CN116200408A

CN116200408A - Preparation method and application of 3 alpha-steroid dehydrogenase

Info

Publication number: CN116200408A
Application number: CN202310036211.XA
Authority: CN
Inventors: 蒋析文; 王佳; 刘文丽; 罗小丽; 刘春奇; 陈颖欣
Original assignee: Guangzhou Da'an Gene Co ltd
Current assignee: Guangzhou Da'an Gene Co ltd
Priority date: 2023-01-06
Filing date: 2023-01-06
Publication date: 2023-06-02

Abstract

The application discloses a preparation method and application of 3 alpha-steroid dehydrogenase. The invention provides a 3 alpha-steroid dehydrogenase expression method based on a prokaryotic expression system, which combines optimization of synonymous codon preference through source screening, improves the expression quantity of soluble proteins, maintains higher activity of expression products and is suitable for industrial production.

Description

Preparation method and application of 3 alpha-steroid dehydrogenase

Technical Field

The invention relates to the field of biological medicine, in particular to a preparation method and application of 3 alpha-steroid dehydrogenase.

Background

The 3 alpha-steroid dehydrogenase (3 alpha-hydroxysteroid dehydrogenase,3 alpha-HSD) is a steroid dehydrogenase secreted by the unit cell of the genus Cong Maojia, acting on a variety of substrates, reversibly catalyzing the redox of the hydroxyl/ketone group at the 3-position of the C19-27 steroid. Total Bile Acids (TBA) in human serum were detected clinically with 3 alpha-HSD. Bile acid is an important component of bile, mainly exists in intestinal and hepatic circulatory system, plays an important role in fat metabolism, and only a small part of bile acid enters peripheral circulation to promote gallbladder contraction and small intestine propulsion and peristalsis. The total bile acid in serum can sensitively reflect whether the pathological changes of liver cells exist or not and whether liver functions are damaged or not. The rise is often seen in various diseases such as acute and chronic hepatitis, hepatitis B virus carriers, alcoholic hepatitis, and the like, and also in diseases such as cirrhosis, obstructive jaundice, cholestatic jaundice, and the like. TBA is also the only serum indicator that can simultaneously respond to three aspects of liver secretion status, synthetic extraction, and hepatocyte damage in disease diagnosis.

At present, the enzyme cycle assay method is used for detecting the content of serum bile, has the advantages of simple operation, low cost, high sensitivity, no pollution of reaction products and strong anti-interference capability, and is suitable for routine inspection. According to the principle of enzyme cycling for serum bile testing, 3 alpha-steroid dehydrogenase is an important reactant. Bile acids are specifically oxidized by 3 alpha-steroid dehydrogenase and Thio-oxidized coenzyme I (Thio-NAD) to form 3-ketol-co-alcohols and Thio-reduced coenzyme I (Thio-NADH). 3-ketosterols form bile acids and oxidized coenzyme I (NAD) under the action of 3 alpha-HSD and reduced coenzyme I (NADH). Bile acids are amplified over the course of multiple cycles, with simultaneous amplification of the generated Thio-NADH. The total bile acid content can be calculated by measuring the change in absorbance of Thio-NADH at 405 nm.

However, the natural 3 alpha-HSD has complex extraction process, more impurities in the extract, complex steps and low yield, which are required to be purified by multi-step chromatography and preparative isoelectric focusing electrophoresis technology, and the enzyme activity is lost in the purification process, more importantly, the 3 alpha-HSD and the beta-HSD are difficult to separate, and the obtained 3 alpha-HSD has high price and limits the application of large-scale clinical detection. Therefore, there is still a need to develop a method for genetically engineering expression of 3 alpha-steroid dehydrogenase to achieve stable large-scale production of 3 alpha-steroid dehydrogenase.

Disclosure of Invention

The invention aims to provide a preparation method of 3 alpha-steroid dehydrogenase.

It is another object of the present invention to provide polynucleotide sequences encoding 3 alpha-steroid dehydrogenases.

It is another object of the present invention to provide a vector adapted to a polynucleotide sequence encoding a 3α -steroid dehydrogenase.

Another object of the present invention is to provide a kit comprising a polynucleotide sequence encoding a 3 alpha-steroid dehydrogenase.

To solve the above technical problem, according to a first aspect of the present invention, there is provided a polynucleotide encoding a 3α -steroid dehydrogenase, the polynucleotide being codon optimized, and the polynucleotide being selected from any one of the following:

(i) A polynucleotide having a sequence shown as SEQ ID NO.1 or SEQ ID NO. 3;

(ii) Polynucleotides having greater than 95% homology to the sequences as shown in SEQ ID No.1 or SEQ ID No. 3; and

(iii) A polynucleotide complementary to the polynucleotide sequence set forth in (i) or (ii).

In a second aspect of the invention there is provided an expression vector comprising a polynucleotide provided in the first aspect of the invention.

