CN116042664A - Preparation method and application of acyl-CoA oxidase - Google Patents

Abstract

The application discloses a preparation method and application of acyl-CoA oxidase. The invention screens out bacterial sources capable of expressing high-enzyme activity soluble acyl-CoA oxidase from a large number of bacterial sources containing acyl-CoA oxidase by genetic engineering technology, and provides a corresponding method for industrially producing the acyl-CoA oxidase.

Description

Preparation method and application of acyl-CoA oxidase

technical field

The invention relates to the field of biomedicine, in particular to a preparation method and application of acyl-CoA oxidase.

Background technique

Acyl-CoA oxidase (Acyl-CoA oxidase, ACX/ACO) widely exists in a variety of organisms, is located in peroxisomes, and participates in the first step of the β-oxidation of various fatty acids in peroxisomes. The enzyme is also the rate-limiting enzyme in fatty acid activation metabolism. There are 6 isoenzymes in the ACX gene family, which can be divided into three types according to the length of the carbon chain recognized in the catalytic reaction. They are: Long-chain ACX (LACX) that recognizes long-chain fatty acids, Medium-chain ACX (MACX) that recognizes medium-chain fatty acids, and Short-chain ACX (SACX) that recognizes short-chain fatty acids. In the field of in vitro diagnosis, acyl-CoA oxidase catalyzes the oxidation reaction of acyl-CoA and can be used to detect the concentration of free fatty acids in blood.

Acyl-CoA oxidase can be prepared from natural products, such as plants and microorganisms. Such preparation methods mostly use Tris-HCl buffer and potassium phosphate buffer extraction methods. In order to improve the purity, multiple purification processes are often combined, such as: Acetone extraction, heat treatment, ammonium sulfate precipitation and phenyl sepharose chromatography, hydroxyapatite molecular sieve column. These steps are complex, require a variety of materials, and the yield is low, so it is difficult to apply to large-scale industrial production. For example, the document "Purification and Properties of Candida tropicalis Acyl-CoA Oxidase" discloses a method for extracting and purifying a target protein from Candida tropicalis. The yield of this method is low, and the specific activity of the product is only 21.8 U/mg. The preparation of recombinant acyl-CoA oxidase based on genetic engineering is suitable for industrial production, but it is still difficult to achieve large-scale industrial production due to factors such as the expression of inclusion bodies and poor enzyme activity. Therefore, there is still a need in the art to develop a method for preparing acyl-CoA oxidase suitable for large-scale industrial production.

Contents of the invention

The purpose of the present invention is to provide a preparation method of acyl-CoA oxidase.

Another object of the present invention is to provide a polynucleotide sequence encoding acyl-CoA oxidase.

Another object of the present invention is to provide a vector compatible with the polynucleotide sequence encoding acyl-CoA oxidase.

Another object of the present invention is to provide a kit comprising a polynucleotide sequence encoding acyl-CoA oxidase.

In order to solve the above technical problems, the first aspect of the present invention provides a polynucleotide encoding acyl-CoA oxidase, the polynucleotide is codon-optimized, and the polynucleotide is selected from any of the following:

(i) the polynucleotide of sequence as shown in SEQ ID NO.1;

(ii) polynucleotides with greater than 95% homology to the sequence shown in SEQ ID NO.1; and

(iii) A polynucleotide complementary to the polynucleotide sequence described in (i) or (ii).

The second aspect of the present invention provides an expression vector comprising the polynucleotide provided in the first aspect of the present invention.

In some preferred schemes, the expression vector is an Escherichia coli expression vector, more preferably pET-28a(+).

In the third aspect of the present invention, a host cell is provided, and the host cell includes the expression vector provided in the second aspect of the present invention; or

The polynucleotide provided in the first aspect of the present invention is integrated in the genome of the host cell.

In some preferred embodiments, the host cell is Escherichia coli (Escherichia coli).

In some preferred schemes, the host cell is Escherichia coli BL21 (DE3) strain.

The fourth aspect of the present invention provides a method for preparing acyl-CoA oxidase, the method comprising the steps of: cultivating the host cell described in the third aspect of the present invention to express the target protein; and

isolating the target protein to obtain the acyl-CoA oxidase;

In some preferred schemes, the host cell is obtained by transforming Escherichia coli with a plasmid containing the polynucleotide according to the first aspect of the present invention.

In some preferred schemes, the host cells are cultured using SB, TB, LB, SOC medium, more preferably TB medium.

In some preferred embodiments, the host cells are cultured in a shaking environment.

In some preferred schemes, the host cells are cultured at a temperature of 16 to 19°C or 35 to 39°C, more preferably the host cells are cultured at a temperature of 16 to 19°C.

In some preferred schemes, when culturing the host cells, the culture medium used contains a kanamycin resistance gene.

In some preferred schemes, when the host cells are cultured, IPTG is used to induce the expression of the target protein.

In some preferred schemes, when the host cells are cultured, they are cultured until the OD600 is between 0.6 and 0.8, and then induced with IPTG to express the target protein.

In some preferred schemes, the step of isolating the protein of interest comprises:

The crushed target protein supernatant is eluted through the chromatographic column when the flow is the same, and the eluate is collected.

In some preferred schemes, the chromatography column is a Ni-column affinity chromatography column (Ni-NTA).

The fifth aspect of the present invention provides a kit, said kit comprising: the polynucleotide as provided in the first aspect of the present invention; or

The expression vector as provided in the second aspect of the present invention; or

The host cell as described in the third aspect of the present invention; or

Or the acyl-CoA oxidase prepared according to the method described in the fourth aspect of the present invention.

Compared with the prior art, the present invention has at least the following advantages:

(1) The present invention selects a bacterial source capable of expressing high-enzyme activity soluble acyl-CoA oxidase from a large number of strain sources containing acyl-CoA oxidase through genetic engineering technology, and provides a corresponding industrial production of acyl-CoA oxidase Enzyme method, which has simple purification steps, high enzyme activity, high protein expression and low production cost;

(2) In a preferred embodiment of the present invention, optimized codons with high soluble expression levels are obtained through synonymous codon preference optimization screening, further improving yield and production efficiency.

It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described in the following (such as embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, we will not repeat them here.

Description of drawings

One or more embodiments are exemplified by pictures in the accompanying drawings, and these exemplifications are not intended to limit the embodiments.

1 is an SDS-PAGE identification diagram of the expression product of acyl-CoA oxidase derived from Barnerella in LB medium according to an embodiment of the present invention (the recombinant plasmid contains optimized codon I);

Figure 2 is an SDS-PAGE identification diagram of the expression product of acyl-CoA oxidase derived from Barnerella in TB medium according to an embodiment of the present invention (the recombinant plasmid contains optimized codon I);

Figure 3 is an SDS-PAGE identification diagram of the induced expression product of the amoeba-derived acyl-CoA oxidase in TB and LB medium at 18°C according to the embodiment of the present invention;

Figure 4 is an SDS-PAGE identification diagram of the induced expression product of acyl-CoA oxidase derived from Pseudomonas in TB and LB medium at 18°C according to an embodiment of the present invention;

Fig. 5 is the SDS-PAGE figure of the purified acyl-CoA oxidase derived from Barnerella according to the embodiment of the present invention (optimized codon I is contained in the recombinant plasmid);

Fig. 6 is a standard curve diagram of measuring activity of acyl-CoA oxidase according to the embodiment of the present invention.

Detailed ways

After extensive and in-depth research, the present inventors have developed a method based on genetic engineering to prepare acyl-CoA oxidase with high enzyme activity, which improves the expression of soluble protein and is suitable for large-scale industrial production. In the present invention, the development of the method for acyl-CoA oxidase with high enzyme activity based on the preparation of genetic engineering is based on the following procedure: S1: firstly, strain source screening is carried out by genetic engineering technology, and those expressed in Escherichia coli are discarded as inclusion bodies S2: Collect the supernatant soluble protein crude product for enzyme activity detection, further discard those bacterial strains that express the product in Escherichia coli without enzyme activity, and select soluble expression and enzyme activity in Escherichia coli High strain source; S3: optimize the synonymous codon preference for the gene sequence encoding acyl-CoA oxidase in the finally selected strain source, and select the optimized codon with high soluble protein yield from several optimized codons Based on the optimized codon, a matching acyl-CoA oxidase expression method was developed, and a large amount of soluble acyl-CoA oxidase with high enzymatic activity was cultivated.

