMGEMDEFANALEVVEQFVRQHPDTLMVATADHNTGGLSIGAGGDYRWNPEILRNMSASTDTLALAALGGDQWAADLARGLGFELNADEVTQLSTARMQGLETMTEAIRKIIDKRTGTGWTTSGHTGTDVQVFAAGPAAELFNGHQDNTDIANKIFTLLPKPKKAKTE

SEQ ID NO.3:

MSVTKTSLLLLTIGLVFSASSKAAPELENGPMKPPSKPKNIVIMVGDGMGPSYTSAYRYFKDNPDTEEVEQTVFDRLLVGMASTYPASVSGYVTDSAAAATALATGVKSYNGAISVDTQKQHLPTMLEKAKALGLSTGVAVTSQINHATPAAFLAHNESRKNYDALALSYLDTNADVLLGGGQKYFSPELLEKFTAKGYQHISRFEDLATITQPKVIGLFAQVQLPWALDEKNANRLSTMTQKALDLLSQNEQGFVLLVEGSLIDWAGHSNDIANTMGEMDEFANALEVVEQFVRQHPDTLMVATADHNTGGLSIGAGGDYRWNPEILRNMSASTDTLALAALGGDQWQADLARGLGFELNADEATQLSTARMQGLETMTEAIRKIIDKRTGTGWTTSGHTGTDVQVFAAGPAAELFNGHQDNTDIANKIFTLLPKPKKAKTE

SEQ ID NO.4:

MSVTKTSLLLLTIGLVFSASSKAAPELENGPMKPPSKPKNIVIMVGDGMGPSYTSAYRYFKDNPDTEEVEQTVFDRLLVGMASTYPASVSGYVTDSAAAATALATGVKSYNGAISVDTQKQHLPTMLEKAKALGLSTGVAVTSQINHATPAAFLAHNESRKNYDALALSYLDTNADVLLGGGQKYFSPELLEKFTAKGYQHISRFEDLATITQPKVIGLFAQVQLPWALDEKNANRLSTMTQKALDLLSQNEQGFVLLVEGSLIDWAGHSNDIANTMGEMDEFANALEVVEQFVRQHPDTLMVATADHNTGGLSIGAGGDYRWNPEILRNMSASTDTLALAALGGDQWQADLARGLGFELNADEVTQLATARMQGLETMTEAIRKIIDKRTGTGWTTSGHTGTDVQVFAAGPAAELFNGHQDNTDIANKIFTLLPKPKKAKTE

SEQ ID NO.5:

MSVTKTSLLLLTIGLVFSASSKAAPELENGPMKPPSKPKNIVIMVGDGMGPSYTSAYRYFKDNPDTEEVEQTVFDRLLVGMASTYPASVSGYVTDSAAAATALATGVKSYNGAISVDTQKQHLPTMLEKAKALGLSTGVAVTSQINHATPAAFLAHNESRKNYDALALSYLDTNADVLLGGGQKYFSPELLEKFTAKGYQHISRFEDLATITQPKVIGLFAQVQLPWALDEKNANRLSTMTQKALDLLSQNEQGFVLLVEGSLIDWAGHSNDIANTMGEMDEFANALEVVEQFVRQHPDTLMVATADHNTGGLSIGAGGDYRWNPEILRNMSASTDTLALAALGGDQWQADLARGLGFELNADEVTQLSTAAMQGLETMTEAIRKIIDKRTGTGWTTSGHTGTDVQVFAAGPAAELFNGHQDNTDIANKIFTLLPKPKKAKTE

SEQ ID NO.6：

MSVTKTSLLLLTIGLVFSASSKAAPELENGPMKPPSKPKNIVIMVGDGMGPSYTSAYRYFKDNPDTEEVEQTVFDRLLVGMASTYPASVSGYVTDSAAAATALATGVKSYNGAISVDTQKQHLPTMLEKAKALGLSTGVAVTSQINHATPAAFLAHNESRKNYDALALSYLDTNADVLLGGGQKYFSPELLEKFTAKGYQHISRFEDLATITQPKVIGLFAQVQLPWALDEKNANRLSTMTQKALDLLSQNEQGFVLLVEGSLIDWAGHSNDIANTMGEMDEFANALEVVEQFVRQHPDTLMVATADHNTGGLSIGAGGDYRWNPEILRNMSASTDTLALAALGGDQAAADLARGLGFELNADEATQLATAAMQGLETMTEAIRKIIDKRTGTGWTTSGHTGTDVQVFAAGPAAELFNGHQDNTDIANKIFTLLPKPKKAKTE