In some preferred embodiments, the expression vector is an E.coli expression vector, more preferably pET-28a (+).

In a third aspect of the invention there is provided a host cell comprising an expression vector provided in the second aspect of the invention; or alternatively

The host cell has integrated into its genome a polynucleotide as provided in the first aspect of the invention.

In some preferred embodiments, the host cell is E.coli (Escherichia coli).

In some preferred embodiments, the host cell is an E.coli BL21 (DE 3) strain.

In a fourth aspect, the present invention provides a method for preparing a 3α -steroid dehydrogenase, the method comprising the steps of: culturing the host cell of the third aspect of the invention to express the protein of interest; and

separating the target protein to obtain the 3 alpha-steroid dehydrogenase;

in some preferred embodiments, the host cell is obtained by transforming E.coli with a plasmid comprising a polynucleotide according to the first aspect of the invention.

In some preferred embodiments, the host cell is cultured using SB, TB, LB, SOC medium, more preferably using TB medium.

In some preferred embodiments, the host cell is cultured in a shaking environment.

In some preferred embodiments, the host cell is cultured at a temperature of 16 to 19 ℃ or 35 to 39 ℃, more preferably at a temperature of 16 to 19 ℃.

In some preferred embodiments, the medium used in culturing the host cell comprises a kanamycin resistance gene.

In some preferred embodiments, the host cell is cultured using IPTG to induce expression of the protein of interest.

In some preferred embodiments, the host cell is cultured until an OD600 of 0.6 to 0.8 is reached, and is then induced with IPTG to express the protein of interest.

In some preferred embodiments, the step of isolating the protein of interest comprises:

eluting the crushed target protein supernatant through a chromatographic column when the flow is the same as that of the target protein supernatant, and collecting the eluent.

In some preferred embodiments, the chromatography column is a Ni-column affinity chromatography column (Ni-NTA).

In a fifth aspect, the invention provides a kit comprising: a polynucleotide as provided in the first aspect of the invention; or alternatively

An expression vector as provided in the second aspect of the invention; or alternatively

A host cell according to the third aspect of the invention; or alternatively

Or a 3α -steroid dehydrogenase prepared according to the method of the fourth aspect of the invention.

Compared with the prior art, the invention has at least the following advantages:

the invention provides a 3 alpha-steroid dehydrogenase expression method based on a prokaryotic expression system, which combines optimization of synonymous codon preference through source screening, improves the expression quantity of soluble protein, maintains higher activity of an expression product and is suitable for industrial production.

It is understood that within the scope of the present invention, the above-described technical features of the present invention and technical features specifically described below (e.g., in the examples) may be combined with each other to constitute new or preferred technical solutions. And are limited to a space, and are not described in detail herein.

Drawings

One or more embodiments are illustrated by way of example and not limitation in the figures of the accompanying drawings.

FIG. 1 is an SDS-PAGE identification of expression products of Pseudomonas-derived 3 alpha-steroid dehydrogenase in TB medium (recombinant plasmid containing optimized codon I) according to an embodiment of the invention;

FIG. 2 is an SDS-PAGE identification of expression products of human 3. Alpha. -steroid dehydrogenase in TB medium according to an embodiment of the invention;

FIG. 3 is an electrophoretogram of Pseudomonas-derived 3. Alpha. -steroid dehydrogenase according to an embodiment of the present invention;

FIG. 4 is an electrophoretogram of a human 3 alpha-steroid dehydrogenase according to an embodiment of the present invention;

FIG. 5 is a graph of a 3. Alpha. -steroid dehydrogenase activity measurement according to an embodiment of the present invention;

FIG. 6 is an SDS-PAGE identification of the expression product of Pseudomonas derived 3 a-steroid dehydrogenase (recombinant plasmid containing optimized codon III) according to an embodiment of the present invention.

Detailed Description

The present inventors have conducted extensive and intensive studies to screen a large number of species sources for bacteria that express soluble 3 a-steroid dehydrogenase, such as recombinant 3 a-steroid dehydrogenase of Pseudomonas origin and of human origin. Through activity detection, recombinant 3 alpha-steroid dehydrogenase with better activity is obtained. On the other hand, based on the gene sequence of 3 alpha-steroid dehydrogenase with better soluble expressed enzyme activity, synonymous codon preference optimization in different modes is carried out, so that the expression quantity of soluble protein is improved.

Acquisition of a Gene of interest/acquisition of a nucleic acid sequence related to a protein of interest

The full-length nucleotide sequence of the target protein or its element or a fragment thereof of the present invention can be usually obtained by PCR amplification, recombinant methods or artificial synthesis. For the PCR amplification method, primers can be designed based on the disclosed nucleotide sequences, particularly open reading frame sequences, and amplified to obtain the relevant sequences using a commercially available cDNA library or a cDNA library prepared according to a conventional method known to those skilled in the art as a template. When the sequence is longer, it is often necessary to perform two or more PCR amplifications, and then splice the amplified fragments together in the correct order.