The method for preparing acyl-CoA oxidase suitable for large-scale industrial production in the present invention involves 1) the steps of obtaining the target gene/obtaining the relevant nucleic acid sequence of the target protein; 2) performing synonymous codon optimization on the target gene to obtain optimized codons 3) the step of introducing the optimized codon into the vector; 4) the step of introducing the vector into the host cell; and 5) the step of culturing the host cell and obtaining the target protein. Preferably, 6) the step of purifying the protein of interest is also involved.

Obtain the target gene/acquire the nucleic acid sequence related to the target protein

The nucleic acid sequence information related to the target gene or target protein in the present invention is obtained by analyzing the amino acid sequence of the acyl-CoA oxidase in different bacterial sources. The same protein from different biological sources has different amino acid sequences, and the gene sequence obtained based on the target protein from different sources usually has unpredictable functional activity. In one embodiment of the present invention, the amino acid sequences of a large number of target proteins from different sources are analyzed through the NCBI database to obtain target gene sequence information from different sources. In some embodiments, the acyl-CoA oxidases derived from Barnerella, Amoeba and Pseudomonas are analyzed through the NCBI database to obtain the corresponding acyl-CoA oxidase gene sequence information.

After obtaining the sequence information of the target protein, the soluble polynucleotide sequence is prepared by methods well known to those skilled in the art. The full-length nucleotide sequence or its fragments of the target protein or its elements in the present invention can usually be obtained by PCR amplification, recombination or artificial synthesis. For the PCR amplification method, primers can be designed according to the published relevant nucleotide sequences, especially the open reading frame sequence, and a commercially available cDNA library or a cDNA library prepared by a conventional method known to those skilled in the art can be used as Template, amplified to obtain related sequences. When the sequence is long, it is often necessary to carry out two or more PCR amplifications, and then splice together the amplified fragments in the correct order.

Once the relevant sequences are obtained, recombinant methods can be used to obtain the relevant sequences in large quantities. Usually, it is cloned into a vector, then transformed into a cell, and then the relevant sequence is isolated from the proliferated host cell by conventional methods.

In addition, related sequences can also be synthesized by artificial synthesis, especially when the fragment length is relatively short. Often, fragments with very long sequences are obtained by synthesizing multiple small fragments and then ligating them.

The method of amplifying DNA/RNA using PCR technique is preferably used to obtain the gene of the present invention. Primers for PCR can be appropriately selected based on the sequence information of the present invention disclosed herein, and can be synthesized by conventional methods. Amplified DNA/RNA fragments can be separated and purified by conventional methods such as by gel electrophoresis.

Synonymous codon preference optimization

The present invention relates to polynucleotide sequences optimized for synonymous codon bias. The obtained target gene sequence is optimized for synonymous codon bias, and the target gene sequence optimized for synonymous codon bias can express the same amino acid sequence as the target protein. In some embodiments of the present invention, E. coli synonymous codon preference optimization is carried out through the gene sequence derived from Barnerella, and several optimized codons are obtained, exemplarily the optimized codon shown in SEQ ID NO:1 Optimized codon IV, optimized codon V, optimized codon VI and optimized codon VII shown in codon I, SEQ ID NO:4-7. In another embodiment, several optimized codons are obtained by optimizing the preference of Escherichia coli synonymous codons to the amoeba-derived gene sequence, for example, the optimized codon II shown in SEQ ID NO:2. In another embodiment, several optimized codons are obtained by optimizing the preference of Escherichia coli synonymous codons to the gene sequence derived from Pseudomonas, for example, the optimized codon III shown in SEQ ID NO:3 .

The target protein gene from the same source, several optimized codons obtained through optimization of synonymous codon preference in different ways, usually, although these optimized codons can express the target protein with equivalent activity in the host cell, the expression level is not same. In some embodiments of the present invention, among the optimized codons obtained by optimizing the synonymous codon preference of Escherichia coli through the acyl-CoA oxidase gene sequence derived from Barnerella, a large number of inclusion bodies are expressed, and some of them are soluble. Exemplarily such as optimized codon I and optimized codon V, optimized codon VI and optimized codon VII, only optimized codon I has soluble expression. Under the same conditions, there are optimized codons for soluble expression, and there are obvious differences in the expression of soluble proteins. For example, optimized codon I and optimized codon IV, the expression of optimized codon I into E. coli is significantly higher in optimizing codon IV.

The target protein genes from different sources, after optimization of synonymous codon preference, have large activity differences in the expression products obtained by introducing into host cells. In one embodiment, the optimized codon I derived from Barnerella and the optimized codon II derived from amoebae after optimizing the preference of synonymous codons in E. The optimized codon Ⅰ derived from Nessella has enzymatic activity.

The present invention also relates to a polynucleotide having a homology greater than 80%, preferably greater than 85%, more preferably greater than 90%, more preferably greater than 91%, more preferably greater than 95% with the sequence shown in SEQ ID NO: 1-7; and polynucleotides complementary to the sequences shown in SEQ ID NO: 1-7.

Carrier of target gene

Also contemplated in the present invention are vectors comprising the polynucleotides (codon optimized) of the present invention. "Vector" in the present invention means a linear or circular DNA molecule comprising a segment encoding a protein of interest operably linked to other segments that provide for its transcription. Such additional segments may include promoter and terminator sequences, and may optionally include one or more origins of replication, one or more selectable markers, enhancers, polyadenylation signals, vectors, and the like. A vector segment may be derived from a host organism, another organism, plasmid or viral DNA, or may be synthetic. The vector can be any expression vector that is synthetic or convenient for recombinant DNA manipulation, and the choice of the vector usually depends on the host cell into which the vector is to be introduced. Thus, a vector may be an autonomously replicating vector, ie a vector, which exists as an extrachromosomal entity whose replication is independent of chromosomal replication, such as a plasmid. Alternatively, the vector may be one that, when introduced into a host cell, integrates into the genome of the host cell and replicates with the chromosome into which it has integrated. In one embodiment, the vector of the invention is an expression vector. In one embodiment of the present invention, pET-28a(+) is selected as the vector to obtain higher expression efficiency.

Methods well known to those skilled in the art can be used to construct expression vectors containing the coding DNA sequence of the protein of the present invention and appropriate transcription/translation control signals. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology and the like. Said DNA sequence can be operably linked to an appropriate promoter in the expression vector to direct mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Exemplarily, the DNA endonuclease is used to cut the carrier DNA molecule into a linear molecule that can be connected with the foreign gene, and then the codon-optimized target gene fragment is connected to the carrier, and the sticky end connection with a single enzyme cutting site can be selected , Directional cloning of double-digested fragments, sticky-end ligation of different restriction enzyme sites, blunt-end ligation, artificial adapter ligation or ligation with oligonucleotide ends to achieve the insertion of exogenous DNA fragments.

Transform host cells with the vector containing the gene of interest

The present invention also relates to host cells produced by genetic engineering using the vector or fusion protein coding sequence of the present invention. The vector containing the codon-optimized gene of interest can be inserted, transfected or otherwise transformed into the host cell by known methods, thereby obtaining a transformant containing the codon-optimized gene of interest of the present invention and capable of expressing the protein of interest . A "host cell" in the present invention is a cell into which exogenous polynucleotides and/or vectors have been introduced. The host cell can be a eukaryotic host cell or a prokaryotic host cell, and the host cell is preferably a bacterium, and preferably Escherichia coli, more preferably Escherichia coli Rosetta (DE3) strain.

Method for preparing target protein

The present invention also relates to a method for preparing the target protein, and the polynucleotide sequence of the present invention can be used to express or produce the recombinant protein. Generally speaking, there are the following steps:

(1) Transform or transduce a suitable host cell with the polynucleotide (or variant) encoding the protein of the present invention, or with a recombinant expression vector containing the polynucleotide;

(2) host cells cultured in a suitable medium;

(3) Separation and purification of protein from culture medium or cells.