SEQ ID NO.7：

MSVTKTSLLLLTIGLVFSASSKAAPELENGPMKPPSKPKNIVIMVGDGMGPSYTSAYRYFKDNPDTEEVEQTVFDRLLVGMASTYPASVSGYVTDSAAAATALATGVKSYNGAISVDTQKQHLPTMLEKAKALGLSTGVAVTSQINHATPAAFLAHNESRKNYDALALSYLDTNADVLLGGGQKYFSPELLEKFTAKGYQHISRFEDLATITQPKVIGLFAQVQLPWALDEKNANRLSTMTQKALDLLSQNEQGFVLLVEGSLIDWAGHSNDIANTMGEMDEFANALEVVEQFVRQHPDTLMVATADHNTGGLSIGAGGDYRWNPEILRNMSASTDTLALAALGGDQWQADLARGLGFELNADEVTQLSTARMQGLETMTEAIRKIIDKRTGTGWTTSGHTGTDVQVFAAGPAAELFNGHQDNTDIANKIFTLLPKPKKAKTE

Example 2

In this example, from the alkaline phosphatase mutant sequences and the unmutated Shewanella sp alkaline phosphatase sequences obtained in example 1, an adapted prokaryotic expression method was developed, and several E.coli-expressed alkaline phosphatase mutants and alkaline phosphatases were obtained. The specific steps are as follows:

(1) Construction of alkaline phosphatase mutant plasmids

According to the amino acid sequence of Shewanella sp alkaline phosphatase, removing the signal peptide aa1-23 at the N end to obtain a sequence shown as SEQ ID NO.7, analyzing the SEQ ID NO.7 to obtain a corresponding gene sequence, optimizing the preference of the synonymous codon of escherichia coli to obtain an optimized codon I, connecting the optimized codon I with a vector pET-28a (+), and entrusting the synthesis of recombinant plasmid C by the Souzhou Jin Weizhi biotechnology Co.

From several Shewanella sp alkaline phosphatase mutant sequences obtained in example 1, corresponding gene sequences were obtained by analysis and were subjected to E.coli synonymous codon bias optimization, respectively, to obtain optimized codons as shown in Table 3. These optimized codon ligation vectors pET-28a (+), were committed to the synthesis of several recombinant plasmids by Suzhou Jin Weizhi Biotechnology Co.

TABLE 3 Table 3

Optimized codon I (SEQ ID NO. 8):

GCTCCAGAACTGGAAAACGGTCCAATGAAGCCTCCGTCTAAACCGAAGAACATTGTCATTATGGTCGGTGACGGTATGGGTCCGAGCTACACTTCCGCATATCGTTACTTCAAAGACAACCCAGACACCGAGGAGGTTGAACAGACTGTTTTCGACCGCCTGCTGGTGGGTATGGCAAGCACCTACCCTGCAAGCGTTTCCGGCTACGTAACTGATAGCGCAGCGGCAGCTACCGCTCTGGCTACTGGTGTTAAATCTTACAATGGTGCGATTTCTGTTGACACCCAAAAGCAGCATCTGCCAACTATGCTGGAAAAAGCTAAAGCTCTGGGCCTGTCTACCGGCGTAGCGGTTACCTCTCAGATCAACCACGCGACTCCGGCGGCATTTCTGGCTCACAACGAAAGCCGCAAAAACTACGACGCTCTGGCTCTGAGCTATCTGGACACTAACGCGGATGTACTGCTGGGTGGCGGTCAGAAATACTTCTCTCCGGAGCTGCTGGAAAAGTTCACTGCGAAAGGCTACCAGCACATCAGCCGTTTCGAAGATCTGGCAACCATTACGCAGCCAAAAGTCATCGGTCTGTTCGCCCAAGTGCAGCTGCCGTGGGCACTGGATGAAAAAAACGCCAATCGTCTGTCCACCATGACTCAGAAAGCACTGGACCTGCTGTCTCAGAACGAACAGGGTTTCGTTCTGCTGGTCGAAGGCAGCCTGATTGACTGGGCAGGTCATTCCAACGACATCGCAAACACCATGGGTGAAATGGATGAATTCGCCAACGCCCTGGAGGTAGTTGAACAGTTCGTACGTCAGCACCCGGACACTCTGATGGTTGCAACCGCGGACCACAATACCGGCGGTCTGTCTATTGGTGCAGGTGGTGACTACCGTTGGAATCCGGAAATCCTGCGTAACATGAGCGCCTCTACTGATACTCTGGCACTGGCTGCGCTGGGTGGTGATCAATGGCAGGCTGATCTGGCACGTGGCCTGGGTTTCGAACTGAACGCGGATGAAGTCACTCAGCTGTCTACCGCTCGTATGCAGGGTCTGGAAACCATGACCGAAGCAATCCGTAAGATCATCGATAAACGCACCGGTACGGGTTGGACTACTAGCGGTCACACCGGTACCGATGTTCAGGTATTCGCCGCTGGTCCGGCAGCTGAACTGTTCAACGGTCACCAGGACAACACCGACATCGCGAACAAAATCTTCACTCTGCTGCCAAAACCGAAAAAAGCGAAAACCGAG