Once the relevant sequences are obtained, recombinant methods can be used to obtain the relevant sequences in large quantities. This is usually done by cloning it into a vector, transferring it into a cell, and isolating the relevant sequence from the propagated host cell by conventional methods.

Furthermore, the sequences concerned, in particular fragments of short length, can also be synthesized by artificial synthesis. In general, fragments of very long sequences are obtained by first synthesizing a plurality of small fragments and then ligating them.

Methods of amplifying DNA/RNA using PCR techniques are preferred for obtaining the genes of the present invention. Primers for PCR can be appropriately selected according to the sequence information of the present invention disclosed herein, and can be synthesized by a conventional method. The amplified DNA/RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.

Homologous proteins of different biological origin have different amino acid sequences, and the recombinant expression products thereof often have unpredictable functional activities, based on the gene sequences obtained from the proteins of interest of different origin. In one embodiment of the invention, the NCBI database is used for analyzing the amino acid sequences of a plurality of target proteins from different sources to obtain the sequence information of the target genes from different sources. In some embodiments, the corresponding 3 a-steroid dehydrogenase gene sequence information is obtained by analysis of pseudomonas and human 3 a-steroid dehydrogenases by NCBI databases.

Synonymous codon bias optimization

To overcome the potential problem of reduced yield when expressing heterologous proteins in E.coli, the present invention relates to synonymous codon-biased optimized polynucleotide sequences. And (3) carrying out synonymous codon preference optimization on the obtained target gene sequence, wherein the target gene sequence subjected to synonymous codon preference optimization can express the amino acid sequence identical to the target protein. In some embodiments of the invention, several optimized codons are obtained by optimizing the E.coli synonymous codon bias for the Pseudomonas-derived 3 alpha-steroid dehydrogenase gene sequence, illustratively optimized codon I shown in SEQ ID NO.1 and III shown in SEQ ID NO. 3. In another embodiment, several optimized codons are obtained by optimization of the synonymous codon bias of E.coli on the human 3. Alpha. -steroid dehydrogenase gene sequence, exemplified by optimized codon II as shown in SEQ ID NO. 2.

Several optimized codons obtained by optimizing codon preference in the same kind of source target protein gene in different modes, and these optimized codons can express target protein with corresponding activity in host cell normally, but the expression amount is different. In some embodiments of the invention, large amounts of inclusion bodies are expressed in codons obtained by optimization of E.coli synonymous codon bias for the 3. Alpha. -steroid dehydrogenase gene sequence of Pseudomonas origin, with partial presence of soluble expression, such as, illustratively, optimization codon I and optimization codon III. Under the same conditions, there are optimizing codons for soluble expression, and the expression amount of soluble protein is also obviously different, such as optimizing codon I and optimizing codon III, and the expression amount of soluble protein introduced into escherichia coli is obviously higher than that of optimizing codon III.

The target protein genes from different sources have larger activity difference after being optimized by synonymous codon preference, and the expression products obtained by introducing the target protein genes into host cells. In one embodiment, the activity difference of the expression product in E.coli is significant between the optimized codon I of the Pseudomonas source after optimization of synonymous codon preference of E.coli and the optimized codon II of the human 3 alpha-steroid dehydrogenase, and only the optimized codon I of the Pseudomonas source has the enzyme activity.

The invention also relates to polynucleotides having a homology of more than 80%, preferably more than 85%, more preferably more than 90%, more preferably more than 91%, more preferably more than 95% to the sequences shown in SEQ ID NOS.1-3; and polynucleotides complementary to the sequences shown in SEQ ID NOS.1-3.

Vector of target gene

The invention also relates to vectors comprising the polynucleotides of the invention. "vector" in the present invention means a linear or circular DNA molecule comprising a fragment encoding a protein of interest operably linked to other fragments providing for its transcription. Such additional fragments may include promoter and terminator sequences, and may optionally include one or more origins of replication, one or more selectable markers, an enhancer, a polyadenylation signal, a vector, and the like. The vector fragment may be derived from the host organism, another organism, plasmid or viral DNA, or may be synthetic. The vector may be any expression vector, synthetic or conveniently subjected to recombinant DNA procedures, the choice of vector generally being dependent on the host cell into which the vector is to be introduced. Thus, the vector may be an autonomously replicating vector, i.e. a vector, which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid. Alternatively, the vector may be one that, when introduced into the host cell, integrates into the host cell genome and replicates with the chromosome with which it is integrated. In one embodiment, the vector of the invention is an expression vector. In one embodiment of the invention pET-28a (+) is selected as a vector to obtain higher expression efficiency.

