CN116042664A - Preparation method and application of acyl-CoA oxidase - Google Patents

Abstract

The application discloses a preparation method and application of acyl-CoA oxidase. The invention screens out bacterial sources capable of expressing high-enzyme activity soluble acyl-CoA oxidase from a large number of bacterial sources containing acyl-CoA oxidase by genetic engineering technology, and provides a corresponding method for industrially producing the acyl-CoA oxidase.

Description

Preparation method and application of acyl-CoA oxidase

Technical Field

The invention relates to the field of biological medicine, in particular to a preparation method and application of acyl-CoA oxidase.

Background

Acyl-CoA oxidase (ACX/ACO) is widely found in a variety of organisms and is located in the peroxisome and is involved in the first step of beta oxidation of various fatty acids in the peroxisome, which is also the rate-limiting enzyme in the activated metabolism of fatty acids. The ACX gene family has 6 isozymes in total and can be classified into three types according to different recognition carbon chain lengths in catalytic reaction. The method comprises the following steps: long-chain ACX (LACX) recognizing Long-chain fatty acids, medium-chain ACX (MACX) recognizing Medium-chain fatty acids, and Short-chain ACX (SACX) recognizing Short-chain fatty acids. In the field of in vitro diagnosis, acyl-coa oxidase catalyzes an oxidation reaction of acyl-coa, and can be used for detecting the concentration of free fatty acids in blood.

acyl-CoA oxidase can be prepared from natural products, such as plants and microorganisms, and the preparation methods mostly adopt Tris-HCl buffer solution and potassium phosphate buffer solution extraction methods, and in order to improve the purity, various purification processes are often combined, such as: acetone extraction, heat treatment, ammonium sulfate precipitation, phenyl agarose chromatography, and hydroxyapatite molecular sieve column. These steps are complicated, require a plurality of materials, have low yields, and are difficult to be applied to industrial mass production. A method for extracting and purifying a target protein from candida tropicalis is disclosed in literature on purification and property study of candida tropicalis acyl-coa oxidase, and has low yield and specific activity of only 21.8U/mg. The recombinant acyl-CoA oxidase prepared based on genetic engineering is suitable for industrial preparation, but is limited by the factors that the product is mostly expressed by inclusion bodies and the enzyme activity is poor, and the large-scale industrial preparation is still difficult to realize. Therefore, there is still a need in the art to develop a method for preparing acyl-coa oxidase suitable for large-scale industrial production.

Disclosure of Invention

The invention aims to provide a preparation method of acyl-CoA oxidase.

It is another object of the present invention to provide polynucleotide sequences encoding acyl-coa oxidase enzymes.

It is another object of the present invention to provide a vector adapted to a polynucleotide sequence encoding an acyl-coa oxidase.

Another object of the invention is to provide a kit comprising a polynucleotide sequence encoding an acyl-CoA oxidase.

To solve the above technical problem, according to a first aspect of the present invention, there is provided a polynucleotide encoding an acyl-coa oxidase, the polynucleotide being codon optimized and the polynucleotide being selected from any one of the following:

(i) A polynucleotide having a sequence as shown in SEQ ID NO. 1;

(ii) A polynucleotide having a homology of greater than 95% with the sequence shown in SEQ ID NO. 1; and

(iii) A polynucleotide complementary to the polynucleotide sequence set forth in (i) or (ii).

In a second aspect of the invention there is provided an expression vector comprising a polynucleotide provided in the first aspect of the invention.

In some preferred embodiments, the expression vector is an E.coli expression vector, more preferably pET-28a (+).

In a third aspect of the invention there is provided a host cell comprising an expression vector provided in the second aspect of the invention; or alternatively

The host cell has integrated into its genome a polynucleotide as provided in the first aspect of the invention.

In some preferred embodiments, the host cell is E.coli (Escherichia coli).

In some preferred embodiments, the host cell is an E.coli BL21 (DE 3) strain.

In a fourth aspect, the present invention provides a method for preparing an acyl-coa oxidase, the method comprising the steps of: culturing the host cell of the third aspect of the invention to express the protein of interest; and

separating the target protein to obtain the acyl-CoA oxidase;

in some preferred embodiments, the host cell is obtained by transforming E.coli with a plasmid comprising a polynucleotide according to the first aspect of the invention.

In some preferred embodiments, the host cell is cultured using SB, TB, LB, SOC medium, more preferably using TB medium.

In some preferred embodiments, the host cell is cultured in a shaking environment.

In some preferred embodiments, the host cell is cultured at a temperature of 16 to 19 ℃ or 35 to 39 ℃, more preferably at a temperature of 16 to 19 ℃.

In some preferred embodiments, the medium used in culturing the host cell comprises a kanamycin resistance gene.

In some preferred embodiments, the host cell is cultured using IPTG to induce expression of the protein of interest.

In some preferred embodiments, the host cell is cultured until an OD600 of 0.6 to 0.8 is reached, and is then induced with IPTG to express the protein of interest.

In some preferred embodiments, the step of isolating the protein of interest comprises:

eluting the crushed target protein supernatant through a chromatographic column when the flow is the same as that of the target protein supernatant, and collecting the eluent.

In some preferred embodiments, the chromatography column is a Ni-column affinity chromatography column (Ni-NTA).

In a fifth aspect, the invention provides a kit comprising: a polynucleotide as provided in the first aspect of the invention; or alternatively

An expression vector as provided in the second aspect of the invention; or alternatively

A host cell according to the third aspect of the invention; or alternatively

Or an acyl-CoA oxidase prepared according to the method of the fourth aspect of the invention.

Compared with the prior art, the invention has at least the following advantages:

(1) The invention screens out bacterial sources capable of expressing high-enzyme activity soluble acyl-CoA oxidase from a large number of bacterial sources containing acyl-CoA oxidase by genetic engineering technology, and provides a corresponding method for industrially producing the acyl-CoA oxidase, and the method has simple purification steps, high activity of the produced enzyme, high protein expression and low production cost;

(2) In the preferred embodiment of the invention, optimized codons with high soluble expression are obtained through synonymous codon preference optimization screening, so that the yield and the production efficiency are further improved.

It is understood that within the scope of the present invention, the above-described technical features of the present invention and technical features specifically described below (e.g., in the examples) may be combined with each other to constitute new or preferred technical solutions. And are limited to a space, and are not described in detail herein.

Drawings

One or more embodiments are illustrated by way of example and not limitation in the figures of the accompanying drawings.

FIG. 1 is a diagram showing SDS-PAGE identification of expression products of an acyl-CoA oxidase derived from Bacillus bazaar in LB medium (recombinant plasmid contains optimized codon I) according to an embodiment of the present invention;

FIG. 2 is an SDS-PAGE identification of expression products of an acyl-CoA oxidase derived from Bacillus bazaar in TB medium (recombinant plasmid containing optimized codon I) according to an embodiment of the present invention;

FIG. 3 is a SDS-PAGE identification of an induction expression product of an acyl-CoA oxidase derived from a amoeba in TB and LB medium at 18℃according to an embodiment of the present invention;

FIG. 4 is a SDS-PAGE identification of pseudomonas derived acyl CoA oxidase induced at 18℃in TB and LB medium according to an embodiment of the invention;

FIG. 5 is a SDS-PAGE diagram of purified acyl-CoA oxidase derived from Bacillus bazaar (recombinant plasmid containing optimized codon I) according to an embodiment of the present invention;

FIG. 6 is a graph showing the standard activity of acyl-CoA oxidase in accordance with the examples of the present invention.

Detailed Description

The inventor of the present invention has developed a method for preparing acyl-CoA oxidase with high enzyme activity based on genetic engineering, which improves the expression level of soluble protein and is suitable for industrial mass production. The development of the method of the present invention for preparing acyl-CoA oxidase having high enzymatic activity based on genetic engineering is based on the following procedure: s1, screening strain sources by a genetic engineering technology, and discarding strain sources with expression products as inclusion bodies in escherichia coli; s2, collecting a crude product of the supernatant soluble protein for enzyme activity detection, further discarding strain sources with no enzyme activity of an expression product in the escherichia coli, and selecting strain sources with soluble expression and high enzyme activity in the escherichia coli; s3, optimizing synonymous codon preference of a gene sequence for encoding acyl-CoA oxidase in a finally selected strain source, selecting an optimized codon with high soluble protein yield from a plurality of optimized codons, developing a matched acyl-CoA oxidase expression method based on the optimized codon, and culturing to obtain a large amount of soluble acyl-CoA oxidase with high enzyme activity.