optimization codon II-1 (SEQ ID NO. 9):

GCTCCAGAACTGGAAAACGGCCCGATGAAACCACCATCTAAACCTAAAAACATCGTGATTATGGTAGGTGATGGTATGGGTCCATCTTACACTTCTGCGTACCGTTACTTCAAAGACAACCCGGACACTGAAGAAGTTGAACAGACTGTTTTTGACCGTCTGCTGGTTGGTATGGCGTCCACTTATCCGGCTTCCGTTTCTGGTTACGTAACCGATTCTGCGGCTGCTGCTACTGCTCTGGCGACTGGTGTTAAATCTTATAACGGTGCAATCTCCGTCGACACCCAAAAACAGCACCTGCCGACCATGCTGGAAAAGGCTAAAGCTCTGGGTCTGTCCACCGGCGTCGCTGTTACCAGCCAGATCAACCATGCTACCCCAGCGGCCTTCCTGGCGCATAATGAAAGCCGCAAAAACTACGATGCGCTGGCACTGTCTTACCTGGACACTAACGCGGACGTACTGCTGGGTGGTGGTCAGAAATACTTCTCTCCGGAACTGCTGGAAAAGTTCACCGCTAAGGGTTACCAGCACATCAGCCGTTTTGAAGATCTGGCAACCATTACCCAGCCGAAAGTGATCGGCCTGTTTGCCCAGGTTCAGCTGCCTTGGGCGCTGGATGAGAAAAACGCGAATCGTCTGTCCACTATGACTCAGAAAGCGCTGGATCTGCTGTCTCAGAACGAACAGGGCTTTGTCCTGCTGGTGGAAGGCAGCCTGATCGATTGGGCGGGTCACTCCAACGATATCGCTAACACCATGGGCGAAATGGATGAATTTGCTAATGCGCTGGAAGTGGTTGAACAGTTTGTCCGTCAGCACCCGGACACGCTGATGGTTGCGACTGCTGATCACAACACCGGTGGTCTGTCTATCGGTGCAGGTGGTGATTACCGCTGGAACCCTGAAATTCTGCGTAACATGAGCGCTTCTACGGATACTCTGGCGCTGGCTGCTCTGGGTGGCGATCAAGCACAGGCAGATCTGGCACGTGGTCTGGGTTTTGAGCTGAACGCAGATGAGGTGACTCAGCTGTCCACGGCGCGTATGCAGGGTCTGGAAACCATGACCGAAGCGATCCGTAAAATCATTGACAAACGCACCGGCACTGGTTGGACTACCTCCGGTCACACTGGCACCGATGTTCAGGTTTTCGCTGCAGGTCCGGCAGCAGAACTGTTTAACGGTCATCAGGATAACACCGACATTGCAAACAAAATCTTCACTCTGCTGCCAAAACCAAAAAAAGCGAAAACCGAA

optimization codon II-2 (SEQ ID NO. 10):