Wherein, step (1) transforming or transducing suitable host cells with the recombinant expression vector containing the polynucleotide can be carried out by conventional techniques well known to those skilled in the art. When the host is Escherichia coli, heat shock and electroporation can be selected. law etc.

The obtained transformant can be cultured by conventional methods to express the polypeptide encoded by the gene of the present invention. According to the host cells used, the medium used in the culture can be selected from various conventional mediums, preferably SB, TB, LB or SOC medium. The culture is carried out under conditions suitable for the growth of the host cells. After the host cells have grown to an appropriate cell density, the selected promoter is induced by an appropriate method (such as temperature shift or chemical induction), and the cells are cultured for an additional period of time. In order to promote the expression of the target protein and increase the expression level of the soluble protein, in a preferred embodiment of the present invention, host cells cultured in TB or LB medium are used, and the medium used contains a kanamycin resistance gene.

In order to further promote the soluble expression of the target protein, in a preferred embodiment of the present invention, after culturing the host cells until the OD ₆₀₀ is between 0.6-0.8, IPTG is used to induce, and at 17 to 19 ° C or 35 to 39 Cultivation was continued for about 8 to 12 hours at °C.

The protein in the above method may be expressed inside the cell, or on the cell membrane, or secreted outside the cell. Proteins can be isolated and purified by various separation methods by taking advantage of their physical, chemical and other properties, if desired. Therefore, in the present invention, after the target protein is successfully cultured, it also involves the steps of isolating and purifying it, for example, in step (3), separating and purifying the protein from the culture medium to obtain a high-purity target protein. Although the method of purifying the target protein can be a conventional means well known to those skilled in the art, including but not limited to: conventional refolding treatment, treatment with protein precipitation agent (salting out method), centrifugation, osmotic destruction, supertreatment, ultracentrifugation , Molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography techniques and combinations of these methods. A preferred embodiment of the present invention provides a method for separating the target protein, the steps include: eluting the broken target protein supernatant through a chromatographic column when the flow is the same, and collecting the eluate; the mobile phase includes BufferA, BufferB and/or BufferC; Wherein, BufferA comprises tris (Tris, concentration 50mM) and NaCl solution (concentration 50mM); BufferB comprises tris (Tris, concentration 50mM), NaCl solution (concentration 50mM ) and imidazole (Imidazole, concentration 500mM); BufferC includes tris (Tris, concentration 50mM) and NaCl solution (concentration 1M).

Preferably, in the elution step, the elution procedure includes a first stage and a second stage; in the first stage, the mobile phase used is BufferA; in the second stage, the mobile phase used is BufferA and BufferB, wherein the volume percentage of BufferA gradually decreases from 100% to 40%, and the volume percentage of BufferB gradually increases from 0% to 60%.

More preferably, the elution procedure further includes a third stage, and in the third stage, the mobile phase used is BufferB.

The eluted and purified target protein product is dialyzed, and the dialyzed sample is collected. Dialyzed samples can be measured by BCA method concentration, to calculate the yield.

In this disclosure, use of any exemplary or exemplary language (eg, "") provided with respect to certain embodiments herein is for the purpose of better presenting the invention only and does not limit the scope of the invention otherwise claimed. scope. Nothing in the text should be construed as indicating any non-recited element in the claims indispensable to the practice of the invention.

If the definition or use of a term in a cited document is inconsistent or inconsistent with the definition of the term described herein, the definition of the term described herein applies instead of the definition of the term in the cited document.

Various terms used in this article are as follows. To the extent a term used in a claim is not defined below, it should be given the broadest definition persons in the art have given that term as reflected in printed publications or issued patents at the time of filing.

As used herein, the term "isolated" refers to a nucleic acid or polypeptide that is separated from at least one other component (eg, nucleic acid or polypeptide) of the nucleic acid or polypeptide in its natural source. In one embodiment, a nucleic acid or polypeptide is found only in the presence, if any, of solvents, buffers, ions or other components normally present in solution thereof. The terms "isolated" and "purified" do not include nucleic acids or polypeptides as they exist in their natural source.

As used herein, the terms "polynucleotide" and "polynucleotide sequence" may be in the form of DNA or RNA. Forms of DNA include cDNA, genomic DNA or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be either the coding strand or the non-coding strand.

The present invention also relates to variants of the above polynucleotides, which encode protein fragments, analogs and derivatives having the same amino acid sequence as the present invention. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide, which may be a substitution, deletion or insertion of one or more nucleotides, but does not substantially change the function of the encoded polypeptide.

As used herein, the term "codon optimization" refers to avoiding codon usage differences based on the actual expression or production of proteins (including Escherichia coli, yeast, mammalian blood cells, plant cells, insect cells, etc.) A way to improve the efficiency of gene synthesis by using low-utilization or rare codons.

As used herein, the terms "homology" and "identity" are used interchangeably to refer to the percentage of identical (ie identical) nucleotides or amino acids between two or more polynucleotides or polypeptides. Sequence identity between two or more polynucleotides or polypeptides can be measured by the following methods. Align the nucleotide or amino acid sequences of polynucleotides or polypeptides, score the number of positions in the aligned polynucleotides or polypeptides that contain the same nucleotide or amino acid residue, and compare this with the aligned polynucleotides or polypeptides Compare the number of positions containing different nucleotide or amino acid residues in . Polynucleotides may differ at a position, for example, by the inclusion of different nucleotides (i.e., substitutions or variations) or deletions of nucleotides (i.e., insertion or deletion of one or two nucleotides in a polynucleotide ). Polypeptides may differ at one position, for example, by the inclusion of amino acids (ie, substitutions or variations) or deletions of amino acids (ie, insertions or deletions of amino acids in one or both polypeptides). Sequence identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of amino acid residues in the polynucleotide or polypeptide. For example, percent identity can be calculated by dividing the number of positions containing identical nucleotides or amino acid residues by the total number of nucleotides or amino acid residues in the polynucleotide or polypeptide and multiplying by 100.

As used herein, the terms "sequence complementarity" and "reverse sequence complementarity" are used interchangeably to refer to a sequence that is oriented in the opposite direction to an original polynucleotide sequence and that is complementary to the original polynucleotide sequence. For example, if the original polynucleotide sequence is ACTGAAC, its reverse complement is GTTCAT.

As used herein, the term "expression" includes any step involved in the production of a polypeptide in a host cell, including but not limited to transcription, translation, post-translational modification, and secretion. Following expression, it can be harvested, ie, the host cells or the expression product are recovered.

In order to make the purpose, technical solutions and advantages of the embodiments of the present invention more clear, the present invention will be further described below in conjunction with specific embodiments. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. For the experimental methods without specific conditions indicated in the following examples, the conventional conditions or the conditions suggested by the manufacturer are usually followed. Percentages and parts are by weight unless otherwise indicated. The experimental materials and reagents used in the following examples can be obtained from commercially available channels unless otherwise specified.

Unless otherwise specified, the technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the application belongs. Exemplary implementation of the application.

Example 1

In this example, plasmids containing optimized codons encoding acyl-CoA oxidase derived from Barnerella, Amoeba and Pseudomonas were synthesized and introduced into Escherichia coli to obtain single clones.

(1) Construction of an acyl-CoA oxidase plasmid

The gene sequence of the acyl-CoA oxidase derived from Barnerella was obtained, and the synonymous codon preference of Escherichia coli was optimized to obtain the optimized codon Ⅰ (SEQ ID NO.1), which was connected to pET-28a (+ ) carrier, and entrusted Suzhou Jinweizhi Biotechnology Co., Ltd. to synthesize it.

The gene sequence of acyl-CoA oxidase derived from amoeba was obtained, and the synonymous codon preference optimization of Escherichia coli was carried out to obtain the optimized codon II (SEQ ID NO.2). Connected to the pET-28a(+) vector, and entrusted Suzhou Jinweizhi Biotechnology Co., Ltd. to synthesize it.

The gene sequence of acyl-CoA oxidase derived from Pseudomonas was obtained, and the synonymous codon preference of Escherichia coli was optimized to obtain the optimized codon III (SEQ ID NO.3). Connected to the pET-28a(+) vector, and entrusted Suzhou Jinweizhi Biotechnology Co., Ltd. to synthesize it.