The invention relates to a method for preparing acyl-CoA oxidase suitable for industrial mass production, which comprises 1) obtaining target genes/obtaining target protein related nucleic acid sequences; 2) Optimizing the synonymous codon of the target gene to obtain an optimized codon; 3) Introducing the optimized codon into a vector; 4) A step of introducing a vector into a host cell; and 5) culturing the host cell and obtaining the protein of interest. Preferably also 6) a step of purifying the protein of interest.

Acquisition of a Gene of interest/acquisition of a nucleic acid sequence related to a protein of interest

The nucleic acid sequence related to the target gene or target protein in the invention obtains the nucleic acid sequence information by analyzing the amino acid sequences of the acyl-CoA oxidase contained in different bacterial sources. Homologous proteins of different biological origin have different amino acid sequences, and the recombinant expression products thereof often have unpredictable functional activities, based on the gene sequences obtained from the proteins of interest of different origin. In one embodiment of the invention, the NCBI database is used for analyzing the amino acid sequences of a plurality of target proteins from different sources to obtain the sequence information of the target genes from different sources. In some embodiments, the corresponding acyl-coa oxidase gene sequence information is obtained by analysis of the acyl-coa oxidases of the bacillus, amoeba and pseudomonas sources by the NCBI database.

After obtaining the information about the sequence of the protein of interest, the polynucleotide sequence may be prepared by methods well known to those skilled in the art. The full-length nucleotide sequence of the target protein or its element or a fragment thereof of the present invention can be usually obtained by PCR amplification, recombinant methods or artificial synthesis. For the PCR amplification method, primers can be designed based on the disclosed nucleotide sequences, particularly open reading frame sequences, and amplified to obtain the relevant sequences using a commercially available cDNA library or a cDNA library prepared according to a conventional method known to those skilled in the art as a template. When the sequence is longer, it is often necessary to perform two or more PCR amplifications, and then splice the amplified fragments together in the correct order.

Once the relevant sequences are obtained, recombinant methods can be used to obtain the relevant sequences in large quantities. This is usually done by cloning it into a vector, transferring it into a cell, and isolating the relevant sequence from the propagated host cell by conventional methods.

Furthermore, the sequences concerned, in particular fragments of short length, can also be synthesized by artificial synthesis. In general, fragments of very long sequences are obtained by first synthesizing a plurality of small fragments and then ligating them.

Methods of amplifying DNA/RNA using PCR techniques are preferred for obtaining the genes of the present invention. Primers for PCR can be appropriately selected according to the sequence information of the present invention disclosed herein, and can be synthesized by a conventional method. The amplified DNA/RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.

Synonymous codon bias optimization

The present invention relates to synonymous codon bias optimized polynucleotide sequences. And (3) carrying out synonymous codon preference optimization on the obtained target gene sequence, wherein the target gene sequence subjected to synonymous codon preference optimization can express the amino acid sequence identical to the target protein. In some embodiments of the invention, optimization of E.coli synonymous codon bias is performed by the gene sequence of the Bacillus bazaar source, resulting in several optimized codons, exemplified by optimized codon I shown in SEQ ID NO.1, optimized codon IV shown in SEQ ID NO.4-7, optimized codon V, optimized codon VI and optimized codon VII. In another embodiment, several optimized codons are obtained by optimization of E.coli synonymous codon preferences for the gene sequence of the amoeba source, exemplary optimized codon II as shown in SEQ ID NO. 2. In another embodiment, several optimized codons are obtained by optimization of E.coli synonymous codon preference for the gene sequence of Pseudomonas origin, exemplified by optimized codon III as shown in SEQ ID NO. 3.

Several optimized codons obtained by optimizing codon preference in the same kind of source target protein gene in different modes, and these optimized codons can express target protein with corresponding activity in host cell normally, but the expression amount is different. In some embodiments of the invention, the optimized codons obtained by optimization of the synonymous codon bias of E.coli by the acyl-CoA oxidase gene sequence of the Bacillus origin are expressed in large amounts by inclusion bodies, with partial soluble expression, such as, for example, optimized codon I and optimized codon V, optimized codon VI and optimized codon VII, and only optimized codon I. Under the same conditions, there are optimizing codons for soluble expression, and the expression amount of soluble protein is also obviously different, for example, optimizing codon I and optimizing codon IV, and the expression amount of soluble protein introduced into escherichia coli by optimizing codon I is obviously higher than that of optimizing codon IV.

The target protein genes from different sources have larger activity difference after being optimized by synonymous codon preference, and the expression products obtained by introducing the target protein genes into host cells. In one embodiment, the activity difference of the expression product in E.coli is remarkable between the optimized codon I of the Bacillus bazaar source and the optimized codon II of the amoeba source after optimization of synonymous codon preference of E.coli, and only the optimized codon I of the Bacillus bazaar source has enzyme activity.

The invention also relates to polynucleotides having a homology of more than 80%, preferably more than 85%, more preferably more than 90%, more preferably more than 91%, more preferably more than 95% to the sequences shown in SEQ ID NOS.1-7; and polynucleotides complementary to the sequences shown in SEQ ID NOS.1-7.

Vector of target gene

The invention also relates to vectors comprising the polynucleotides (optimized codons) of the invention. "vector" in the present invention means a linear or circular DNA molecule comprising a fragment encoding a protein of interest operably linked to other fragments providing for its transcription. Such additional fragments may include promoter and terminator sequences, and may optionally include one or more origins of replication, one or more selectable markers, an enhancer, a polyadenylation signal, a vector, and the like. The vector fragment may be derived from the host organism, another organism, plasmid or viral DNA, or may be synthetic. The vector may be any expression vector, synthetic or conveniently subjected to recombinant DNA procedures, the choice of vector generally being dependent on the host cell into which the vector is to be introduced. Thus, the vector may be an autonomously replicating vector, i.e. a vector, which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid. Alternatively, the vector may be one that, when introduced into the host cell, integrates into the host cell genome and replicates with the chromosome with which it is integrated. In one embodiment, the vector of the invention is an expression vector. In one embodiment of the invention pET-28a (+) is selected as a vector to obtain higher expression efficiency.

Methods well known to those skilled in the art can be used to construct expression vectors containing the coding DNA sequences of the proteins of the invention and appropriate transcriptional/translational control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence may be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Illustratively, the insertion of the exogenous DNA fragment is accomplished by cleaving the vector DNA molecule with a DNA endonuclease into a linear molecule that can be linked to the exogenous gene, and then ligating the codon optimized fragment of the gene of interest to the vector, optionally with a single restriction site cohesive end ligation, double restriction site directional cloning, cohesive end ligation of different restriction sites, blunt end ligation, artificial linker ligation, or end ligation with an oligonucleotide.

Transformation of host cells with vectors containing genes of interest

The invention also relates to host cells genetically engineered with the vector or fusion protein coding sequences of the invention. The vector containing the codon-optimized gene of interest may be inserted, transfected or otherwise transformed into a host cell by known methods to obtain a transformant containing the codon-optimized gene of interest of the present invention and capable of expressing the protein of interest. A "host cell" in the present invention is a cell into which an exogenous polynucleotide and/or vector has been introduced. The host cell may be a eukaryotic host cell or a prokaryotic host cell, the host cell is preferably a bacterium, and is preferably E.coli, more preferably E.coli ROSETTA (DE 3) strain (Escherichia coli Rosetta (DE 3) strain).

Method for producing target protein

The invention also relates to a method for preparing the target protein, and the polynucleotide sequence can be used for expressing or producing recombinant protein. Generally, there are the following steps:

(1) Transforming or transducing a suitable host cell with a polynucleotide (or variant) encoding a protein of the invention, or with a recombinant expression vector comprising the polynucleotide;

(2) A host cell cultured in a suitable medium;

(3) Separating and purifying the protein from the culture medium or the cells.