GCTCCGGAACTGGAAAATGGCCCTATGAAACCGCCGTCTAAACCTAAAAACATCGTAATCATGGTTGGCGATGGCATGGGTCCGTCCTATACTTCTGCCTACCGCTATTTCAAAGACAACCCAGACACCGAGGAAGTTGAACAGACTGTATTCGACCGTCTGCTGGTTGGTATGGCTTCCACCTATCCGGCATCTGTTTCTGGCTATGTAACCGATTCTGCAGCTGCAGCCACTGCACTGGCAACCGGTGTGAAATCTTATAACGGTGCTATTTCTGTTGATACGCAGAAACAGCACCTGCCGACCATGCTGGAAAAAGCGAAAGCACTGGGCCTGTCCACCGGTGTTGCTGTTACCTCTCAGATCAACCATGCGACCCCGGCTGCTTTTCTGGCACATAACGAATCCCGTAAGAACTACGACGCGCTGGCCCTGTCTTATCTGGATACCAACGCGGATGTACTGCTGGGTGGCGGTCAGAAATATTTCTCCCCTGAACTGCTGGAAAAGTTTACCGCCAAAGGTTATCAGCATATCTCTCGCTTCGAAGATCTGGCGACTATCACCCAGCCGAAAGTTATTGGCCTGTTCGCACAGGTTCAACTGCCGTGGGCACTGGATGAAAAAAACGCCAACCGTCTGAGCACCATGACTCAGAAAGCGCTGGACCTGCTGAGCCAGAACGAGCAGGGTTTCGTACTGCTGGTCGAAGGCAGCCTGATTGACTGGGCAGGTCATAGCAACGATATCGCAAACACGATGGGCGAGATGGACGAATTTGCGAACGCGCTGGAAGTGGTAGAACAGTTCGTCCGCCAGCATCCTGACACCCTGATGGTTGCGACCGCTGACCACAATACCGGTGGCCTGTCTATTGGTGCTGGTGGCGACTATCGTTGGAACCCGGAAATCCTGCGTAACATGAGCGCTTCCACCGATACCCTGGCACTGGCTGCTCTGGGTGGCGATCAATGGGCAGCTGATCTGGCCCGTGGTCTGGGTTTCGAACTGAACGCTGATGAAGTTACCCAGCTGTCTACGGCGCGTATGCAGGGCCTGGAGACTATGACTGAAGCCATCCGCAAAATCATCGACAAGCGTACCGGCACTGGCTGGACTACCTCTGGCCACACTGGTACCGACGTACAGGTTTTCGCAGCAGGTCCAGCCGCTGAACTGTTCAACGGTCACCAGGACAACACTGACATCGCCAACAAAATCTTCACCCTGCTGCCGAAACCGAAAAAAGCAAAAACCGAA

optimization codon II-3 (SEQ ID NO. 11):

GCACCTGAACTGGAGAACGGTCCAATGAAACCGCCGTCTAAACCTAAAAACATTGTTATTATGGTCGGTGATGGTATGGGTCCGTCTTATACGTCCGCTTACCGTTATTTTAAAGACAACCCGGACACCGAGGAAGTGGAGCAGACCGTTTTCGATCGTCTGCTGGTTGGCATGGCGTCTACTTATCCTGCGTCCGTGTCTGGCTATGTGACTGATTCTGCTGCTGCTGCAACCGCACTGGCAACTGGTGTGAAAAGCTATAACGGCGCTATCTCTGTCGACACTCAGAAACAGCACCTGCCGACGATGCTGGAAAAAGCGAAAGCTCTGGGCCTGTCTACCGGTGTCGCGGTAACCAGCCAAATCAACCACGCTACGCCGGCAGCCTTTCTGGCACATAACGAAAGCCGTAAAAACTACGATGCGCTGGCGCTGAGCTACCTGGACACCAACGCAGACGTTCTGCTGGGCGGTGGTCAGAAATACTTCTCTCCGGAACTGCTGGAAAAATTTACCGCAAAGGGCTATCAGCACATTAGCCGCTTCGAAGACCTGGCCACCATCACCCAGCCGAAAGTTATCGGTCTGTTCGCTCAGGTGCAACTGCCGTGGGCGCTGGATGAGAAAAATGCTAACCGTCTGTCTACGATGACCCAGAAAGCCCTGGATCTGCTGTCCCAGAACGAACAGGGCTTCGTTCTGCTGGTAGAAGGCTCTCTGATTGACTGGGCTGGCCACAGCAACGATATCGCAAACACCATGGGTGAGATGGACGAGTTCGCTAATGCGCTGGAAGTAGTGGAACAGTTTGTACGTCAGCACCCGGATACTCTGATGGTGGCCACGGCGGACCACAACACTGGTGGTCTGAGCATCGGTGCAGGTGGCGACTACCGTTGGAACCCGGAAATCCTGCGTAACATGAGCGCTTCTACCGATACCCTGGCACTGGCTGCACTGGGCGGTGATCAGTGGCAGGCTGATCTGGCGCGTGGTCTGGGTTTCGAGCTGAACGCTGACGAAGCGACTCAGCTGAGCACTGCCCGTATGCAGGGCCTGGAAACGATGACCGAAGCGATCCGTAAAATCATCGATAAACGTACCGGTACCGGTTGGACTACCTCCGGTCACACTGGCACCGACGTTCAGGTTTTTGCGGCAGGTCCGGCAGCGGAGCTGTTTAATGGTCACCAGGACAATACCGATATCGCGAACAAAATTTTCACCCTGCTGCCGAAGCCGAAGAAAGCAAAAACTGAG