Methods well known to those skilled in the art can be used to construct expression vectors containing the coding DNA sequences of the proteins of the invention and appropriate transcriptional/translational control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence may be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Illustratively, the insertion of the exogenous DNA fragment is accomplished by cleaving the vector DNA molecule with a DNA endonuclease into a linear molecule that can be linked to the exogenous gene, and then ligating the codon optimized fragment of the gene of interest to the vector, optionally with a single restriction site cohesive end ligation, double restriction site directional cloning, cohesive end ligation of different restriction sites, blunt end ligation, artificial linker ligation, or end ligation with an oligonucleotide.

Transformation of host cells with vectors containing genes of interest

The invention also relates to host cells genetically engineered with the vector or fusion protein coding sequences of the invention. The vector containing the codon-optimized gene of interest may be inserted, transfected or otherwise transformed into a host cell by known methods to obtain a transformant containing the codon-optimized gene of interest of the present invention and capable of expressing the protein of interest. A "host cell" in the present invention is a cell into which an exogenous polynucleotide and/or vector has been introduced. The host cell may be a eukaryotic host cell or a prokaryotic host cell, the host cell is preferably a bacterium, and is preferably E.coli, more preferably E.coli ROSETTA (DE 3) strain (Escherichia coli Rosetta (DE 3) strain).

Method for producing target protein

The invention also relates to a method for preparing the target protein, and the polynucleotide sequence can be used for expressing or producing recombinant protein. Generally, there are the following steps:

(1) Transforming or transducing a suitable host cell with a polynucleotide (or variant) encoding a protein of the invention, or with a recombinant expression vector comprising the polynucleotide;

(2) A host cell cultured in a suitable medium;

(3) Separating and purifying the protein from the culture medium or the cells.

Wherein, the transformation or transduction of the recombinant expression vector containing the polynucleotide of the step (1) into a suitable host cell can be performed by conventional techniques well known to those skilled in the art, and when the host is E.coli, a heat shock method, an electrotransformation method, etc. can be selected.

The transformant obtained can be cultured by a conventional method to express the polypeptide encoded by the gene of the present invention. Depending on the host cell used, the medium used in the culture may be selected from a variety of conventional media, preferably SB, TB, LB or SOC media. The culture is carried out under conditions suitable for the growth of the host cell. After the host cells have grown to the appropriate cell density, the selected promoters are induced by suitable means (e.g., temperature switching or chemical induction) and the cells are cultured for an additional period of time. In order to promote the expression of the target protein and to increase the expression level of the soluble protein, a preferred embodiment of the present invention uses a host cell cultured in TB or LB medium, and the medium used contains a kanamycin resistance gene.

To further promote soluble expression of the protein of interest, in a preferred embodiment of the invention, the host cell is cultured to OD ₆₀₀ After 0.6-0.8 induction with IPTG and further incubation at 17 to 19 ℃ or 35 to 39 ℃ for about 8 to 12 hours. The soluble expression level is high in a low temperature range, for example, 17 to 19 ℃.

The protein in the above method may be expressed in the cell, or on the cell membrane, or secreted outside the cell. If desired, the proteins can be isolated and purified by various separation methods using their physical, chemical and other properties. Thus, in the present invention, after the successful culture to obtain the target protein, it also involves a step of separating and purifying it, for example, in step (3), separating and purifying the protein from the culture medium to obtain the target protein in high purity. Although methods for purifying the protein of interest may be conventional means well known to those skilled in the art, including but not limited to: conventional renaturation treatment, treatment with a protein precipitant (salting-out method), centrifugation, osmotic sterilization, super-treatment, super-centrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques and combinations of these methods. In a preferred embodiment of the present invention there is provided a method for isolating a protein of interest, the steps comprising: eluting the crushed target protein supernatant through a chromatographic column when the flow is the same as that of the target protein supernatant, and collecting eluent; the mobile phase comprises BufferA, bufferB and/or BufferC; wherein, the BufferA comprises Tris (Tris, concentration 50 mM) and NaCl solution (concentration 50 mM); bufferB includes Tris (Tris, 50mM concentration), naCl solution (50 mM concentration) and Imidazole (500 mM concentration); bufferC includes Tris (Tris, 50mM concentration) and NaCl solution (1M concentration).

Preferably, in the eluting step, the eluting procedure includes a first stage and a second stage; in the first stage, the mobile phase used is BufferA; in the second stage, the mobile phase is a mixture of BufferA and BufferB, wherein the volume percentage of BufferA is gradually reduced from 100% to 40%, and the volume percentage of BufferB is gradually increased from 0% to 60%.

More preferably, the elution procedure further comprises a third stage in which the mobile phase used is BufferB.

Dialyzing the eluted and purified target protein product, and collecting a dialyzed sample. The dialysis samples were measured for concentration by BCA method and the yield was calculated.