Wherein, the transformation or transduction of the recombinant expression vector containing the polynucleotide of the step (1) into a suitable host cell can be performed by conventional techniques well known to those skilled in the art, and when the host is E.coli, a heat shock method, an electrotransformation method, etc. can be selected.

The transformant obtained can be cultured by a conventional method to express the polypeptide encoded by the gene of the present invention. Depending on the host cell used, the medium used in the culture may be selected from a variety of conventional media, preferably SB, TB, LB or SOC media. The culture is carried out under conditions suitable for the growth of the host cell. After the host cells have grown to the appropriate cell density, the selected promoters are induced by suitable means (e.g., temperature switching or chemical induction) and the cells are cultured for an additional period of time. In order to promote the expression of the target protein and to increase the expression level of the soluble protein, a preferred embodiment of the present invention uses a host cell cultured in TB or LB medium, and the medium used contains a kanamycin resistance gene.

To further promote soluble expression of the protein of interest, in a preferred embodiment of the invention, the host cell is cultured to OD ₆₀₀ After 0.6-0.8 induction with IPTG and further incubation at 17 to 19 ℃ or 35 to 39 ℃ for about 8 to 12 hours.

The protein in the above method may be expressed in the cell, or on the cell membrane, or secreted outside the cell. If desired, the proteins can be isolated and purified by various separation methods using their physical, chemical and other properties. Thus, in the present invention, after the successful culture to obtain the target protein, it also involves a step of separating and purifying it, for example, in step (3), separating and purifying the protein from the culture medium to obtain the target protein in high purity. Although methods for purifying the protein of interest may be conventional means well known to those skilled in the art, including but not limited to: conventional renaturation treatment, treatment with a protein precipitant (salting-out method), centrifugation, osmotic sterilization, super-treatment, super-centrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques and combinations of these methods. In a preferred embodiment of the present invention there is provided a method for isolating a protein of interest, the steps comprising: eluting the crushed target protein supernatant through a chromatographic column when the flow is the same as that of the target protein supernatant, and collecting eluent; the mobile phase comprises BufferA, bufferB and/or BufferC; wherein, the BufferA comprises Tris (Tris, concentration 50 mM) and NaCl solution (concentration 50 mM); bufferB includes Tris (Tris, 50mM concentration), naCl solution (50 mM concentration) and Imidazole (500 mM concentration); bufferC includes Tris (Tris, 50mM concentration) and NaCl solution (1M concentration).

Preferably, in the eluting step, the eluting procedure includes a first stage and a second stage; in the first stage, the mobile phase used is BufferA; in the second stage, the mobile phase is a mixture of BufferA and BufferB, wherein the volume percentage of BufferA is gradually reduced from 100% to 40%, and the volume percentage of BufferB is gradually increased from 0% to 60%.

More preferably, the elution procedure further comprises a third stage in which the mobile phase used is BufferB.

Dialyzing the eluted and purified target protein product, and collecting a dialyzed sample. The dialysis samples were measured for concentration by BCA method and the yield was calculated.

In the present disclosure, any exemplary or exemplary language (e.g., ") provided for certain embodiments herein is used merely to better present the disclosure and does not limit the scope of the disclosure as otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

If the definition or use of a term in a reference is inconsistent or inconsistent with the definition of that term described herein, the definition of the term described herein applies and the definition of the term in the reference does not apply.

Various terms used herein are shown below. If a term used in a claim is not defined below, the broadest definition persons in the pertinent art have given that term are given as reflected in publications or issued patents that are printed at the time of application.

As used herein, the term "isolated" refers to a nucleic acid or polypeptide that is separated from at least one other component (e.g., a nucleic acid or polypeptide) that the nucleic acid or polypeptide is found in its natural source. In one embodiment, the nucleic acid or polypeptide is found to be present only (if any) in solvents, buffers, ions or other components that are normally present in its solution. The terms "isolated" and "purified" do not include nucleic acids or polypeptides that are present in their natural source.

As used herein, the terms "polynucleotide" and "polynucleotide sequence" may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. The DNA may be single-stranded or double-stranded. The DNA may be a coding strand or a non-coding strand.

The invention also relates to variants of the above polynucleotides which encode protein fragments, analogs and derivatives having the same amino acid sequence as the invention. Variants of the polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. Such nucleotide variants include substitution variants, deletion variants and insertion variants. As known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the encoded polypeptide.

As used herein, the term "codon optimization" refers to a manner of improving the efficiency of gene synthesis by avoiding the use of low-availability or rare codons according to codon usage differences exhibited by organisms (including e.coli, yeast, mammalian blood cells, plant cells, insect cells, etc.) that actually do protein expression or production.

As used herein, the terms "homology" and "identity" are used interchangeably to refer to the percentage of identical (i.e., identical) nucleotides or amino acids between two or more polynucleotides or polypeptides. Sequence identity between two or more polynucleotides or polypeptides can be measured by the following methods. The nucleotide or amino acid sequence of a polynucleotide or polypeptide is aligned, the number of positions in the aligned polynucleotide or polypeptide that contain the same nucleotide or amino acid residue is scored and compared to the number of positions in the aligned polynucleotide or polypeptide that contain a different nucleotide or amino acid residue. Polynucleotides may differ at one position, for example, according to the inclusion of different nucleotides (i.e., substitutions or variations) or deletions of nucleotides (i.e., insertions or deletions of one or two nucleotides in the polynucleotide). The polypeptides may differ at one position, for example, by containing an amino acid (i.e., substitution or variation) or a deletion of an amino acid (i.e., an amino acid or deletion of an amino acid inserted into one or both polypeptides). Sequence identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of amino acid residues in the polynucleotide or polypeptide. For example, percent identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of nucleotide or amino acid residues in the polynucleotide or polypeptide, and then multiplying by 100.

As used herein, the terms "sequence complementary" and "reverse sequence complementary" are used interchangeably to refer to a sequence that is opposite in direction to and complementary to the original polynucleotide sequence. For example, if the original polynucleotide sequence is actaac, then its reverse complement is GTTCAT.

As used herein, the term "expression" includes any step involving the production of a polypeptide in a host cell, including, but not limited to, transcription, translation, post-translational modification, and secretion. After expression, the host cells or expression products can be harvested, i.e.recovered.

The present invention will be further described with reference to specific embodiments in order to make the objects, technical solutions and advantages of the embodiments of the present invention more apparent. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental methods, in which specific conditions are not noted in the following examples, are generally conducted under conventional conditions or under conditions recommended by the manufacturer. Percentages and parts are weight percentages and parts unless otherwise indicated. The experimental materials and reagents used in the following examples were obtained from commercial sources unless otherwise specified.

Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs, it is to be noted that the terms used herein are used merely to describe specific embodiments and are not intended to limit the exemplary embodiments of this application.

Example 1

In this example, plasmids containing optimized codons encoding acyl-CoA oxidase derived from Bacillus bazaar, proteus and Pseudomonas were synthesized and introduced into E.coli for cultivation to obtain a monoclonal.

(1) Construction of acyl-CoA oxidase plasmid

The gene sequence of the acyl-CoA oxidase from Bacillus bazaar was obtained and optimized for the synonymous codon preference of E.coli to obtain optimized codon I (SEQ ID NO. 1), which was ligated into pET-28a (+) vector and delegated synthesis by Souzhou Jin Weizhi Biotech Co.

Obtaining the gene sequence of the acyl-CoA oxidase from the amoeba, and optimizing the synonymous codon preference of the escherichia coli to obtain an optimized codon II (SEQ ID NO. 2). Was ligated into pET-28a (+) vector and was delegated to Suzhou Jin Weizhi Biotechnology Co.

Obtaining the gene sequence of the acyl-CoA oxidase from pseudomonas, and optimizing the synonymous codon preference of the escherichia coli to obtain an optimized codon III (SEQ ID NO. 3). Was ligated into pET-28a (+) vector and was delegated to Suzhou Jin Weizhi Biotechnology Co.