optimization codon II-4 (SEQ ID NO. 12):

GCTCCTGAACTGGAAAACGGTCCTATGAAACCGCCGTCTAAACCGAAAAATATCGTTATTATGGTTGGTGACGGTATGGGTCCTTCCTATACCTCTGCGTACCGTTACTTCAAAGACAACCCGGATACTGAAGAAGTTGAACAAACCGTCTTCGATCGTCTGCTGGTCGGCATGGCTTCCACCTACCCGGCAAGCGTAAGCGGTTACGTAACTGATTCTGCAGCTGCGGCTACTGCTCTGGCAACGGGTGTAAAAAGCTACAACGGCGCGATTTCCGTGGACACCCAGAAGCAGCACCTGCCAACTATGCTGGAAAAAGCAAAAGCTCTGGGCCTGTCTACCGGTGTGGCAGTCACTTCTCAGATCAACCACGCTACTCCAGCGGCTTTCCTGGCGCATAACGAAAGCCGTAAAAACTATGATGCGCTGGCTCTGTCTTACCTGGACACCAACGCAGACGTACTGCTGGGTGGCGGTCAAAAGTACTTCTCCCCGGAGCTGCTGGAAAAGTTCACCGCGAAAGGCTACCAGCATATCTCCCGCTTCGAAGATCTGGCTACCATCACGCAGCCGAAAGTTATCGGTCTGTTTGCCCAAGTACAGCTGCCGTGGGCTCTGGATGAAAAAAACGCAAACCGTCTGTCCACCATGACCCAGAAAGCTCTGGATCTGCTGTCCCAGAACGAACAGGGTTTCGTTCTGCTGGTGGAAGGCTCTCTGATTGACTGGGCGGGCCATTCCAACGACATTGCTAACACGATGGGTGAAATGGACGAGTTTGCGAACGCACTGGAAGTTGTTGAACAGTTCGTGCGCCAGCATCCGGATACCCTGATGGTTGCGACCGCTGACCACAACACTGGTGGTCTGTCTATTGGTGCAGGCGGTGATTACCGTTGGAACCCGGAAATCCTGCGCAACATGTCTGCGTCTACTGACACCCTGGCACTGGCTGCTCTGGGTGGTGATCAGTGGCAAGCTGACCTGGCACGTGGTCTGGGCTTTGAACTGAATGCGGATGAAGTAACCCAGCTGGCGACTGCGCGTATGCAGGGTCTGGAAACGATGACCGAGGCGATTCGTAAAATCATCGACAAACGTACCGGCACTGGTTGGACTACTTCCGGCCACACTGGTACCGATGTTCAGGTCTTCGCGGCTGGTCCAGCAGCAGAACTGTTCAACGGTCATCAGGATAACACGGACATCGCGAATAAAATTTTCACCCTGCTGCCGAAGCCGAAAAAAGCGAAAACTGAG

optimization codon II-5 (SEQ ID NO. 13):