(2) Recombinant plasmid introduced into host Escherichia coli

Take 1 μL of the expression plasmid prepared in the above step (1), add it to 30 μL of Escherichia coli competent BL21(DE3) in an ice bath, place it in an ice bath for 30 minutes, and place it in a water bath at 42°C for 45 seconds, immediately place it on ice for 2 minutes, and add 400 μL In the SOC medium without antibiotics, shake culture at 37°C and 230rpm for 45min. Take 100 μL of the bacterial solution and evenly spread it on the LB plate containing 100 μg/mL kana-resistant, and cultivate overnight in a 37°C incubator.

(3) Expression of the target gene

Pick the single clones prepared in step (2), and inoculate them in LB and TB medium containing 100 μg/mL kana resistance respectively by aseptic operation, do two repetitions, and culture at 37°C with shaking at 220rpm until the OD600 is between 0.6- Between 0.8, IPTG was induced, respectively placed at 37 ° C and 18 ° C shaking culture overnight. Samples were sonicated for SDS-PAGE identification. The identification results are shown in Figures 1 to 4.

According to Figures 1 to 4, the acyl-CoA oxidase derived from Barnerella and Pseudomonas can be expressed supernatantly in Escherichia coli, and the acyl-CoA oxidase derived from amoebae can be expressed in inclusion bodies.

(4) Purification of target protein

Weigh about 4 g of the Barnerella and Pseudomonas-derived recombinant cells prepared in step (3), add 20 mL of LysisBuffer and disperse on ice using a disperser. Ultrasonic disruption of cells: Ф10 probe, power 10%, working for 5.5s, stopping for 9.9s, ultrasonic disruption for 30min. Centrifuge at 20,000 rpm at 4°C for 30 min, take the supernatant, and filter through a 0.22 μm membrane. Use 1mL Ni-NTA to purify, refer to Table 1 for the preparation of mobile phase components, the mobile phase flow rate is 0.5mL/min, use 20mL Lysis Buffer to wash the UV and conductance to the baseline after loading the sample. The elution program includes: Step 1: 0% B, 10CV, 1.5ml/min; Step 2: 0—60% B, 20CV, 1.5ml/min; Step 3: 100% B, 15CV, 1.5ml/min.

Table 1

The purified product was collected for subsequent enzyme activity testing. The electrophoresis results of the purified products from some sources are shown in Figure 5 (Figure 5 is the electrophoresis results of the acyl-CoA oxidase derived from Barnerella bacillus after collection. It can be seen from Figure 5 that the target protein can be hung on the column and begins to elute at a concentration of 130mM imidazole According to SDS result, select eluent B1-B7 to carry out dialysis, the sample 13mL that obtains after dialysis.Use BCA to measure concentration, the result is: R2=0.996, and its concentration is 1.917mg/mL, and output is 24.921mg, and yield rate is 6.23 mg/g bacteria).