(2) Recombinant plasmid introduction into host E.coli

Taking 1 mu L of the expression plasmid prepared in the step (1), adding the expression plasmid into 30 mu L of escherichia coli competent BL21 (DE 3) under ice bath condition, standing for 30min in ice bath, standing for 45s in water bath at 42 ℃, standing for 2min on ice immediately, adding 400 mu L of SOC culture medium without antibiotics, and culturing for 45min at 37 ℃ and 230rpm in an oscillating way. mu.L of the bacterial liquid was uniformly spread on LB plates containing 100. Mu.g/mL of kana resistance, and incubated overnight at 37 ℃.

(3) Expression of the Gene of interest

Selecting the monoclonal prepared in the step (2), inoculating the monoclonal in LB and TB media containing 100 mug/mL kana resistance in sterile operation, performing two repetitions, performing shaking culture at 37 ℃ and 220rpm until OD600 is between 0.6 and 0.8, performing induction by IPTG, and performing shaking culture at 37 ℃ and 18 ℃ respectively overnight. Sampling and ultrasonication for SDS-PAGE identification. The results of the identification are shown in FIGS. 1 to 4.

According to FIGS. 1 to 4, acyl-CoA oxidases derived from Bacillus bazaar and Pseudomonas are expressed as inclusion bodies in E.coli as well as in the supernatant.

(4) Purification of the protein of interest

About 4g of recombinant cells derived from Bacillus bazaar and Pseudomonas prepared in the step (3) were weighed, and 20mL of Lysis Buffer was added thereto to disperse them on ice using a disperser. Ultrasonic disruption of cells: the phi 10 probe has 10 percent of power, works for 5.5 seconds, stops for 9.9 seconds and is subjected to ultrasonic crushing for 30 minutes. Centrifugation was carried out at 20000rpm at 4℃for 30min, and the supernatant was collected and filtered through a 0.22 μm membrane. Purification with 1mL Ni-NTA, formulation of mobile phase fractions referring to Table 1, mobile phase flow rate of 0.5mL/min, UV and conductance to baseline were rinsed with 20mL Lysis Buffer for the run-on. The elution procedure included: step 1:0% B,10CV,1.5ml/min; step 2:0-60% B,20CV,1.5ml/min; step 3:100% B,15CV,1.5ml/min.

TABLE 1

The purified product was collected for subsequent enzyme activity testing. The results of electrophoresis of the partially purified product were shown in FIG. 5 (FIG. 5 shows the results of electrophoresis after collection of the enzyme acyl-CoA oxidase derived from Bacillus bazaar, from FIG. 5, it can be seen that the target protein was allowed to hang on the column, and elution was started at a concentration of 130mM imidazole based on the result of SDS, and the eluents B1 to B7 were selected for dialysis to obtain 13mL of the sample after dialysis, and the concentration was measured using BCA, and as a result, R2=0.996, the concentration was 1.917mg/mL, the yield was 24.921mg, and the yield was 6.23mg/g of bacteria).