GCGCCAGAACTGGAAAATGGTCCAATGAAACCGCCGTCTAAACCGAAGAACATCGTAATCATGGTTGGCGACGGCATGGGTCCGTCTTACACCTCTGCGTACCGTTATTTCAAAGACAACCCGGATACCGAGGAAGTTGAACAAACCGTTTTCGATCGTCTGCTGGTGGGCATGGCATCTACTTATCCGGCTTCTGTATCCGGTTACGTTACCGATTCTGCAGCAGCTGCTACCGCACTGGCGACTGGTGTTAAAAGCTACAACGGTGCGATCTCCGTCGATACTCAGAAACAGCATCTGCCGACTATGCTGGAAAAAGCGAAAGCGCTGGGTCTGTCTACTGGTGTAGCGGTCACGAGCCAAATCAACCACGCTACTCCGGCAGCTTTTCTGGCTCACAACGAATCTCGTAAAAACTACGACGCCCTGGCGCTGTCCTACCTGGATACCAACGCTGACGTACTGCTGGGTGGCGGCCAGAAATATTTCAGCCCGGAACTGCTGGAAAAATTCACCGCTAAAGGCTATCAGCACATCTCCCGTTTTGAAGACCTGGCAACTATCACCCAGCCGAAAGTCATTGGCCTGTTTGCACAGGTTCAACTGCCGTGGGCACTGGACGAGAAAAACGCTAATCGTCTGTCTACTATGACCCAAAAGGCGCTGGACCTGCTGTCTCAAAACGAACAGGGTTTCGTCCTGCTGGTTGAAGGTAGCCTGATTGACTGGGCAGGCCACTCCAACGATATTGCGAACACGATGGGCGAAATGGACGAATTCGCTAACGCACTGGAGGTGGTGGAACAGTTCGTTCGCCAGCATCCTGACACCCTGATGGTTGCTACCGCGGACCACAACACCGGTGGTCTGAGCATTGGTGCAGGTGGCGATTACCGTTGGAATCCGGAAATCCTGCGCAACATGTCTGCGTCTACTGATACCCTGGCTCTGGCTGCTCTGGGTGGTGACCAATGGCAAGCAGACCTGGCTCGTGGTCTGGGTTTCGAACTGAACGCGGATGAAGTTACGCAGCTGTCTACTGCCGCTATGCAAGGCCTGGAGACCATGACTGAAGCTATCCGCAAGATCATTGATAAGCGTACCGGCACGGGTTGGACTACTAGCGGCCACACCGGTACCGACGTACAGGTTTTTGCCGCTGGTCCGGCAGCAGAACTGTTCAACGGTCACCAGGACAACACCGATATTGCTAACAAGATCTTCACGCTGCTGCCAAAACCGAAAAAAGCCAAGACTGAA

optimized codon III-1 (SEQ ID NO. 14):

GCGCCTGAACTGGAAAACGGCCCAATGAAACCACCGTCTAAACCAAAAAATATCGTGATTATGGTTGGCGACGGTATGGGTCCGTCTTACACTAGCGCTTACCGCTACTTCAAAGACAACCCGGATACTGAAGAAGTAGAACAAACCGTGTTTGATCGTCTGCTGGTGGGCATGGCTTCTACCTACCCGGCATCCGTGAGCGGTTACGTTACGGATTCTGCTGCGGCAGCTACCGCTCTGGCAACTGGTGTGAAATCTTACAACGGCGCAATCTCTGTCGACACTCAGAAACAGCACCTGCCGACTATGCTGGAAAAAGCGAAAGCTCTGGGTCTGTCCACTGGTGTGGCTGTTACCTCCCAGATCAACCATGCTACCCCTGCTGCTTTTCTGGCTCATAATGAATCTCGTAAAAACTATGATGCCCTGGCGCTGAGCTACCTGGATACGAATGCTGACGTTCTGCTGGGTGGCGGTCAGAAATACTTTAGCCCAGAGCTGCTGGAAAAATTCACGGCGAAAGGTTACCAGCACATCTCCCGTTTCGAAGACCTGGCGACTATTACTCAGCCGAAAGTTATCGGTCTGTTCGCACAGGTGCAACTGCCGTGGGCTCTGGATGAAAAGAACGCTAACCGTCTGTCCACCATGACCCAGAAAGCGCTGGACCTGCTGTCTCAGAACGAGCAAGGTTTCGTGCTGCTGGTCGAAGGTTCCCTGATCGACTGGGCTGGTCACTCTAATGACATCGCAAACACCATGGGTGAGATGGACGAATTTGCCAACGCGCTGGAAGTTGTTGAACAGTTTGTACGTCAGCATCCGGACACTCTGATGGTGGCAACCGCAGATCACAACACCGGTGGTCTGTCTATCGGTGCTGGTGGTGACTACCGCTGGAACCCGGAAATCCTGCGTAACATGTCTGCGAGCACTGATACTCTGGCGCTGGCAGCTCTGGGTGGTGACCAAGCAGCCGCAGATCTGGCTCGTGGTCTGGGTTTTGAACTGAACGCGGATGAAGCGACCCAGCTGGCAACTGCAGCGATGCAGGGCCTGGAAACCATGACCGAGGCAATCCGTAAAATCATTGATAAACGCACCGGCACTGGCTGGACTACTAGCGGTCACACCGGCACTGATGTCCAGGTTTTCGCGGCAGGTCCGGCTGCTGAACTGTTCAACGGCCACCAGGACAACACCGATATTGCGAACAAGATCTTCACCCTGCTGCCGAAGCCGAAAAAAGCAAAGACCGAA