In the present disclosure, any exemplary or exemplary language (e.g., ") provided for certain embodiments herein is used merely to better present the disclosure and does not limit the scope of the disclosure as otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

If the definition or use of a term in a reference is inconsistent or inconsistent with the definition of that term described herein, the definition of the term described herein applies and the definition of the term in the reference does not apply.

Various terms used herein are shown below. If a term used in a claim is not defined below, the broadest definition persons in the pertinent art have given that term are given as reflected in publications or issued patents that are printed at the time of application.

As used herein, the term "isolated" refers to a nucleic acid or polypeptide that is separated from at least one other component (e.g., a nucleic acid or polypeptide) that the nucleic acid or polypeptide is found in its natural source. In one embodiment, the nucleic acid or polypeptide is found to be present only (if any) in solvents, buffers, ions or other components that are normally present in its solution. The terms "isolated" and "purified" do not include nucleic acids or polypeptides that are present in their natural source.

As used herein, the terms "polynucleotide" and "polynucleotide sequence" may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. The DNA may be single-stranded or double-stranded. The DNA may be a coding strand or a non-coding strand.

The invention also relates to variants of the above polynucleotides which encode protein fragments, analogs and derivatives having the same amino acid sequence as the invention. Variants of the polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. Such nucleotide variants include substitution variants, deletion variants and insertion variants. As known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the encoded polypeptide.

As used herein, the term "codon optimization" refers to a manner of improving the efficiency of gene synthesis by avoiding the use of low-availability or rare codons according to codon usage differences exhibited by organisms (including e.coli, yeast, mammalian blood cells, plant cells, insect cells, etc.) that actually do protein expression or production.

As used herein, the terms "homology" and "identity" are used interchangeably to refer to the percentage of identical (i.e., identical) nucleotides or amino acids between two or more polynucleotides or polypeptides. Sequence identity between two or more polynucleotides or polypeptides can be measured by the following methods. The nucleotide or amino acid sequence of a polynucleotide or polypeptide is aligned, the number of positions in the aligned polynucleotide or polypeptide that contain the same nucleotide or amino acid residue is scored and compared to the number of positions in the aligned polynucleotide or polypeptide that contain a different nucleotide or amino acid residue. Polynucleotides may differ at one position, for example, according to the inclusion of different nucleotides (i.e., substitutions or variations) or deletions of nucleotides (i.e., insertions or deletions of one or two nucleotides in the polynucleotide). The polypeptides may differ at one position, for example, by containing an amino acid (i.e., substitution or variation) or a deletion of an amino acid (i.e., an amino acid or deletion of an amino acid inserted into one or both polypeptides). Sequence identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of amino acid residues in the polynucleotide or polypeptide. For example, percent identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of nucleotide or amino acid residues in the polynucleotide or polypeptide, and then multiplying by 100.

As used herein, the terms "sequence complementary" and "reverse sequence complementary" are used interchangeably to refer to a sequence that is opposite in direction to and complementary to the original polynucleotide sequence. For example, if the original polynucleotide sequence is actaac, then its reverse complement is GTTCAT.

As used herein, the term "expression" includes any step involving the production of a polypeptide in a host cell, including, but not limited to, transcription, translation, post-translational modification, and secretion. After expression, the host cells or expression products can be harvested, i.e.recovered.

The present invention will be further described with reference to specific embodiments in order to make the objects, technical solutions and advantages of the embodiments of the present invention more apparent. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental methods, in which specific conditions are not noted in the following examples, are generally conducted under conventional conditions or under conditions recommended by the manufacturer. Percentages and parts are weight percentages and parts unless otherwise indicated. The experimental materials and reagents used in the following examples were obtained from commercial sources unless otherwise specified.

Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs, it is to be noted that the terms used herein are used merely to describe specific embodiments and are not intended to limit the exemplary embodiments of this application.

Example 1

In this example, a plasmid containing Pseudomonas and a codon optimized for a human-derived 3. Alpha. -steroid dehydrogenase was synthesized, and introduced into E.coli for cultivation to obtain a monoclonal.

(1) Construction of 3 alpha-steroid dehydrogenase plasmid

The gene sequence of Pseudomonas 3 alpha-steroid dehydrogenase was obtained and optimized for E.coli synonymous codon preference to obtain optimized codon I (SEQ ID NO. 1), ligated into pET-28a (+) vector and delegated synthesis by Suzhou Jin Weizhi Biotech Co.

The gene sequence of human 3 alpha-steroid dehydrogenase is obtained and optimized for synonymous codon preference of colibacillus to obtain optimized codon II (SEQ ID NO. 2). Was ligated into pET-28a (+) vector and was delegated to Suzhou Jin Weizhi Biotechnology Co.