SEQ ID NO.1

ATGACCGAAGTAGTTGACCGTGCTTCTTCTCCGGCTTCTCCTGGTTCCACTACCGCTGCGGCAGATGGTGCGAAAGTAGC

GGTTGAACCGCGTGTTGACGTTGCAGCTCTGGGTGAACAACTGCTGGGCCGTTGGGCGGATATCCGTCTGCACGCACGTG

ACCTGGCTGGTCGTGAGGTGGTTCAGAAAGTTGAGGGCCTGACTCACACTGAACACCGTTCTCGTGTTTTTGGTCAACTG

AAATACCTGGTTGACAACAACGCCGTACACCGTGCATTCCCATCTCGTCTGGGCGGTTCTGACGATCATGGTGGCAATAT

CGCAGGCTTCGAAGAACTGGTTACTGCTGATCCGAGCCTGCAGATCAAAGCGGGCGTACAGTGGGGTCTGTTTGGTAGCG

CGGTTATGCACCTGGGCACCCGTGAACATCACGATAAATGGCTGCCGGGTATCATGTCCCTGGAGATCCCGGGCTGCTTC

GCAATGACCGAGACTGGTCACGGCTCCGACGTCGCTTCTATTGCAACCACCGCAACCTACGATGAAGAAACTCAGGAATT

TGTGATCGACACCCCATTCCGTGCAGCATGGAAAGACTACATCGGCAACGCAGCAAACGATGGTCTGGCGGCGGTTGTTT

TCGCCCAGCTGATCACGCGTAAAGTAAACCATGGTGTGCATGCTTTCTACGTTGATCTGCGTGACCCGGCGACTGGTGAC

TTTCTGCCGGGTATTGGTGGTGAGGACGACGGTATCAAAGGTGGCCTGAACGGTATTGACAATGGCCGTCTGCATTTCAC

CAACGTTCGTATTCCGCGTACCAATCTGCTGAACCGTTACGGCGACGTAGCTGTTGACGGTACCTACAGCAGCACTATCG

AATCCCCGGGTCGTCGCTTTTTCACCATGCTGGGCACTCTGGTTCAAGGTCGCGTAAGCCTGGATGGCGCAGCCGTTGCA

GCATCTAAAGTGGCTCTGCAGAGCGCTATTCATTATGCAGCGGAACGTCGCCAGTTCAACGCTACTAGCCCTACCGAAGA

AGAAGTCCTGCTGGACTACCAGCGTCATCAGCGCCGTCTGTTCACGCGTCTGGCAACCACCTACGCTGCATCCTTCGCTC

ACGAGCAGCTGCTGCAGAAATTCGATGATGTTTTCAGCGGCGCACACGATACCGATGCAGATCGTCAGGATCTGGAAACC

CTGGCGGCTGCGCTGAAACCGCTGTCTACTTGGCACGCACTGGATACGCTGCAGGAATGCCGTGAAGCTTGTGGTGGCGC

GGGTTTCCTGATTGAAAACCGTTTCGCTTCCCTGCGCGCTGACCTGGATGTGTACGTCACCTTTGAAGGTGATAACACCG

TTCTGCTGCAGCTGGTTGCGAAACGTCTGCTGGCTGACTACGCTAAAGAATTCCGTGGCGCTAACTTTGGTGTTCTGGCG

CGCTATGTGGTTGATCAAGCTGCGGGTGTAGCACTGCACCGTACTGGTCTGCGTCAGGTGGCTCAGTTCGTCGCTGATTC

TGGTTCTGTTCAGAAAAGCGCTCTGGCACTGCGCGACGAAGAGGGTCAGCGTACTCTGCTGACCGACCGTGTGCAATCTA

TGGTGGCTGAAGTTGGTGCTGCGCTGAAAGGTGCTGGTAAACTGCCGCAGCATCAGGCAGCAGCGCTGTTTAACCAGCAC

CAGAACGAACTGATCGAAGCGGCTCAAGCGCATGCTGAACTGCTGCAATGGGAAGCGTTCACCGAAGCACTGGCGAAAGT

AGATGACGCGGGCACGAAAGAAGTTCTGACCCGCCTGCGCGACCTGTTTGGTCTGTCCCTGATTGAAAAGCATCTGAGCT

GGTATCTGATGAATGGTCGTCTGTCCATGCAACGTGGTCGTACCGTTGGCACGTATATCAACCGTCTGCTGGTTAAAATC

CGTCCGCACGCGCTGGATCTGGTAGATGCATTCGGCTACGGTGCTGAACATCTGCGTGCTGCTATCGCAACTGGTGCCGA

AGCAACCCGTCAGGACGAAGCGCGTACTTACTTCCGTCAGCAACGCGCGTCTGGTTCTGCACCGGCTGATGAAAAAACTC

TGCTGGCGATCAAAGCAGGCAAATCTCGC

SEQ ID NO.2

ATGAACCCGGACCTGAAACGCGAACGTAAAGGCGCATCCTTTGATGCAACCGCAACTCGTGAACGTTTTCAGAAACTGGT

AGCGGATGAACCGGTGTTTGCGAATGATGACAAATACTTCCTGTCTCGTGTGCAGAACTATGAACGTGTTCTGCAGAAGG

TTGTGCGCGGCATCCAAATGTGCATCGAACATAACATCACTCCGGAAGATGCGGAATACCTGTTCCACTTCATCGGTGAA

GAGTTCATGGTTGCGCTGCACTGGTCCATGTTCATCCCGACCCTGCAGGGTCAGGCTACCAACGACCAGAAACTGCAGTG

GCTGCCGCTGGCGCAGACCTTCCAGATCATTGGCTGTTATGCCCAGACGGAGATGGGTCATGGCTCCAACGTGCGTGGTC

TGGAAACGACCGCGACCTACGACAAAGCGACGCAGGAATTCGTTCTGCATTCCCCTACCCTGACTTCCACCAAATGGTGG

CCGGGCGGCCTGGGCAAAACGTCCACTCACTGCGTCACTCACGCACGTCTGCTGGTGGAAGGCAAGGACCATGGTGTGGC

CACCTTCATCGTTCAGATTCGCTCTACCGATGACCATGCGCCGATGCCGGGCGTAACTGTCGGCGATATCGGTCCTAAAT

TTGGCTACGACACCCAGGATAACGGTTTCCTGCGTTTTGACCACGTTCGTATCCCACGTGATCAAATGCTGATGAAATAC

AAGCAGGTCTCCCCGGAAGGTGTTGTGACCGAAGCACCGAAAAAGCTGTCTAAACTGAGCTATGGCACCATGATGTACAT

TCGCTCCCGCATCGTTGGTGGTGCATCCTCTACGCTGGCACGTGCGTGCACCATTGCAGTACGTTATTCCGCTGTACGTC

GTCAGTTCAGCGACGCAGACAACGAACCGGAAAAACAGGTACTGGACTACCGTATGCAGCAGTATCGTCTGCTGCCGCTG

CTGGCCACTGCATACGCATTCCATTTCACCGGTCGTTACATGCGTAACATCTACGATGAGCTGATGCGTAACATCCAGTC

CGACGACGTGTCTGCGCTGCCGGAAGTTCACGCGACCTCTGCGGGCCTGAAAGCGGTTACCACTTGGATGACCGCGGATG

GTATTGAGGAATGCCGTAAATGCTGCGGTGGCCACGGCTACAGCAAGTTTGCGGGTATTTCTGACATTTACGTAAACTAT

GTACCAGCCTGCACTTATGAAGGCGATAACGTTGTCATGTGCCTGCAGACCGCGCGTTACCTGGTTAAGACCGCACGTGG

CGCTGCAAAGGGTGAACCTCTGGTGGGCAGCGTGCAGTGTCCGGCGCAGAAAGTTGCGGATTTCCTGTGCCCGCGTACCT

GGGTTGATGCTTTTGCGCTGCGTGCACGCTTCTGCGTTTTCGAGACCGTTAAAAAACTGGACGCTCTGAAGGGTCGTGGT

CTGAACGATAAACAGGTTTGGAACGAAGCTCAGATCGATCTGGTAAAGATGACCAAAGCGCATTGTTATTACACCATCGT

GCGTAATTTCGCAAACGCGGTAGAAAAGGTTGAGGATAAACAGCTGCAGGCCGTTCTGCACAAACTGTGCATGCTGTTCG

CGCTGTACCAGGTGCAGCGTGACCTGGGCGATTTTACTTGTTCTGGTTACCTGGCTCAGGAACAGGTCCCGCTGCTGAAC

GAAGCTGTGGAAGTGCTGCTGAGCGAACTGCGTAAAGACGCTGTACCGCTGGTAGACTCTTTCGACTTCTCTGATCACTT

TCTGAACAGCAGCCTGGGTCGTTACAACGGTGACGTCTATGAGCACATGTATAAATGGGCGCAGAAGGAACCACTGAACC

AGGCGCCGTACGCTACCCAGCCTCCAGGCTATGAAAAATACCTGAAACGCCTGCTGAACGGCGAGGTACTGCAGGAAGCC

ATCCAGAACAAAATGACTAAAGCTAACCTG

SEQ ID NO.3

ATGACTGACAGCTCTATTCCTGGCGCTGATGCACTGAAGGCACGTGATGAACTGCGCGATGTTCTGTTTGGCGGTACCTT

CGAATCTCACCATCAGTCCATTCGCAAAGTGCTGCTGGACCCGATCTTCGATCCGCAGAGCGGTCTGAACATGGAACAAG

CTGGTCGTCTGGCTTACGCTCGTAGCCGTCATGTGCACGGTGCGCTGGAACGTCCGCTGGAAATTCTGGCGAACCCGCGT

CGTCTGTTCGCTCTGGCAGAATGGCCGTCTCTGCTGGATGTTGCATCTTTTAGCCTGCTGATGGTGCACTACAACCTGTG

CCTGGGTACCGTGTTCGACCATGCGCGCGACCGTTCCGATATCGCTGATCTGACCGAAGCCCTGGACGGCCTGACCTCTT

TCGGTCCTTACATGGCTACCGAACTGGGTTTCGGTAACAATGTCGCTGCTCTGCAAACTGAAGCAGTGTACGATCGTCAG

AGCCAGACCTTCACCCTGAACACCCCATCTGTTTCTGCGCAGAAATACATGAGCTACAGCGGCTTCGGCGACATCCCGAA

AGTGGCAACCGTTATGGCGCGTCTGAAAATCGAAGGTAAAGATTATGGCGTCTTCCCGTTCCTGGTTCGCCTGTCTACTG

AGGCTGGTCTGTGCCCAGGTATCCGTGCTGCACTGTGTCCGGAAAAACCGGTTCAGGGCCTGGATAACGGTCTGACCTGG

TTTGACAACGTGCGCGTACCGCGTTCTAGCCTGCTGCATGGTGATATGGGTCACTTCGCCGAAGATGGTCACTTCGTAGT

TGGTGCAGGCAACGCTCGTTCTCGTTTCCTGCGCGCAATGAGCCGCATTGTTCCAGGTCGTCTGTGCGTTGCATCTGCAG

CGCAGGGCGCATCTCGTGCATCTCTGTACATCGCGCTGCGTTATGGTCAACAGCGTCTGACTAACGCTCCGGGTACTAAC

GATATGCCGGTTATTGAATATCGTTCTTACCAGGTCCCACTGTTCTCTGCACTGGCGTCTACCTACGCCATGACCCTGCT

GCTGAACGAAGCTAAGGCGCGTTTCCTGGCAAACACCACTGAACCGGCTGTTGACGTTGTGTCTCTGATCAACATCACCA

AAGCTCTGGCGACTTGGGACGCGTCTGCAGTCATCGCAGAGTGTCGCGAACGTTGTGGTGCACAGGGCATCTTCTCTGCC

AACCGTATCGCTGACTACGGTTCTCTGCTGCAGGGCCTGGTCACCGCAGAAGGTGATAACCTGGTCCTGCTGGCTACCGT

TGCAGGCCAGCTGCTGGCTCAGGTATGGCAGGGTCCAGAACCTCTGCGTCCGGTTCGTGCTCGTCGTCTGGCTGAACCTG

AGTGGCTGATCGCCGCTATTGCGTTCCGCGAACATCAACTGTGGCTGACCATCCGCGAAGAAATGAACACTGATGAGCGT

GGCTATTTCGAAGTGTGGAACGACGCAATGAACCCTGGCCTGGAACTGGCTCGTCTGCGTGGTGAACGTCTGGCACTGGA

ACAGCTGTGGTCTGCCTCTCTGCACGCACAGCAAGACGAGGCTAAAGCGGCGCTGAACTGTCTGGCAAGCCTGTACGGTC

TGAACCTGCTGCGTCGTGACGCGGCTTGGTACCTGGCACACGAACTGATTGATGCTGGTCAAGCACTGTCTCTGCCGGGC

CGTATCGATCAACAGTGCGTTGCACTGCGTCCGCATGTTTCCATGCTGATTGACGGTTTTGGTCTGAGCCCTGAACTGCT

GCGTGCTCCGATCGCTCAGGACGATTACATCCAGGCCTTCTGCAAACAGGTTAATGCGAACGTAGAC

Example 2

In this example, purified acyl-CoA oxidases derived from Bacillus bazaar and Pseudomonas were taken for subsequent enzyme activity detection experiments. The method comprises the following specific steps:

(1) Solution preparation

1M Tris-HCl pH 8.0: tris powder 121.14g was weighed out, poured into a 1L beaker and sterilized purified water was added to 800ml. After stirring uniformly, the pH was adjusted to 8.0 with concentrated hydrochloric acid at 25℃and then the volume was set to 1L. Filtering with 0.22um, and storing at 4deg.C;

5mM palmitoyl CoA: 10mg of palmitoyl CoA powder was weighed out and dissolved in 1.99mL of deionized water.