(2) Recombinant plasmid introduction into host E.coli

Taking 1 mu L of the expression plasmid obtained in the step (1), adding the expression plasmid into 30 mu L of escherichia coli competent BL21 (DE 3) under ice bath condition, standing for 30min in ice bath, standing for 45s in water bath at 42 ℃, standing for 2min on ice immediately, adding 400 mu L of SOC culture medium without antibiotics, and culturing for 45min at 37 ℃ and 230rpm in a shaking way. mu.L of the bacterial liquid was uniformly spread on LB plates containing 100. Mu.g/mL of kana resistance, and incubated overnight at 37 ℃.

(3) Expression of the Gene of interest

Picking the monoclonal prepared in the step (2), inoculating in TB and LB culture medium containing 100 mug/mL kana resistance respectively, shaking and culturing at 37 ℃ and 220rpm until OD600 is between 0.6 and 0.8, inducing with IPTG, and shaking and culturing at 37 ℃ and 18 ℃ respectively overnight. SDS-PAGE identification was performed by sonication of the samples, and the results of partial sample identification are shown in FIG. 4, for example. FIG. 4 is a graph showing the results of identifying an alkaline phosphatase that is not mutated. TB and LB media were identified to be expressed in supernatant at 18℃with 46kDa band of interest. The product identification results are counted in table 4.

TABLE 4 Table 4

(4) Purification of the expression product (Nickel column+QP column)

About 10g of recombinant cells were weighed, and 50ml of Lysis buffer containing 600mM guanidine hydrochloride was added thereto to resuspend the cells using a vortex shaker. Ultrasonic disruption of cells: the phi 10 probe has 10 percent of power, works for 5.5 seconds, stops for 9.9 seconds and is subjected to ultrasonic crushing for 30 minutes. Centrifugation was carried out at 20000rpm at 4℃for 30min, and the supernatant was collected and filtered through a 0.22 μm membrane. Taking filtered supernatant, loading the filtered supernatant on a 5ml Ni column, and washing impurities and eluting target proteins according to the following steps: elutionstep 1:0% B,5CV, step2:0-60% B,15CV, step3:100% B,6CV, flow rate: loading 2.5ml/min (sample pump), eluting 5ml/ml, collecting: 8ml/tube (15 ml). The collected samples were diluted 6-fold directly with 50mM Tris-HCl,5% glycerol, pH7.0 solution for Q-HP column purification, 5ml QP column purification, mobile phase flow rate of 3ml/min, UV and conductivity to baseline were rinsed with 20ml 50mM Tris-HCl Buffer after loading, elution procedure included: step1:0% B,8CV,3ml/min; step2, 0-60% B,20CV,3ml/min; step3:100% B,15CV,3ml/min. The eluted sample is collected for electrophoretic separation, and an exemplary electrophoretogram of a portion of the sample is shown in fig. 5 and 6. In FIG. 5, lanes 0.22 μm, lane F1-3, lane2A1-2B3, lane2C3, 100%, 10% SDS-PAGE, run 2.0. Mu.l. In FIG. 6, lanes-Ni eluted diluted sample, lane1A1-2A1 passed through, lane2A2-2B3 gradient eluted, 2B3: 2.36U/. Mu.l, 10% SDS-PAGE, run: 2.0. Mu.l.

The protein of interest eluted mainly at 250mM NaCl. F was dialyzed overnight in the dialysate and the volumes of the samples after dialysis were collected to be 20ml, respectively. The BCA was used to measure the concentration, resulting in: r is R ² =0.995, the concentration was 18.2mg/ml, the yield was 433.2mg, and the yield was 43.32mg/g bacteria. The yield and the yield statistics of the purified product are shown in Table 5.