(2) Recombinant plasmid introduction into host E.coli

Taking 1 mu L of the expression plasmid prepared in the step (1), adding the expression plasmid into 30 mu L of escherichia coli competent BL21 (DE 3) under ice bath condition, standing for 30min in ice bath, standing for 45s in water bath at 42 ℃, standing for 2min on ice immediately, adding 400 mu L of SOC culture medium without antibiotics, and culturing for 45min at 37 ℃ and 230rpm in an oscillating way. mu.L of the bacterial liquid was uniformly spread on LB plates containing 100. Mu.g/mL of kana resistance, and incubated overnight at 37 ℃.

SEQ ID NO.1

TCTGTAATCGCTATTACCGGTTCTGCATCTGGCATCGGTGCAGCCCTGAAAGAACTGCTGGCGCGTGCTGGTCACACCGT

CATCGGTATCGATCGCGGCCAGGCGGATATTGAAGCAGACCTGTCCACTCCAGGCGGTCGTGAAACCGCTGTTGCGGCTG

TTCTGGATCGCTGTGGTGGTGTACTGGACGGCCTGGTCTGCTGTGCTGGTGTAGGTGTTACCGCGGCTAACTCCGGCCTG

GTGGTTGCTGTGAACTACTTCGGTGTGTCTGCACTGCTGGACGGTCTGGCTGAAGCACTGAGCCGTGGTCAACAGCCGGC

AGCTGTAATCGTAGGCTCTATCGCAGCTACCCAGCCGGGTGCTGCTGAACTGCCTATGGTTGAAGCTATGCTGGCCGGCG

ACGAAGCACGTGCAATCGAACTGGCGGAACAACAGGGTCAGACCCACCTGGCATACGCAGGTTCTAAATACGCAGTCACC

TGTCTGGCGCGCCGTAACGTTGTTGACTGGGCGGGTCGTGGTGTTCGCCTGAACGTAGTAGCTCCGGGTGCTGTTGAAAC

TCCACTGCTGCAGGCTTCTAAAGCGGATCCGCGCTATGGTGAAAGCACTCGTCGTTTCGTAGCTCCGCTGGGTCGTGGCT

CTGAACCACGTGAAGTTGCTGAAGCGATTGCTTTCCTGCTGGGTCCGCAGGCCTCTTTCATTCATGGCTCCGTGCTGTTC

GTTGACGGCGGCATGGATGCTCTGATGCGTGCAAAAACGTTC

SEQ ID NO.2

ATGGACTCCAAACATCAGTGCGTAAAGCTGAACGACGGTCACTTTATGCCTGTTCTGGGCTTCGGCACTTATGCCCCAGC

GGAAGTGCCTAAAAGCAAAGCACTGGAGGCAACTAAACTGGCAATCGAGGCAGGCTTTCGCCACATTGATAGCGCGCACC

TGTATAACAACGAAGAACAGGTCGGCCTGGCAGTTCGTAGCAAAATCGCTGACGGTAGCGTTAAACGTGAAGATATCTTC

TACACCTCTAAACTGTGGTGCAACTCTCATCGTCCGGAGCTGGTTCGTCCGGCTCTGGAACGTTCTCTGAAAAAAGCGCA

GCTGGACTACGTTGACCTGTACCTGATCCACTCTCCGATGAGCCTGAAACCTGGTGAAGAGCTGAGCCCGACCGACGAAA

ACGGTAAAGTGATCTTCGACATTGTGGATCTGTGCACCACTTGGGAGGCGATGGAAAAATGCAAGGACGCTGGTCTGGCG

AAATCTATTGGCGTATCTAACTTCAATCGTCGTCAGCTGGAAATGATTCTGAACAAACCAGGTCTGAAATATAAACCGGT

GTGCAACCAGGTAGAATGCCACCCGTATTTCAACCGTTCTAAACTGCTGGACTTCTGCAAATCCAAAGACATCGTACTGG

TTGCTTATTCCGCCCTGGGCAGCCAACGTGACAAACGCTGGGTAGATCCGAACAGCCCGGTTCTGCTGGAAGACCCGGTA

CTGTGCGCTCTGGCGAAAAAACATAAACGTACTCCGGCGCTGATTGCACTGCGTTATCAGCTGCAGCGTGGTGTGGTGGT

TCTGGCAAAAAGCTACAACGAACAGCGTATCCGCCAGAACGTTCAAGTATTCGAATTCCAGCTGACCGCTGAAGACATGA

AAGCGATTGATGGCCTGGATCGTAACCTGCACTACTTCAACTCTGACTCCTTTGCCAGCCACCCGAATTATCCGTACTCT

GACGAATAC

Example 2

In this example, two different monoclonals obtained in example 1 were taken separately, inoculated in TB medium containing 100. Mu.g/mL of kana resistance, shake-cultured at 37℃at 220rpm until OD600 was between 0.6 and 0.8, induced with IPTG, and shake-cultured overnight at 37℃and 18℃respectively. SDS-PAGE identification is performed by sampling and ultrasonication, and the identification result is shown in FIGS. 1 and 2.