5mM FAD: 0.0041g FAD powder was weighed into 1mL deionized water and stored in the dark. .

0.1% 4-aminoantipyrine: 0.05g of 4-aminoantipyrine powder was weighed and dissolved in 50mL of deionized water and stored in the dark.

0.1% phenol: 0.05g of phenol powder was weighed and dissolved in 50mL of deionized water and stored in a dark place.

5mL working fluid formulation is referenced in Table 2.

TABLE 2

Reagent(s)	Volume added	Final concentration
			1M Tris-HCl	0.1mL	20mM
0.1％4-AA	1.56mL	1.5mM
			0.1% phenol	1mL	2.1mM
Peroxidase (5U/. Mu.L)	5μL	25U
			FAD(5mM)	10μL	10μM
Palmitoyl CoA (5 mM)	500μL	0.5mM
			ddH2O	1795μL

Positive enzyme preparation: 200U of positive enzyme (commercial acyl-CoA oxidase control) was dissolved in 0.2mL of PBS pH 7.4 buffer to prepare 1U/. Mu.L of enzyme solution, which was gradually diluted again according to the gradient, and the diluted solution was PBS pH 7.4 buffer.

(2) Instrument detection

The enzyme label instrument is preheated for 30min, 100 mu L of reaction liquid is added, the absorbance at 500nm is detected, 1 mu L of enzyme diluent is added in a blank group, the absorbance A1 is detected at 500nm, 1 mu L of enzyme liquid with each concentration is added in an experimental group, the mixture is uniformly mixed for 5s by shaking, the reaction is carried out for 5min, the absorbance A2 is detected at 500nm, and a standard curve is drawn as shown in figure 6. The OD difference A2-A1 of the sample and the blank was calculated and the sample concentration was determined from the difference. The results are shown in Table 3.

TABLE 3 Table 3

Purified recombinant acyl-coa oxidation zymogen solution of bacillus bazaar has a concentration of 1.917mg/mL and an average viability of 0.2611U/μl, then the specific viability is (0.4628 x 1000)/1.917 =241.4U/mg. The recombinant acyl-CoA oxidase from Pseudomonas is detected, and no enzyme activity is generated.

Example 3

In the embodiment, the purified product of the acyl-coa oxidase with good enzymatic activity is selected, and the coding genes of the acyl-coa oxidase are subjected to optimization of synonymous codons of escherichia coli in different modes, and the optimized codons with higher soluble expression quantity are obtained by screening.

The acyl-CoA oxidase gene sequence of Bacillus bazaar source was selected, optimized for synonymous codon preference unlike in example 1 to obtain a large number of optimized codons, exemplified by the optimized codons shown in SEQ ID Nos. 4 to 7, and recombinant plasmids were synthesized and cultured in E.coli in the same manner as in example 1, and the soluble expression level was measured, and the results are shown in Table 4.

TABLE 4 Table 4

Optimizing codons	Whether or not there is soluble expression	Purification yield
			Optimized codon I	Soluble expression	6.23mg/g
Optimization of codon IV	Inclusion body expression	/
			Optimization of codon V	Soluble expression	4.58mg/g
Optimization of codon VI	Inclusion body expression	/
			Optimized codon VII	Inclusion body expression	/

SEQ ID NO.4：

ATGACTGAAGTAGTGGATAGAGCTAGTTCCCCAGCATCCCCTGGATCAACTACCGCTGCTGCTGATGGTGCCAAAGTTGCAGTTGAACCAAGAGTTGACGTCGCTGCTCTGGGAGAACAGTTACTAGGAAGATGGGCTGATATAAGGTTGCATGCTAGAGATCTGGCTGGTAGAGAGGTCGTTCAAAAGGTCGAGGGTCTTACTCATACCGAACACAGATCCAGAGTCTTTGGACAACTTAAATACTTGGTCGACAATAACGCCGTTCATAGAGCTTTTCCTAGTAGGTTAGGAGGATCTGATGACCACGGTGGAAACATTGCTGGCTTTGAAGAATTGGTAACAGCTGATCCTTCCCTTCAGATTAAGGCTGGCGTCCAATGGGGCCTTTTTGGATCCGCTGTTATGCACCTTGGTACACGTGAGCACCATGATAAGTGGCTGCCAGGAATTATGAGTCTGGAGATCCCCGGTTGTTTTGCTATGACAGAAACAGGACATGGTTCCGACGTTGCTAGTATTGCAACAACCGCTACTTACGATGAAGAAACTCAGGAGTTCGTCATTGACACTCCATTCCGTGCTGCATGGAAGGACTATATTGGAAACGCTGCTAATGACGGACTTGCTGCAGTGGTATTTGCCCAACTAATAACACGAAAAGTTAACCATGGCGTTCATGCCTTCTATGTCGATTTGAGAGACCCCGCCACAGGTGACTTTTTGCCAGGTATAGGAGGTGAGGATGATGGTATAAAGGGAGGTTTGAACGGTATAGATAATGGAAGGTTGCACTTCAC