TABLE 5

Codon numbering	Corresponding alkaline phosphatase/mutant	Yield mg/g
			Optimized codon I	Unmutated alkaline phosphatase	43.32mg/g
Optimized codon II-1	Alkaline phosphatase mutant A-1	35.27mg/g
			Optimized codon II-2	Alkaline phosphatase mutant A-2	32.46mg/g
Optimized codon II-3	Alkaline phosphatase mutant A-3	34.07mg/g
			Optimized codon II-4	Alkaline phosphatase mutant A-4	28.53mg/g
Optimized codon II-5	Alkaline phosphatase mutant A-5	26.37mg/g
			Optimized codon III-1	Alkaline phosphatase mutant B-1	31.47mg/g

Example 3

In this example, the alkaline phosphatase mutant prepared in example 2 was subjected to activity measurement. The method comprises the following specific steps:

(1) Solution preparation

2mL of the working fluid was prepared according to Table 6 below.

TABLE 6

Reagent(s)	Volume added
		500mM PNPP	200μL
10X rCutSmart buffer	200μL
		ddH2O	1.6mL

(2) Activity test

Preparation of positive alkaline phosphatase (commercially available active alkaline phosphatase): 1U/. Mu.L of positive alkaline phosphatase (diluted with PBS pH 7.4 buffer (containing 50% glycerol) and gradually diluted again in a gradient, the dilution being PBS pH 7.4 buffer).

And (3) measuring by an instrument: the microplate reader was preheated for 30min and the temperature was set to 37 ℃. Program setting of the enzyme label instrument: 50. Mu.L of the working solution was added, the absorbance A1 was measured at 405nm, 1. Mu.L of the positive enzyme solution was added at each concentration, and the reaction was carried out for 5 minutes, and the absorbance A2 was measured at 405 nm. The OD differences A2-A1 of the alkaline phosphatase mutant prepared in example 2 and the blank were calculated, and the enzyme activity values were calculated and counted as shown in Table 7 below.

TABLE 7

Example 4

In this example, the alkaline phosphatase mutant prepared in example 2 was subjected to heat sensitivity measurement. The method comprises the following specific steps:

taking the alkaline phosphatase mutant prepared in the example 2, equally dividing the alkaline phosphatase mutant into 5 groups, and treating 4 experimental groups at 65, 75, 85 and 95 ℃ for 15min respectively; one control group was not subjected to heating treatment, and then the OD value of each group of samples was tested, respectively, the higher the OD value was, the higher the enzyme activity was, the OD value of the control group was increased with the extension of the reaction time, and the OD of the experimental group was almost unchanged with the extension of the reaction time, indicating that the mutant enzymes could be inactivated by treatment at 65, 75, 85 and 95℃for 15 min.

From FIG. 8, it can be seen that the alkaline phosphatase mutant can be completely inactivated by short-time high-temperature treatment, and the modified alkaline phosphatase has good heat sensitivity.

It will be understood by those of ordinary skill in the art that the foregoing embodiments are specific examples of carrying out the invention and that various changes in form and details may be made therein without departing from the spirit and scope of the invention.

Claims

1. An alkaline phosphatase mutant, wherein the alkaline phosphatase mutant is mutated at one or more sites in the wild-type alkaline phosphatase sequence selected from the group consisting of: w348, Q349, V365, S369 and R372; wherein, the amino acid residue number adopts the number shown in SEQ ID NO. 7.

2. The alkaline phosphatase mutant according to claim 1, wherein the amino acid sequence of the wild-type alkaline phosphatase is shown in SEQ ID No. 7.

3. The alkaline phosphatase mutant according to claim 1, wherein the number of mutation sites is 1 to 5.

4. Alkaline phosphatase mutant according to claim 1, characterized in that the amino acid sequence of the alkaline phosphatase mutant has at least 90% homology with SEQ ID No. 7.

5. The alkaline phosphatase mutant according to claim 1, wherein the alkaline phosphatase mutant is mutated on the basis of a wild-type alkaline phosphatase as shown in SEQ ID No.7, and the alkaline phosphatase mutant comprises a mutation site selected from the group consisting of: W348A, Q349A, V365A, S369A and R372A.

6. A polynucleotide molecule encoding the alkaline phosphatase mutant according to any one of claims 1 to 5.

7. A vector comprising the nucleic acid molecule of claim 6.

8. A host cell comprising the vector or chromosome of claim 7 integrated with the nucleic acid molecule of claim 6.

9. A method for preparing the alkaline phosphatase mutant according to claim 1, comprising the steps of:

(i) Culturing the host cell of claim 8 under suitable conditions to express said alkaline phosphatase mutant; and

(ii) Isolating the alkaline phosphatase mutant.

10. A kit comprising the alkaline phosphatase mutant according to any one of claims 1 to 5.