As can be seen, codons optimized for 3. Alpha. -steroid dehydrogenase containing both Pseudomonas and human origin were expressed in supernatant at 18 ℃. (3. Alpha. -steroid dehydrogenase molecular weight 25.8 kDa)

Example 3

The 3 alpha-steroid dehydrogenase monoclonal of Pseudomonas origin and of human origin was selected for extensive cultivation and purification. About 5g of recombinant cells were weighed, and 25ml of Lysis Buffer was added thereto to disperse the cells on ice using a disperser. Ultrasonic disruption of cells: the phi 10 probe has 10 percent of power, works for 5.5 seconds, stops for 9.9 seconds and is subjected to ultrasonic crushing for 30 minutes. Centrifugation was carried out at 20000rpm at 4℃for 30min, and the supernatant was collected and filtered through a 0.22 μm membrane. Purification using 1ml Ni-NTA and mobile phase composition formulation reference Table 2, flow rate 0.5ml/min, UV and conductance to baseline were rinsed with 20ml Lysis Buffer after loading. The elution procedure included: step 1:0% B,10CV,1.5ml/min; step 2:0-60% B,15CV,2ml/min; step 3:100% B,10CV,1.5ml/min.

TABLE 2

Reagent(s)	BufferA	BufferB	BufferC	Lysis Buffer
					Tris	50mM	50mM	50mM	50mM
NaCl	50mM	50mM	1M	300mM
					Glycerol	-	-	-	-
Imidazole	-	500mM	-	-
					pH	8.0	8.0	8.0	8.0

The electrophoresis results after sample collection are shown in FIG. 3 and FIG. 4.

As can be seen from FIG. 3, the Pseudomonas-derived 3. Alpha. -steroid dehydrogenase was allowed to pass through the column, and eluted at 150mM imidazole concentration, based on the SDS results, eluent 2A10-2B4 was selected for dialysis, and the concentration of 9ml of the dialyzed sample was measured using BCA, as follows: r is R ² =0.995, its concentration is 7.43mg/ml, yield is 66.87mg, yield is 13.84mg/g bacteria.

As can be seen from FIG. 4, samples of human 3. Alpha. -steroid dehydrogenase collected in 14-26 were pooled and mixed together to give a total of 13ml, and the concentration was measured using BCA, as follows: r is R ² =0.996, its concentration is 2.23mg/ml, yield is 28.99mg, yield is 7.24mg/g bacteria.

Example 4

In this example, purified Pseudomonas-derived and human 3. Alpha. -steroid dehydrogenase was used for subsequent enzyme activity detection experiments. The method comprises the following specific steps:

(1) Solution preparation

1M Tris-HCl pH 8.2: tris powder 121.14g was weighed out, poured into a 1L beaker and sterilized purified water was added to 800ml. After stirring evenly, the pH is adjusted to 8.2 by using concentrated hydrochloric acid at 25 ℃, the volume is fixed to 1L, the filtration is carried out at 0.22um, and the mixture is preserved at 4 ℃.

17.5mM DL-cystathionine: 0.0388g DL-cystathionine and 0.0605g Tris are weighed and dissolved in water, the pH is adjusted to 8.0, and the volume is fixed to 10mL.

20mM androsterone: 0.03g of androsterone powder is weighed and dissolved in 5mL of absolute ethyl alcohol, and the mixture is stored in a dark place.

100mM NAD+: 0.066g of NAD+ powder was weighed and dissolved in 1mL of deionized water and stored protected from light.

5mL working fluid formulation is referenced in Table 2.

TABLE 2

Reagent(s)	Volume added	Final concentration
			1M Tris-HCl	0.1mL	20mM
20mM androsterone	16.7μL	0.07mM
			100mM NAD+	50μL	1mM
ddH2O	4833.3μL

Positive enzyme preparation: positive enzyme (3. Alpha. -steroid dehydrogenase at a concentration of 63U/mg) was dissolved in PBS pH 7.4 buffer to prepare 1U/. Mu.L of enzyme solution, which was gradually diluted again according to the gradient, and the diluted solution was PBS pH 7.4 buffer.

(2) Instrument detection

The enzyme label instrument is preheated for 30min, 100 mu L of reaction liquid is added, the absorbance at 340nm is detected, 1 mu L of enzyme diluent is added into a blank group, 1 mu L of enzyme liquid with each concentration is added, shaking and mixing are carried out for 5s, the reaction is carried out for 1min, the absorbance at 340nm is detected, and a standard curve is drawn as shown in figure 5. Blank is designated A1 and test is designated A2. The OD difference A2-A1 of the sample and the blank was calculated and the sample concentration was determined from the difference. The results are shown in Table 3

TABLE 3 Table 3

The purified pseudomonas source recombinant 3 alpha-steroid dehydrogenase zymogen solution had a concentration of 7.43mg/mL and an average viability of 0.0645U/μl, then the specific viability was (0.0645 x 1000)/7.43=8.68U/mg. And the detection of the human recombinant 3 alpha-steroid dehydrogenase has no enzyme activity.