CAACGTAAGAATTCCACGTACAAACCTGCTGAACAGATATGGCGATGTGGCTGTCGACGGTACATACAGTTCAACTATTG

AAAGTCCTGGTCGAAGATTCTTTACTATGCTGGGAACCTTAGTTCAGGGACGTGTTAGTTTGGATGGTGCCGCTGTTGCT

GCTAGTAAGGTTGCTTTACAGTCTGCTATCCACTATGCCGCTGAAAGACGTCAGTTCAACGCCACTTCTCCTACCGAAGA

AGAGGTTTTGTTAGACTACCAAAGGCACCAGAGAAGACTATTCACAAGATTGGCAACAACGTACGCTGCTTCTTTCGCTC

ATGAACAACTTTTGCAGAAGTTTGATGATGTTTTTTCTGGAGCACACGACACTGACGCAGACAGACAGGATCTAGAGACC

CTTGCTGCTGCTCTGAAACCACTATCCACTTGGCACGCACTTGACACCTTGCAAGAATGTAGAGAAGCTTGTGGTGGTGC

TGGTTTCTTGATTGAAAATAGATTTGCTTCCTTAAGAGCAGATTTAGATGTCTATGTCACTTTTGAAGGAGACAATACCG

TTCTGCTTCAACTTGTCGCTAAGCGATTGTTAGCCGATTATGCTAAGGAGTTCAGAGGAGCTAATTTTGGCGTACTGGCA

CGATACGTTGTTGATCAGGCTGCTGGAGTTGCTCTTCATAGGACTGGCCTAAGACAGGTTGCTCAATTCGTAGCCGATTC

CGGAAGTGTGCAAAAGTCTGCCTTGGCACTACGTGATGAAGAAGGTCAAAGAACATTGTTGACCGACCGAGTTCAATCCA

TGGTCGCTGAGGTGGGAGCCGCTTTGAAGGGAGCTGGAAAGCTACCCCAACATCAAGCAGCTGCCCTATTCAACCAACAT

CAAAACGAACTTATTGAAGCAGCACAGGCTCATGCAGAATTATTGCAGTGGGAGGCTTTCACAGAAGCTTTGGCTAAGGT

TGACGATGCCGGAACTAAGGAAGTGTTGACTAGACTGAGAGACTTGTTTGGTCTATCTCTGATTGAAAAGCACCTATCCT

GGTACTTAATGAACGGTCGACTGTCTATGCAGAGAGGAAGAACTGTCGGAACTTATATTAATAGACTTCTAGTGAAGATC

AGGCCACACGCCCTTGATTTGGTGGATGCTTTCGGATACGGTGCCGAACATCTTAGGGCTGCTATTGCAACTGGTGCTGA

GGCTACAAGACAGGACGAAGCCCGTACTTACTTTAGACAACAGCGAGCTTCCGGATCCGCACCAGCAGATGAAAAAACAT

TATTAGCTATCAAAGCTGGTAAATCTAGG

SEQ ID NO.5：

ATGACGGAAGTAGTAGACCGAGCATCATCTCCAGCTTCACCAGGATCCACAACAGCTGCTGCAGATGGCGCAAAGGTTGC

GGTGGAACCTAGAGTTGATGTCGCGGCTCTTGGAGAACAGCTTCTCGGCAGATGGGCAGATATTCGTCTGCATGCAAGAG

ACCTTGCGGGGCGCGAAGTCGTTCAGAAAGTGGAAGGACTGACACATACCGAACATCGCTCTCGTGTCTTTGGACAGCTG

AAATACCTGGTCGATAACAATGCTGTGCATCGTGCTTTTCCGAGCAGATTGGGCGGATCTGATGACCACGGGGGAAACAT

CGCCGGCTTCGAAGAACTGGTGACGGCAGATCCTTCACTTCAGATTAAAGCGGGAGTGCAGTGGGGCCTTTTCGGATCAG

CTGTGATGCATCTGGGTACCAGAGAACATCATGACAAATGGCTTCCGGGAATCATGTCACTTGAAATTCCTGGATGTTTC

GCTATGACGGAGACCGGTCACGGGTCTGACGTTGCCTCAATTGCCACAACAGCGACATACGATGAGGAAACACAAGAATT

TGTCATAGACACACCTTTTCGAGCTGCTTGGAAAGATTATATAGGAAACGCTGCGAACGATGGCCTTGCAGCGGTAGTTT

TTGCGCAACTTATAACAAGAAAAGTTAACCATGGGGTCCACGCCTTCTACGTTGACCTTAGAGATCCTGCCACAGGTGAT

TTCTTACCAGGTATCGGGGGCGAAGATGATGGTATTAAAGGAGGTTTAAACGGGATCGATAATGGTCGTTTACATTTTAC

TAACGTTCGCATTCCGCGCACTAACTTGTTAAACCGCTATGGCGACGTGGCAGTCGATGGAACATATTCCTCTACGATTG

AAAGCCCGGGACGTCGGTTTTTCACAATGTTAGGCACACTTGTACAAGGTAGAGTCTCGTTAGATGGCGCGGCAGTAGCA

GCAAGCAAAGTTGCTCTGCAGTCTGCCATTCATTATGCTGCGGAACGACGGCAGTTTAATGCGACCAGCCCGACAGAAGA

AGAGGTCCTTCTCGATTACCAGAGACATCAGAGAAGACTTTTCACTCGTCTTGCAACGACTTATGCGGCTTCCTTTGCTC

ATGAACAGCTTTTGCAAAAATTCGACGATGTCTTTTCTGGCGCGCATGATACTGACGCTGACCGTCAGGATCTGGAGACA

TTGGCCGCCGCCCTTAAACCGTTATCCACCTGGCATGCTTTAGACACGCTTCAAGAATGCCGAGAAGCGTGCGGCGGAGC

AGGTTTTTTGATTGAGAATAGATTTGCGTCCTTGCGCGCGGACTTAGATGTTTATGTTACATTTGAGGGCGACAACACAG

TACTGTTACAATTAGTTGCTAAACGCCTGCTTGCCGATTATGCGAAGGAATTCCGAGGCGCTAATTTTGGCGTGCTGGCA

CGCTATGTTGTTGATCAAGCTGCGGGTGTTGCATTGCATCGGACAGGGCTCAGACAGGTTGCTCAATTTGTTGCCGACTC

AGGCTCCGTGCAAAAGTCCGCATTGGCACTGCGGGATGAAGAAGGACAGCGAACGCTGCTGACAGACCGGGTACAGTCTA

TGGTAGCAGAAGTCGGCGCTGCGCTTAAAGGTGCAGGAAAACTTCCGCAGCACCAGGCCGCTGCTCTCTTCAACCAGCAT

CAGAATGAACTGATCGAAGCTGCCCAAGCGCACGCCGAACTGTTACAATGGGAAGCATTCACAGAAGCGCTTGCTAAGGT

AGATGATGCGGGTACCAAAGAAGTGTTAACCCGTCTGAGAGACCTGTTTGGGCTGTCACTGATAGAGAAACATTTATCAT

GGTATCTCATGAACGGACGGCTCAGCATGCAGCGTGGACGTACTGTTGGGACCTACATTAATAGACTTCTGGTAAAAATC

CGCCCTCATGCTCTTGATCTCGTAGATGCTTTTGGCTACGGCGCAGAACATCTTAGAGCTGCAATTGCGACAGGAGCGGA

AGCTACTCGCCAAGACGAAGCACGGACATATTTTCGGCAGCAGCGAGCAAGTGGTTCAGCCCCAGCAGACGAAAAAACAT

TGCTTGCGATTAAAGCCGGCAAGTCAAGA

SEQ ID NO.6：

ATGACTGAAGTCGTTGATAGAGCATCCTCACCCGCATCTCCAGGTTCAACGACAGCCGCTGCTGATGGTGCTAAGGTTGC

TGTGGAACCAAGAGTTGATGTCGCGGCACTGGGTGAACAATTATTAGGTCGTTGGGCTGATATCCGTCTTCATGCTAGGG

ATTTGGCTGGTAGAGAGGTAGTTCAAAAGGTGGAGGGGTTGACCCACACAGAACATAGATCTAGGGTTTTTGGTCAGTTG

AAATACTTGGTGGATAATAATGCTGTACATAGGGCTTTTCCATCCAGGTTGGGTGGATCAGACGACCATGGTGGTAACAT

CGCAGGTTTTGAAGAACTAGTAACCGCTGATCCATCTCTTCAAATCAAAGCTGGAGTCCAATGGGGCCTGTTCGGGAGTG

CTGTTATGCATCTAGGTACAAGAGAGCATCATGATAAGTGGTTGCCTGGAATAATGAGTTTGGAAATTCCCGGTTGTTTT

GCTATGACCGAGACGGGTCACGGCTCTGATGTCGCCTCCATCGCTACAACTGCAACCTACGATGAAGAAACCCAAGAATT

TGTTATAGATACCCCTTTTAGAGCTGCATGGAAAGATTATATCGGTAATGCTGCAAACGATGGTCTTGCTGCTGTGGTTT

TCGCGCAATTGATTACTCGTAAAGTTAATCATGGTGTTCACGCTTTCTACGTAGATTTGCGTGACCCAGCTACTGGGGAT

TTCTTGCCAGGTATCGGTGGTGAAGACGATGGTATTAAAGGTGGTTTGAATGGGATTGATAATGGCAGATTACATTTTAC

AAACGTGAGAATCCCTAGAACAAACCTTCTAAACAGATATGGAGATGTAGCAGTTGATGGTACCTACAGTTCAACAATAG

AATCACCTGGTAGAAGATTCTTCACCATGTTGGGTACTCTGGTTCAAGGAAGAGTGAGTTTGGATGGGGCAGCAGTTGCT

GCTTCAAAAGTGGCTTTGCAAAGCGCCATTCATTATGCAGCAGAACGTAGACAATTTAATGCCACTTCTCCGACTGAGGA

AGAGGTATTATTGGATTACCAAAGGCATCAGAGGAGGTTATTTACGAGATTAGCAACTACTTACGCTGCATCTTTTGCAC

ACGAACAATTGCTGCAAAAATTTGACGACGTTTTTTCAGGTGCACATGATACAGATGCCGATAGGCAAGATTTGGAGACT

CTTGCCGCCGCACTTAAACCACTTAGTACTTGGCATGCTCTAGACACTCTTCAAGAGTGCAGAGAGGCATGCGGTGGAGC

GGGATTTCTGATAGAAAATAGATTTGCAAGCTTAAGAGCCGATTTGGATGTCTACGTTACCTTTGAAGGTGACAATACTG