SEQ ID NO.1

ATGACCGAAGTAGTTGACCGTGCTTTCTTCTCCGGCTTCTCCTGGTTCCACTACCGCTGCGGCAGATGGTGCGAAAGTAGC

GGTTGAACCGCGTGTTGACGTTGCAGCTCTGGGTGAACAACTGCTGGGCCGTTGGGCGGATATCCGTCTGCACGCACGTG

ACCTGGCTGGTCGTGAGGTGGTTCAGAAAGTTGAGGGCCTGACTCACACTGAACACCGTTCTCGTGTTTTTGGTCAACTG

AAATACCTGGTTGACAACAACGCCGTACACCGTGCATTCCCATCTCGTCTGGGCGGTTCTGACGATCATGGTGGCAATAT

CGCAGGCTTCGAAGAACTGGTTACTGCTGATCCGAGCCTGCAGATCAAAGCGGGCGTACAGTGGGGTCTGTTTGGTAGCG

CGGTTATGCACCTGGGCACCCGTGAACATCACGATAAATGGCTGCCGGGTATCATGTCCCTGGAGATCCCGGGCTGCTTC

GCAATGACCGAGACTGGTCACGGCTCCGACGTCGCTTCTATTGCAACCACCGCAACCTACGATGAAGAAACTCAGGAATT

TGTGATCGACACCCCATTCCGTGCAGCATGGAAAGACTACATCGGCAACGCAGCAAACGATGGTCTGGCGGCGGTTGTTT

TCGCCCAGCTGATCACGCGTAAAGTAAACCATGGTGTGCATGCTTTCTACGTTGATCTGCGTGACCCGGCGACTGGTGAC

TTTCTGCCGGGTATTGGTGGTGAGGACGACGGTATCAAAGGTGGCCTGAACGGTATTGACAATGGCCGTCTGCATTTCAC

CAACGTTCGTATTCCGCGTACCAATCTGCTGAACCGTTACGGCGACGTAGCTGTTGACGGTACCTACAGCAGCACTATCG

AATCCCCGGGTCGTCGCTTTTTTCACCATGCTGGGCACTCTGGTTCAAGGTCGCGTAAGCCTGGATGGCGCAGCCGTTGCA

GCATCTAAAGTGGCTCTGCAGAGCGCTATTCATTATGCAGCGGAACGTCGCCAGTTCAACGCTACTAGCCCTACCGAAGA

AGAAGTCCTGCTGGACTACCAGCGTCATCAGCGCCGTCTGTTCACGCGTCTGGCAACCACCTACGCTGCATCCTTCGCTC

ACGAGCAGCTGCTGCAGAAATTCGATGATGTTTTCAGCGGCGCACACGATACCGATGCAGATCGTCAGGATCTGGAAACC

CTGGCGGCTGCGCTGAAACCGCTGTCTACTTGGCACGCACTGGATACGCTGCAGGAATGCCGTGAAGCTTGTGGTGGCGC

GGGTTTCCTGATTGAAAACCGTTTCGCTTCCCTGCGCGCTGACCTGGATGTGTACGTCACCTTTGAAGGTGATAACACCG

TTCTGCTGCAGCTGGTTGCGAAACGTCTGCTGGCTGACTACGCTAAAGAATTCCGTGGCGCTAACTTTGGTGTTCTGGCG

CGCTATGTGGTTGATCAAGCTGCGGGTGTAGCACTGCACCGTACTGGTCTGCGTCAGGTGGCTCAGTTCGTCGCTGATTC

TGGTTCTGTTCAGAAAAGCGCTCTGGCACTGCGCGACGAAGAGGGTCAGCGTACTCTGCTGACCGACCGTGTGCAATCTA

TGGTGGCTGAAGTTGGTGCTGCGCTGAAAGGTGCTGGTAAACTGCCGCAGCATCAGGCAGCAGCGCTGTTTAACCAGCAC

CAGAACGAACTGATCGAAGCGGCTCAAGCGCATGCTGAACTGCTGCAATGGGAAGCGTTCACCGAAGCACTGGCGAAAGT

AGATGACGCGGGCACGAAAGAAGTTCTGACCCGCCTGCGCGACCTGTTTGGTCTGTCCCTGATTGAAAAGCATCTGAGCT

GGTATCTGATGAATGGTCGTCTGTCCATGCAACGTGGTCGTACCGTTGGCACGTATATCAACCGTCTGCTGGTTAAAATC

CGTCCGCACGCGCTGGATCTGGTAGATGCATTCGGCTACGGTGCTGAACATCTGCGTGCTGCTATCGCAACTGGTGCCGA

AGCAACCCGTCAGGACGAAGCGCGTACTTACTTCCGTCAGCAACGCGCGTCTGGTTCTGCACCGGCTGATGAAAAAACTC

TGCTGGCGATCAAAGCAGGCAAAATCTCGC

SEQ ID NO.2

ATGAACCCGGACCTGAAACGCGAACGTAAAGGCGCATCCTTTGATGCAACCGCAACTCGTGAACGTTTTCAGAAACTGGT

AGCGGATGAACCGGTGTTTGCGAATGATGACAAATACTTCCTGTCTCGTGTGCAGAACTATGAACGTGTTCTGCAGAAGG

TTGTGCGCGGCATCCAAATGTGCATCGAACATAACATCACTCCGGAAGATGCGGAATACCTGTTCCACTTCATCGGTGAA

GAGTTCATGGTTGCGCTGCACTGGTCCATGTTCATCCCGACCCTGCAGGGTCAGGCTACCAACGACCAGAAACTGCAGTG

GCTGCCGCTGGCGCAGACCTTCCAGATCATTGGCTGTTATGCCCAGACGGAGATGGGTCATGGCTCCAACGTGCGTGGTC

TGGAAACGACCGCGACCTACGACAAAGCGACGCAGGAATTCGTTCTGCATTCCCCCTACCCTGACTTCCACCAAATGGTGG

CCGGGCGGCCTGGGCAAAACGTCCACTCACTGCGTCACTCACGCACGTCTGCTGGTGGAAGGCAAGGACCATGGTGTGGC

CACCTTCATCGTTCAGATTCGCTCTACCGATGACCATGCGCCGATGCCGGGCGTAACTGTCGGCGATATCGGTCCTAAAT

TTGGCTACGACACCCAGGATAACGGTTTCCTGCGTTTTGACCACGTTCGTATCCCACGTGATCAAATGCTGATGAAATAC

AAGCAGGTCTCCCCGGAAGGTGTTGTGACCGAAGCACCGAAAAAGCTGTCTAAACTGAGCTATGGCACCATGATGTACAT

TCGCTCCCGCATCGTTGGTGGTGCATCCTCTACGCTGGCACGTGCGTGCACCATTGCAGTACGTTATTCCGCTGTACGTC

GTCAGTTCAGCGACGCAGACAACGAACCGGAAAAACAGGTACTGGACTACCGTATGCAGCAGTATCGTCTGCTGCCGCTG

CTGGCCACTGCATACGCATTCCATTTCACCGGTCGTTACATGCGTAACATCTACGATGAGCTGATGCGTAACATCCAGTC

CGACGACGTGTCTGCGCTGCCGGAAGTTCACGCGACCTCTGCGGGCCTGAAAGCGGTTACCACTTGGATGACCGCGGATG

GTATTGAGGAATGCCGTAAATGCTGCGGTGGCCACGGCTACAGCAAGTTTGCGGGTATTTCTGACATTTACGTAAACTAT

GTACCAGCCTGCACTTATGAAGGCGATAACGTTGTCATGTGCCTGCAGACCGCGCGTTACCTGGTTAAGACCGCACGTGG

CGCTGCAAAGGGTGAACCTCTGGTGGGCAGCGTGCAGTGTCCGGCGCAGAAAGTTGCGGATTTCCTGTGCCCGCGTACCT

GGGTTGATGCTTTTGCGCTGCGTGCACGCTTCTGCGTTTTCGAGACCGTTAAAAAACTGGACGCTCTGAAGGGTCGTGGT

CTGAACGATAAACAGGTTTGGAACGAAGCTCAGATCGATCTGGTAAAGATGACCAAAGCGCATTGTTATTACACCATCGT

GCGTAATTTCGCAAACGCGGTAGAAAAGGTTGAGGATAAACAGCTGCAGGCCGTTCTGCACAAACTGTGCATGCTGTTCG

CGCTGTACCAGGTGCAGCGTGACCTGGGCGATTTTACTTGTTCTGGTTACCTGGCTCAGGAACAGGTCCCGCTGCTGAAC

GAAGCTGTGGAAGTGCTGCTGAGCGAACTGCGTAAAGACGCTGTACCGCTGGTAGACTCTTTCGACTTCTCTGATCACTT

TCTGAACAGCAGCCTGGGTCGTTACAACGGTGACGTCTATGAGCACATGTATAAATGGGCGCAGAAGGAACCACTGAACC

AGGCGCCGTACGCTACCCAGCCTCCAGGCTATGAAAAATACCTGAAACGCCTGCTGAACGGCGAGGTACTGCAGGAAGCC

ATCCAGAACAAAATGACTAAAGCTAACCTG

SEQ ID NO.3

ATGACTGACAGCCTCTATTCCTGGCGCTGATGCACTGAAGGCACGTGATGAACTGCGCGATGTTCTGTTTGGCGGTACCTT

CGAATCTCACCATCAGTCCATTCGCAAAGTGCTGCTGGACCCGATCTTCGATCCGCAGAGCGGTCTGAACATGGAACAAG

CTGGTCGTCTGGCTTACGCTCGTAGCCGTCATGTGCACGGTGCGCTGGAACGTCCGCTGGAAATTCTGGCGAACCCGCGT

CGTCTGTTCGCTCTGGCAGAATGGCCGTCTCTGCTGGATGTTGCATCTTTTAGCCTGCTGATGGTGCACTACAACCTGTG

CCTGGGTACCGTGTTCGACCATGCGCGCGACCGTTCCGATATCGCTGATCTGACCGAAGCCCTGGACGGCCTGACCTCTT

TCGGTCCTTACATGGCTACCGAACTGGGTTTCGGTAACAATGTCGCTGCTCTGCAAACTGAAGCAGTGTACGATCGTCAG

AGCCAGACCTTCACCCTGAACACCCCATCTGTTTCTGCGCAGAAATACATGAGCTACAGCGGCTTCGGCGACATCCCGAA

AGTGGCAACCGTTATGGCGCGTCTGAAAATCGAAGGTAAAGATTATGGCGTCTTCCCGTTCCTGGTTCGCCTGTCTACTG

AGGCTGGTCTGTGCCCAGGTATCCGTGCTGCACTGTGTCCGGAAAAACCGGTTCAGGGCCTGGATAACGGTCTGACCTGG

TTTGACAACGTGCGCGTACCGCGTTCTAGCCTGCTGCATGGTGATATGGGTCACTTCGCCGAAGATGGTCACTTCGTAGT

TGGTGCAGGCAACGCTCGTTCTCGTTTCCTGCGCGCAATGAGCCGCATTGTTCCAGGTCGTCTGTGCGTTGCATCTGCAG

CGCAGGGCGCATCTCGTGCATCTCTGTACATCGCGCTGCGTTATGGTCAACAGCGTCTGACTAACGCTCCGGGTACTAAC

GATATGCCGGTTATTGAATATCGTTCTTACCAGGTCCCACTGTTCTCTGCACTGGCGTCTACCTACGCCATGACCCTGCT

GCTGAACGAAGCTAAGGCGCGTTTCCTGGCAAACACCACTGAACCGGCTGTTGACGTTGTGTCTCTGATCAACATCACCA

AAGCTCTGGCGACTTGGGACGCGTCTGCAGTCATCGCAGAGTGTCGCGAACGTTGTGGTGCACAGGGCATCTTCTCTGCC

AACCGTATCGCTGACTACGGTTCTCTGCTGCAGGGCCTGGTCACCGCAGAAGGTGATAACCTGGTCCTGCTGGCTACCGT

TGCAGGCCAGCTGCTGGCTCAGGTATGGCAGGGTCCAGAACCTCTGCGTCCGGTTCGTGCTCGTCGTCTGGCTGAACCTG

AGTGGCTGATCGCCGCTATTGCGTTCCGCGAACATCAACTGTGGCTGACCATCCGCGAAGAAATGAACACTGATGAGCGT

GGCTATTTCGAAGTGTGGAACGACGCAATGAACCCTGGCCTGGAACTGGCTCGTCTGCGTGGTGAACGTCTGGCACTGGA

ACAGCTGTGGTCTGCCTCTCTGCACGCACAGCAAGACGAGGCTAAAGCGGCGCTGAACTGTCTGGCAAGCCTGTACGGTC

TGAACCTGCTGCGTCGTGACGCGGCTTGGTACCTGGCACACGAACTGATTGATGCTGGTCAAGCACTGTCTCTGCCGGGC

CGTATCGATCAACAGTGCGTTGCACTGCGTCCGCATGTTTCCATGCTGATTGACGGTTTTGGTCTGAGCCCTGAACTGCT

GCGTGCTCCGATCGCTCAGGACGATTACATCCAGGCCTTCTGCAAACAGGTTAATGCGAACGTAGAC

Example 2

In this example, the purified acyl-CoA oxidases from Barnerella and Pseudomonas were used for subsequent enzyme activity detection experiments. Specific steps are as follows:

(1) Solution preparation

1M Tris-HCl pH 8.0: Weigh 121.14g of Tris powder, pour it into a 1L beaker and add sterilized purified water to 800ml. After stirring evenly, use concentrated hydrochloric acid to adjust the pH to 8.0 at 25°C, and then adjust the volume to 1L. Filter at 0.22um, store at 4°C;

5mM palmitoyl-CoA: Weigh 10mg of palmitoyl-CoA powder and dissolve in 1.99mL deionized water.