Comparative example 1

In this comparative example, the optimized codon with the largest expression level was obtained by screening the optimized codon for the Pseudomonas-derived 3. Alpha. -steroid dehydrogenase.

Selecting a 3 alpha-steroid dehydrogenase gene sequence derived from pseudomonas, optimizing synonymous codon preferences different from example 1 to obtain a large number of optimized codons, exemplarily shown as optimized codon III of SEQ ID NO.3, synthesizing recombinant plasmids in the same manner as example 1, culturing and purifying expression products of the recombinant plasmids by referring to the methods of examples 2 and 3, expressing the recombinant plasmids containing the optimized codon III in TB medium with SDS-PAGE patterns of the expression products referring to FIG. 6, weighing 20g of thalli, purifying by using a 5mL nickel column, collecting the purified products, and measuring the concentration by using BCA, wherein the result is that: r is R ² =0.995, the concentration was 1.22mg/mL, the volume was 42mL, the yield was 51.24mg, and the yield was 2.56mg/g bacteria.

SEQ ID NO.3：

AGTGTGATTGCTATTACCGGATCCGCTTCAGGTATTGGAGCTGCACTGAAAGAACTGTTAGCGAGAGCAGGGCATACGGT

AATTGGCATAGATCGCGGCCAGGCGGATATCGAAGCCGATCTTAGCACTCCGGGCGGTAGAGAAACAGCCGTAGCTGCGG

TGTTGGATCGCTGTGGTGGCGTTCTGGACGGCCTTGTATGCTGTGCGGGAGTTGGCGTAACAGCAGCTAATAGTGGCCTC

GTCGTCGCTGTGAACTATTTTGGCGTATCTGCTTTATTAGATGGATTAGCTGAGGCCTTGTCTAGAGGCCAACAGCCAGC

CGCAGTCATAGTCGGCTCAATTGCGGCAACACAACCTGGAGCCGCAGAACTCCCGATGGTTGAAGCCATGTTAGCCGGAG

ATGAGGCTCGTGCAATTGAGTTAGCAGAACAGCAAGGACAGACGCATCTTGCTTACGCAGGAAGCAAGTATGCGGTGACG

TGTCTTGCGAGACGCAATGTAGTCGATTGGGCTGGTAGAGGCGTTCGGCTTAATGTTGTGGCTCCGGGAGCTGTGGAAAC

CCCGTTGTTACAGGCATCCAAAGCCGATCCACGCTACGGGGAAAGTACCCGGAGATTTGTTGCTCCATTAGGACGCGGCA

GTGAACCGCGGGAAGTTGCTGAAGCGATTGCTTTTCTCTTAGGGCCTCAAGCCTCATTCATTCATGGGTCCGTCCTGTTT

GTGGATGGTGGCATGGATGCATTAATGCGTGCAAAAACATTT

It will be understood by those of ordinary skill in the art that the foregoing embodiments are specific examples of carrying out the invention and that various changes in form and details may be made therein without departing from the spirit and scope of the invention.

Claims

1. An isolated polynucleotide encoding a 3α -steroid dehydrogenase, wherein the polynucleotide is codon optimized and the polynucleotide is selected from any one of:

(i) A polynucleotide as shown in SEQ ID NO.1 or SEQ ID NO. 3;

(iii) A polynucleotide complementary to the sequence set forth in (i) or (ii).

2. An expression vector comprising the polynucleotide of claim 1.

3. The expression vector according to claim 3, characterized in that it is an E.coli expression vector, preferably pET-28a (+).

4. A host cell comprising the expression vector of claim 2 or 3; or alternatively

The polynucleotide of claim 1 integrated into the genome of the host cell.

5. A method of preparing a 3 alpha-steroid dehydrogenase, the method comprising the steps of:

transforming a host cell with a vector comprising the polynucleotide of claim 1;

culturing the host cell to express the 3α -steroid dehydrogenase.

6. The method of claim 5, wherein the host cells are cultured using TB medium.

7. The method of claim 5, wherein the host cell is cultured at a temperature of 16 to 19 ℃.

8. The method according to claim 5, wherein the medium used in culturing the host cell comprises a kanamycin resistance gene.

9. The method of claim 5, wherein the host cell is cultured to express the protein of interest by IPTG induction.

10. A kit, comprising: the polynucleotide of claim 1; or alternatively

The expression vector of claim 2 or 3; or alternatively

The host cell of claim 4; or alternatively

A 3α -steroid dehydrogenase prepared according to the method of any one of claims 5 to 9.