TTCTTTTGCAATTGGTTGCTAAGAGGTTGTTGGCCGATTACGCAAAGGAATTCAGAGGAGCTAATTTTGGTGTTTTGGCC

AGATACGTAGTCGATCAAGCTGCCGGGGTTGCACTGCATAGAACAGGTCTTAGACAAGTGGCACAGTTCGTCGCGGATTC

AGGTAGCGTACAAAAGTCAGCCCTAGCCCTTAGGGATGAAGAAGGCCAGAGAACCTTGCTAACTGATAGAGTACAATCTA

TGGTAGCTGAAGTTGGAGCAGCTTTGAAGGGTGCCGGGAAATTACCACAGCATCAAGCCGCAGCGTTGTTTAACCAGCAT

CAAAATGAATTAATCGAAGCTGCTCAAGCTCACGCAGAATTGTTGCAATGGGAAGCTTTTACTGAAGCTCTAGCTAAGGT

CGATGATGCGGGCACGAAAGAGGTTTTGACTAGATTACGTGATCTGTTCGGATTGTCTTTGATTGAAAAACATTTATCTT

GGTATTTAATGAATGGTCGTTTAAGTATGCAGAGGGGAAGAACAGTTGGTACATATATTAACCGTTTGCTTGTAAAGATA

AGGCCTCATGCGTTGGATCTTGTTGACGCCTTTGGATATGGGGCAGAACATTTAAGGGCTGCTATCGCAACCGGTGCTGA

GGCAACTAGACAAGATGAAGCAAGAACATATTTCAGACAGCAAAGAGCAAGTGGAAGCGCCCCAGCTGACGAAAAGACCT

TGTTGGCTATCAAAGCGGGAAAGTCCAGA

SEQ ID NO.7：

ATGACTGAGGTAGTGGACAGGGCTTCTAGTCCTGCATCTCCTGGATCTACAACTGCAGCTGCCGACGGTGCAAAGGTGGC

AGTTGAGCCTAGAGTGGACGTTGCTGCCCTCGGAGAACAACTGCTGGGTCGGTGGGCCGATATTAGGTTGCATGCCAGAG

ATCTGGCCGGTAGGGAAGTCGTTCAGAAGGTCGAAGGACTGACCCACACCGAACATAGGAGCAGAGTTTTCGGCCAGCTT

AAATACCTGGTTGATAATAATGCAGTCCACAGAGCCTTTCCCAGCCGACTTGGAGGAAGCGACGACCACGGAGGCAATAT

CGCAGGCTTTGAAGAGCTGGTTACCGCCGATCCCTCCCTTCAAATTAAAGCCGGGGTGCAGTGGGGTCTGTTTGGTAGTG

CAGTAATGCACCTGGGCACAAGGGAACACCACGACAAGTGGCTCCCAGGGATCATGAGCCTGGAAATCCCGGGGTGTTTT

GCCATGACCGAAACCGGACATGGCTCTGACGTGGCGTCTATTGCTACAACGGCAACTTACGACGAGGAAACCCAAGAGTT

TGTTATAGATACCCCCTTCAGAGCCGCCTGGAAGGACTATATCGGTAATGCAGCAAACGATGGTCTCGCCGCCGTTGTGT

TTGCCCAGCTGATTACAAGAAAGGTGAACCACGGGGTTCACGCATTTTACGTGGATCTCAGAGACCCTGCAACCGGTGAT

TTCTTGCCTGGCATCGGAGGGGAAGATGACGGGATCAAGGGTGGCCTGAATGGGATTGACAACGGTAGGCTGCATTTCAC

AAACGTGAGGATCCCCAGGACCAACCTGCTCAATAGATACGGTGATGTGGCCGTAGATGGTACATACTCCAGCACCATCG

AGTCCCCCGGACGAAGGTTTTTTACCATGTTGGGTACGCTCGTCCAGGGCCGGGTGTCTCTTGATGGAGCAGCGGTGGCA

GCTTCAAAGGTGGCCCTCCAGTCTGCCATTCACTACGCTGCTGAGCGAAGGCAGTTCAACGCCACCTCTCCAACCGAGGA

GGAGGTGCTGTTGGATTACCAAAGGCACCAAAGACGCCTTTTCACCCGGCTCGCAACCACATACGCAGCAAGCTTCGCGC

ACGAGCAGCTGCTCCAGAAGTTCGATGACGTTTTCTCTGGAGCCCATGATACCGATGCCGATAGGCAAGACCTGGAGACC

TTGGCAGCAGCACTGAAACCTCTCTCAACCTGGCACGCTTTGGACACTTTGCAGGAATGCAGGGAGGCATGCGGAGGTGC

TGGCTTCCTGATCGAGAACCGCTTTGCTTCACTTCGCGCCGATCTTGACGTATATGTCACTTTCGAAGGGGACAATACCG

TGCTTCTCCAGCTTGTCGCAAAAAGACTGCTGGCAGACTACGCCAAGGAATTCAGAGGAGCAAATTTTGGAGTATTGGCC

AGATACGTCGTGGATCAGGCAGCGGGAGTTGCACTGCACAGGACTGGCTTGCGCCAGGTTGCTCAGTTTGTGGCCGACAG

TGGAAGCGTACAGAAGAGTGCATTGGCTCTGCGGGATGAGGAAGGGCAGAGAACGCTGCTGACCGATCGGGTGCAGTCAA

TGGTGGCAGAGGTGGGCGCAGCTCTGAAAGGAGCAGGGAAACTGCCTCAGCATCAGGCTGCTGCTCTGTTCAACCAGCAC

CAGAACGAGCTGATCGAGGCCGCACAAGCCCATGCAGAGTTGCTGCAGTGGGAGGCGTTTACAGAGGCCCTGGCTAAAGT

TGATGATGCTGGCACTAAAGAGGTCCTCACTAGGTTGCGGGATCTCTTCGGACTGTCTCTGATTGAAAAACATCTGTCAT

GGTATCTGATGAATGGACGACTTTCCATGCAGCGGGGGAGAACAGTGGGAACTTATATTAACCGGCTGCTGGTAAAAATT

CGACCCCATGCTCTCGACCTGGTGGATGCCTTTGGTTACGGCGCTGAACACCTCCGGGCTGCTATAGCCACTGGAGCAGA

AGCCACAAGGCAGGACGAGGCCAGGACATACTTTAGACAACAGAGAGCCAGTGGATCTGCCCCCGCTGATGAAAAGACCC

TGCTCGCAATTAAAGCAGGCAAGTCCAGG

It will be understood by those of ordinary skill in the art that the foregoing embodiments are specific examples of carrying out the invention and that various changes in form and details may be made therein without departing from the spirit and scope of the invention.

Claims (10)

1. An isolated polynucleotide encoding an acyl-coa oxidase, wherein the polynucleotide is codon optimized and the polynucleotide is selected from any one of the following:

(i) A polynucleotide as shown in SEQ ID NO. 1;

(ii) A polynucleotide having a homology of greater than 95% with the sequence shown in SEQ ID NO. 1; and

(iii) A polynucleotide complementary to the sequence set forth in (i) or (ii).

2. An expression vector comprising the polynucleotide of claim 1.

3. The expression vector according to claim 3, characterized in that it is an E.coli expression vector, preferably pET-28a (+).

4. A host cell comprising the expression vector of claim 2 or 3; or alternatively

The polynucleotide of claim 1 integrated into the genome of the host cell.

5. A method for preparing an acyl-coa oxidase, the method comprising the steps of:

transforming a host cell with a vector comprising the polynucleotide of claim 1;

culturing the host cell to express the acyl-coa oxidase.

6. The method of claim 5, wherein the host cells are cultured using TB medium.

7. The method of claim 5, wherein the host cell is cultured at a temperature of 16 to 19 ℃.

8. The method according to claim 5, wherein the medium used in culturing the host cell comprises a kanamycin resistance gene.

9. The method of claim 5, wherein the host cell is cultured to express the protein of interest by IPTG induction.

10. A kit, comprising: the polynucleotide of claim 1; or alternatively

The expression vector of claim 2 or 3; or alternatively

The host cell of claim 4; or alternatively

An acyl-coa oxidase prepared according to the method of any one of claims 5 to 9.

Images