5mM FAD: Weigh 0.0041g FAD powder, dissolve it in 1mL deionized water, and store in the dark. .

0.1% 4-aminoantipyrine: Weigh 0.05g 4-aminoantipyrine powder, dissolve it in 50mL deionized water, and store in the dark.

0.1% phenol: Weigh 0.05g of phenol powder and dissolve in 50mL of deionized water, and store in the dark.

Refer to Table 2 for the preparation of 5mL working solution.

Table 2

Reagent add volume Final concentration 1M Tris-HCl 0.1mL 20mM 0.1% 4-AA 1.56mL 1.5mM 0.1% phenol 1mL 2.1mM Peroxidase (5U/μL) 5μL 25U FAD (5mM) 10μL 10μM Palmitoyl-CoA (5mM) 500μL 0.5mM ddH2O 1795μL the

Preparation of positive enzyme: Dissolve 200U positive enzyme (commercially available acyl-CoA oxidase reference substance) in 0.2mL PBSpH 7.4 buffer solution to make 1U/μL enzyme solution, and gradually dilute it according to the gradient. The diluent is PBS pH 7.4 buffer.

(2) Instrument testing

Preheat the microplate reader for 30 minutes, add 100 μL of the reaction solution, and measure the absorbance at 500 nm. Add 1 μL of enzyme diluent to the blank group, and measure the absorbance A1 at 500 nm. Add 1 μL of enzyme solutions of various concentrations in the experimental group, shake and mix for 5 seconds. After reacting for 5 minutes, the absorbance value A2 was detected at 500 nm, and a standard curve was drawn as shown in FIG. 6 . Calculate the OD difference A2-A1 between the sample and the blank, and calculate the sample concentration based on the difference. The results are shown in Table 3.

table 3

The concentration of the stock solution of the purified Barnerella-derived recombinant acyl-CoA oxidase is 1.917mg/mL, and the average activity is 0.2611U/μL, so the specific activity is (0.4628*1000)/1.917=241.4U/mg. However, the recombinant acyl-CoA oxidase derived from Pseudomonas has no enzymatic activity after testing.

Example 3

In this example, the Barnerella-derived acyl-CoA oxidase with good enzymatic activity of the purified product was selected, and its coding gene was optimized for Escherichia coli synonymous codon preference in different ways, and the optimized one with higher soluble expression was screened. a.

Select the acyl-CoA oxidase gene sequence derived from Barnerella, and optimize the synonymous codon preference different from Example 1 to obtain a large number of optimized codons, exemplarily as shown in SEQ ID NO.4-7 The codon was optimized, and the recombinant plasmid was synthesized in the same manner as in Example 1 and cultured in Escherichia coli, and the soluble expression level was measured. The results are shown in Table 4.

Table 4

optimized codon Whether there is soluble expression Purification Yield Optimized codon Ⅰ Soluble expression 6.23mg/g Optimized codon Ⅳ Inclusion body expression / Optimized codon Ⅴ Soluble expression 4.58mg/g Optimized codon Ⅵ Inclusion body expression / Optimize codon VII Inclusion body expression /

SEQ ID NO.4:

ATGACTGAAGTAGTGGATAGAGCTAGTTCCCCAGCATCCCCTGGATCAACTACCGCTGCTGCTGATGGTGCCAAAGTTGCAGTTGAACCAAGAGTTGACGTCGCTGCTCTGGGAGAACAGTTACTAGGAAGATGGGCTGATATAAGGTTGCATGCTAGAGATCTGGCTGGTAGAGAGGTCGTTCAAAAGGTCGAGGGTCTTACTCATACCGA ACACAGATCCAGAGTCTTTGGACAACTTAAATACTTGGTCGACAATAACGCCGTTCATAGAGCTTTTCCTAGTAGGTTAGGAGGATCTGATGACCACGGTGGAAACATTGCTGGCTTTGAAGAATTGGTAACAGCTGATCCTTCCCTTCAGATTAAGGCTGGCGTCCAATGGGGCCTTTTTGGATCCGCTGTTATGCACCTTGGTACACGTGAG CACCATGATAAGTGGCTGCCAGGAATTATGAGTCTGGAGATCCCCGGTTGTTTTGCTATGACAGAAACAGGACATGGTTCCGACGTTGCTAGTATTGCAACAACCGCTACTTACGATGAAGAAACTCAGGAGTTCGTCATTGACACTCCATTCCGTGCTGCATGGAAGGACTATATTGGAAACGCTGCTAATGACGGACTTGCTGCAGTGGT ATTTGCCCAACTAATAACACGAAAAGTTAACCATGGCGTTCATGCCTTCTATGTCGATTTGAGAGACCCCGCCACAGGTGACTTTTTGCCAGGTATAGGAGGTGAGGATGATGGTATAAAGGGAGGTTTGAACGGTATAGATAATGGAAGGTTGCACTTCAC

CAACGTAAGAATTCCACGTACAAACCTGCTGAACAGATATGGCGATGTGGCTGTCGACGGTACATACAGTTCAACTATTG

AAAGTCCTGGTCGAAGATTCTTACTATGCTGGGAACCTTAGTTCAGGGACGTGTTAGTTTGGATGGTGCCGCTGTTGCT

GCTAGTAAGGTTGCTTTACAGTCTGCTATCCACTATGCCGCTGAAAGACGTCAGTTCAACGCCACTTCTCTCTACCGAAGA

AGAGGTTTTGTTAGACTACCAAAGGCACCAGAGAAGACTATTCACAAGATTGGCAACAACGTACGCTGCTTCTTTCGCTC

ATGAACAACTTTTGCAGAAGTTTGATGATGTTTTTTCTGGAGCACACGACACTGACGCAGACAGACAGGATCTAGAGACC

CTTGCTGCTGCTCTGAAACCACTATCCACTTGGCACGCACTTGACACCTTGCAAGAATGTAGAGAAGCTTGTGGTGGTGC

TGGTTTCTTGATTGAAAATAGATTTGCTTCCTTAAGAGCAGATTTAGATGTCTATGTCACTTTTGAAGGAGACAATACCG

TTCTGCTTCAACTTGTCGCTAAGCGATTGTTAGCCGATTATGCTAAGGAGTTCAGAGGAGCTAATTTTGGCGTACTGGCA

CGATACGTTGTTGATCAGGCTGCTGGAGTTGCTCTTCATAGGACTGGCCTAAGACAGGTTGCTCAATTCGTAGCCGATTC

CGGAAGTGTGCAAAAGTCTGCCTTGGCACTACGTGATGAAGAAGGTCAAAGAACATTGTTGACCGACCGAGTTCAATCCA

TGGTCGCTGAGGTGGGAGCCGCTTTGAAGGGAGCTGGAAAGCTACCCCAACATCAAGCAGCTGCCCTATTCAACCAACAT

CAAAACGAACTTATTGAAGCAGCACAGGCTCATGCAGAATTATTGCAGTGGGAGGCTTTTCACAGAAGCTTTGGCTAAGGT

TGACGATGCCGGAACTAAGGAAGTGTTGACTAGACTGAGAGACTTGTTTGGTCTATCTCTGATTGAAAAGCACCTATCCT

GGTACTTAATGAACGGTCGACTGTCTATGCAGAGAGGAAGAACTGTCGGAACTTATATTAATAGACTTCTAGTGAAGATC

AGGCCACACGCCCTTGATTTGGTGGATGCTTTCGGATACGGTGCCGAACATCTTAGGGCTGCTATTGCAACTGGTGCTGA

GGCTACAAGACAGGACGAAGCCCGTACTTACTTTTAGACAACAGCGAGCTTCCGGATCCGCACCAGCAGATGAAAAAACAT

TATTAGCTATCAAAGCTGGTAAATCTAGG

SEQ ID NO.5:

ATGACGGAAGTAGTAGACCGAGCATCATCTCCAGCTTCACCAGGATCCACAACAGCTGCTGCAGATGGCGCAAAGGTTGC

GGTGGAACCTAGAGTTGATGTCGCGGCTCTTGGAGAACAGCTTCTCGGCAGATGGGCAGATATTCGTCTGCATGCAAGAG

ACCTTGCGGGGCGCGAAGTCGTTCAGAAAGTGGAAGGACTGACACATACCGAACATCGCTCTCGTGTCTTTGGACAGCTG

AAATACCTGGTCGATAACAATGCTGTGCATCGTGCTTTTCCGAGCAGATTGGGCGGATCTGATGACCACGGGGGAAACAT

CGCCGGCTTCGAAGAACTGGTGACGGCAGATCCTTCACTTCAGATTAAAGCGGGAGTGCAGTGGGGCCTTTTCGGATCAG

CTGTGATGCATCTGGGTACCAGAGAACATCATGACAAATGGCTTCCGGGAATCATGTCACTTGAAATTCCTGGATGTTTC

GCTATGACGGAGACCGGTCACGGGTCTGACGTTGCCTCAATTGCCACAACAGCGACATACGATGAGGAAACACAAGAATT

TGTCATAGACACACCTTTTCGAGCTGCTTGGAAAGATTATAGGAAACGCTGCGAACGATGGCCTTGCAGCGGTAGTTT

TTGCGCAACTTATAACAAGAAAAGTTAACCATGGGGTCCACGCCTTCTACGTTGACCTTAGAGATCCTGCCACAGGTGAT

TTCTTACCAGGTATCGGGGGCGAAGATGATGGTATTAAAGGAGGTTTAAACGGGATCGATAATGGTCGTTTACATTTTAC

TAACGTTCGCATTCCGCGCACTAACTTGTTAAACCGCTATGGCGACGTGGCAGTCGATGGAACATATTCCTCTACGATTG

AAAGCCCGGGACGTCGGTTTTTCACAATGTTAGGCACACTTGTACAAGGTAGAGTCTCGTTAGATGGCGCGGCAGTAGCA

GCAAGCAAAGTTGCTCTGCAGTCTGCCATTCATTATGCTGCGGAACGACGGCAGTTTAATGCGACCAGCCCCGACAGAAGA

AGAGGTCCTTCTCGATTACCAGAGACATCAGAGAAGACTTTTCACTCGTCTTGCAACGACTTATGCGGCTTCCTTTGCTC

ATGAACAGCTTTTGCAAAAATTCGACGATGTCTTTTCTGGCGCGCATGATACTGACGCTGACCGTCAGGATCTGGAGACA

TTGGCCGCCGCCCTTAAACCGTTATCCACCTGGCATGCTTTAGACACGCTTCAAGAATGCCGAGAAGCGTGCGGCGGAGC

AGGTTTTTTGATTGAGAATAGATTTGCGTCCTTGCGCGCGGACTTAGATGTTTTATGTTACATTTGAGGGCGACAACACAG

TACTGTTACAAATTAGTTGCTAAACGCCTGCTTGCCGATTATGCGAAGGAATTCCGAGGCGCTAATTTTGGCGTGCTGGCA

CGCTATGTTGTTGATCAAGCTGCGGGTGTTGCATTGCATCGGACAGGGCTCAGACAGGTTGCTCAATTTGTTGCCGACTC

AGGCTCCGTGCAAAAGTCCGCATTGGCACTGCGGGATGAAGAAGGACAGCGAACGCTGCTGACAGACCGGGTACAGTCTA

TGGTAGCAGAAGTCGGCGCTGCGCTTAAAGGTGCAGGAAAACTTCCGCAGCACCAGGCCGCTGCTCTCTTCAACCAGCAT

CAGAATGAACTGATCGAAGCTGCCCAAGCGCACGCCGAACTGTTACAATGGGAAGCATTCACAGAAGCGCTTGCTAAGGT

AGATGATGCGGGTACCAAAGAAGTGTTAACCCGTCTGAGAGACCTGTTTGGGCTGTCACTGATAGAGAAACATTTATCAT

GGTATCTCATGAACGGACGGCTCAGCATGCAGCGTGGACGTACTGTTGGGACCTACATTAATAGACTTCTGGTAAAAATC

CGCCCTCATGCTCTTGATCTCGTAGATGCTTTTGGCTACGGCGCAGAACATCTTAGAGCTGCAATTGCGACAGGAGCGGA

AGCTACTCGCCAAGACGAAGCACGGACATATTTTTCGGCAGCAGCGAGCAAGTGGTTCAGCCCCAGCAGACGAAAAAACAT

TGCTTGCGATTAAAGCCGGCAAGTCAAGA

SEQ ID NO.6:

ATGACTGAAGTCGTTGATAGAGCATCCTCACCCGCATCTCCAGGTTCAACGACAGCCGCTGCTGATGGTGCTAAGGTTGC

TGTGGAACCAAGAGTTGATGTCGCGGCACTGGGTGAACAATTATTAGGTCGTTGGGCTGATATCCGTCTTCATGCTAGGG

ATTTGGCTGGTAGAGAGGTAGTTCAAAAGGTGGAGGGGTTGACCCACACAGAACATAGATCTAGGGTTTTTGGTCAGTTG

AAATACTTGGTGGATAATAATGCTGTACATAGGGCTTTTCCATCCAGGTTGGGTGGATCAGACGACCATGGTGGTAACAT

CGCAGGTTTTGAAGAACTAGTAACCGCTGATCCATCTCTTCAAATCAAAGCTGGAGTCCAATGGGGCCTGTTCGGGAGTG

CTGTTATGCATCTAGGTACAAGAGAGCATCATGATAAGTGGTTGCCTGGAATAATGAGTTTGGAAATTCCCGGTTGTTTT

GCTATGACCGAGACGGGTCACGGCTCTGATGTCGCCTCCATCGCTACAACTGCAACCTACGATGAAGAAACCCAAGAATT

TGTTATAGATACCCCTTTTAGAGCTGCATGGAAAGATTATATCGGTAATGCTGCAAACGATGGTCTTGCTGCTGTGGTTT

TCGCGCAATTGATTACTCGTAAAGTTAATCATGGTGTTCACGCTTTCTACGTAGATTTGCGTGACCCAGCTACTGGGGAT

TTCTTGCCAGGTATCGGTGGTGAAGACGATGGTATTAAAGGTGGTTTGAATGGGATTGATAATGGCAGATTACATTTTAC

AAACGTGAGAATCCCTAGAACAAACCTTCTAAACAGATATGGAGATGTAGCAGTTGATGGTACCTACAGTTCAACAATAG

AATCACCTGGTAGAAGATTCTTCACCATGTTGGGTACTCTGGTTCAAGGAAGAGTGAGTTTGGATGGGGCAGCAGTTGCT

GCTTCAAAAGTGGCTTTGCAAAGCGCCATTCATTATGCAGCAGAACGTAGACAATTTAATGCCACTTCTCCGACTGAGGA

AGAGGTATTATTGGATTACCAAAGGCATCAGAGGAGGTTATTTACGAGATTAGCAACTACTTACGCTGCATCTTTTGCAC

ACGAACAATTGCTGCAAAAATTTGACGACGTTTTTTTCAGGTGCACATGATACAGATGCCGATAGGCAAGATTTGGAGACT

CTTGCCGCCGCACTTAAACCACTTAGTACTTGGCATGCTCTAGACACTCTTCAAGAGTGCAGAGAGGCATGCGGTGGAGC

GGGATTTCTGATAGAAAATAGATTTGCAAGCTTAAGAGCCGATTTGGATGTCTACGTTACCTTTGAAGGTGACAATACTG

TTCTTTTGCAATTGGTTGCTAAGAGGTTGTTGGCCGATTACGCAAAGGAATTCAGAGGAGCTAATTTTGGTGTTTTGGCC

AGATACGTAGTCGATCAAGCTGCCGGGGTTGCACTGCATAGAACAGGTCTTAGACAAGTGGCACAGTTCGTCGCGGATTC

AGGTAGCGTACAAAAGTCAGCCTAGCCCTTAGGGATGAAGAAGGCCAGAGAACCTTGCTAACTGATAGAGTACAATCTA

TGGTAGCTGAAGTTGGAGCAGCTTTGAAGGGTGCCGGGAAATTACCACAGCATCAAGCCGCAGCGTTGTTTAACCAGCAT

CAAAATGAATTAATCGAAGCTGCTCAAGCTCACGCAGAATTGTTGCAATGGGAAGCTTTTACTGAAGCTCTAGCTAAGGT

CGATGATGCGGGCACGAAAGAGGTTTTGACTAGATTACGTGATCTGTTCGGATTGTCTTTGATTGAAAAACATTTATCTT

GGTATTTAATGAATGGGTCGTTTAAGTATGCAGAGGGGAAGAACAGTTGGTACATATATTAACCGTTTGCTTGTAAAGATA

AGGCCTCATGCGTTGGATCTTGTTGACGCCTTTGGATATGGGGCAGAACATTTAAGGGCTGCTATCGCAACCGGTGCTGA

GGCAACTAGACAAGATGAAGCAAGAACATATTTCAGACAGCAAAGAGCAAGTGGAAGCGCCCCAGCTGACGAAAAGACCT

TGTTGGCTATCAAAGCGGGAAAGTCCAGA

SEQ ID NO.7:

ATGACTGAGGTAGTGGACAGGGCTTCTAGTCCTGCATCTCCTGGATCTACAACTGCAGCTGCCGACGGTGCAAAGGTGGC

AGTTGAGCCTAGAGTGGACGTTGCTGCCCTCGGAGAACAACTGCTGGGTCGGTGGGCCGATATTAGGTTGCATGCCAGAG

ATCTGGCCGGTAGGGAAGTCGTTCAGAAGGTCGAAGGACTGACCCACACCGAACATAGGAGCAGAGTTTTCGGCCAGCTT

AAATACCTGGTTGATAATAATGCAGTCCACAGAGCCTTTCCCAGCCGACTTGGAGGAAGCGACGACCACGGAGGCAATAT

CGCAGGCTTTGAAGAGCTGGTTACCGCCGATCCCTCCCTTCAAATTAAAGCCGGGGTGCAGTGGGGTCTGTTTGGTAGTG

CAGTAATGCACCTGGGCACAAGGGAACACCACGACAAGTGGCTCCCAGGGATCATGAGCCTGGAAATCCCGGGGTGTTTT

GCCATGACCGAAACCGGACATGGCTCTGACGTGGCGTCTATTGCTACAACGGCAACTTACGACGAGGAAACCCAAGAGTT

TGTTATAGATACCCCCTTCAGAGCCGCCTGGAAGGACTATATCGGTAATGCAGCAAACGATGGTCTCGCCGCCGTTGTGT

TTGCCCAGCTGATTACAAGAAAGGTGAACCACGGGGTTCACGCATTTTACGTGGATCTCAGAGACCCTGCAACCGGTGAT

TTCTTGCCTGGCATCGGAGGGGAAGATGACGGGATCAAGGGTGGCCTGAATGGGATTGACAACGGTAGGCTGCATTTCAC

AAACGTGAGGATCCCCAGGACCAACCTGCTCAATAGATACGGTGATGTGGCCGTAGATGGTACATACTCCAGCACCATCG

AGTCCCCCGGACGAAGGTTTTTTTACCATGTTGGGTACGCTCGTCCAGGGCCGGGTGTCTCTTGATGGAGCAGCGGTGGCA

GCTTCAAAGGTGGCCCTCCAGTCTGCCATTCACTACGCTGCTGAGCGAAGGCAGTTCAACGCCACCTCTCCAACCGAGGA

GGAGGTGCTGTTGGATTACCAAAGGCACCAAAGACGCCTTTTCACCCGGCTCGCAACCACATACGCAGCAAGCTTCGCGC

ACGAGCAGCTGCTCCAGAAGTTCGATGACGTTTTCTCTGGAGCCCATGATACCGATGCCGATAGGCAAGACCTGGAGACC

TTGGCAGCAGCACTGAAACCTCTCTCAACCTGGCACGCTTTGGACACTTTGCAGGAATGCAGGGAGGCATGCGGAGGTGC

TGGCTTCCTGATCGAGAACCGCTTTGCTTCACTTCGCGCCGATCTTGACGTATATGTCACTTTCGAAGGGGACAATACCG

TGCTTCTCCAGCTTGTCGCAAAAAGACTGCTGGCAGACTACGCCAAGGAATTCAGAGGAGCAAATTTTGGAGTATTGGCC

AGATACGTCGTGGATCAGGCAGCGGGAGTTGCACTGCACAGGACTGGCTTGCGCCAGGTTGCTCAGTTTGTGGCCGACAG

TGGAAGCGTACAGAAGAGGTGCATTGGCTCTGCGGGATGAGGAAGGGCAGAGAACGCTGCTGACCGATCGGGTGCAGTCAA

TGGTGGCAGAGGTGGGCGCAGCTCTGAAAGGAGCAGGGAAACTGCCTCAGCATCAGGCTGCTGCTCTGTTCAACCAGCAC

CAGAACGAGCTGATCGAGGCCGCACAAGCCCATGCAGAGTTGCTGCAGTGGGAGGCGTTTACAGAGGCCCTGGCTAAAGT

TGATGATGCTGGCACTAAAGAGGTCCTCACTAGGTTGCGGGATCTCTTCGGACTGTCTCTGATTGAAAAACATCTGTCAT

GGTATCTGATGAATGGACGACTTTCCATGCAGCGGGGGAGAACAGTGGGAACTTATATTAACCGGCTGCTGGTAAAAATT

CGACCCCATGCTCTCGACCTGGTGGATGCCTTTGGTTACGGCGCTGAACACCTCCGGGCTGCTATAGCCACTGGAGCAGA

AGCCACAAGGCAGGACGAGGCCAGGACATACTTTAGACAACAGAGAGCCAGTGGATCTGCCCCCGCTGATGAAAAGACCC

TGCTCGCAATTAAAGCAGGCAAGTCCAGG

Those of ordinary skill in the art can understand that the above-mentioned embodiments are specific examples for realizing the present invention, and in practical applications, various changes can be made to it in form and details without departing from the spirit and spirit of the present invention. scope.

Claims (10)

1. An isolated polynucleotide encoding an acyl-coa oxidase, wherein the polynucleotide is codon optimized and the polynucleotide is selected from any one of the following:

(i) A polynucleotide as shown in SEQ ID NO. 1;

(ii) A polynucleotide having a homology of greater than 95% with the sequence shown in SEQ ID NO. 1; and

(iii) A polynucleotide complementary to the sequence set forth in (i) or (ii).

2. An expression vector comprising the polynucleotide of claim 1.

3. The expression vector according to claim 3, characterized in that it is an E.coli expression vector, preferably pET-28a (+).

4. A host cell comprising the expression vector of claim 2 or 3; or alternatively

The polynucleotide of claim 1 integrated into the genome of the host cell.

5. A method for preparing an acyl-coa oxidase, the method comprising the steps of:

transforming a host cell with a vector comprising the polynucleotide of claim 1;

culturing the host cell to express the acyl-coa oxidase.

6. The method of claim 5, wherein the host cells are cultured using TB medium.

7. The method of claim 5, wherein the host cell is cultured at a temperature of 16 to 19 ℃.

8. The method according to claim 5, wherein the medium used in culturing the host cell comprises a kanamycin resistance gene.

9. The method of claim 5, wherein the host cell is cultured to express the protein of interest by IPTG induction.

10. A kit, comprising: the polynucleotide of claim 1; or alternatively

The expression vector of claim 2 or 3; or alternatively

The host cell of claim 4; or alternatively

An acyl-coa oxidase prepared according to the method of any one of claims 5 to 9.

Images