CN116042662A - Preparation method and application of acyl-coa synthetase - Google Patents

Abstract

The application discloses a preparation method and application of acyl-CoA synthetase. The preparation method of the high-activity recombinant acyl-CoA synthetase is developed, and the method has the advantages of large expression quantity of soluble protein, simple purification steps and high product activity, and is suitable for large-scale industrial production.

Description

Preparation method and application of acyl-coa synthetase

Technical Field

The invention relates to the field of biological medicine, in particular to a preparation method and application of acyl-CoA synthetase.

Background

Acyl-coa synthetase (ACS), also known as acetyl-coa ligase, acetyl-activating enzyme, is a basal enzyme ubiquitous in microorganisms and is a metabolic core enzyme. It is often used as a biological process for the preparation of mevalonic acid. The mevalonic acid has optical activity, can be applied to the industries of synthesis of optical materials, medicines, videos and the like, and has the effect of delaying skin aging of human bodies, so that the mevalonic acid has very wide application prospect. However, mevalonate-dependent acyl-CoA synthetases are in shortage of sources and difficult to extract. Many researchers have tried to develop a genetically engineered method for preparing recombinant acyl-coa synthetases, and in 2004, dai aesthetic et al purified the acyl-coa synthetase from rhizobia and analyzed its enzymatic properties. It is concluded that the enzyme activity is 12.7 times different before and after purification treatment, but the process is extremely unstable and is difficult to meet the requirements of industrial production. In addition, patent publication No. CN104480077A discloses a recombinant acyl-CoA synthetase, which takes an acyl-CoA synthetase gene of Pseudomonas fluorescens strain as a template, and obtains a recombinant expression product in escherichia coli, but the inventor discovers that the product has low enzyme activity in research and cannot meet the requirement of industrial production. Therefore, there is still a need in the art to develop a method for preparing a high-activity acyl-coa synthetase that is suitable for large-scale industrial production.

Disclosure of Invention

The invention aims to provide a preparation method of acyl-CoA synthetase.

It is another object of the present invention to provide polynucleotide sequences encoding acyl-coa synthetases.

It is another object of the present invention to provide a vector adapted to a polynucleotide sequence encoding an acyl-coa synthetase.

It is another object of the present invention to provide a kit comprising a polynucleotide sequence encoding an acyl-coa synthetase.

To solve the above technical problem, according to a first aspect of the present invention, there is provided a polynucleotide encoding an acyl-coa synthetase, the polynucleotide being codon optimized, and the polynucleotide being selected from any one of the following:

(i) A polynucleotide having a sequence as shown in SEQ ID NO. 1;

(ii) A polynucleotide having a homology of greater than 95% with the sequence shown in SEQ ID NO. 1; and

(iii) A polynucleotide complementary to the polynucleotide sequence set forth in (i) or (ii).

In a second aspect of the invention there is provided an expression vector comprising a polynucleotide provided in the first aspect of the invention.

In some preferred embodiments, the expression vector is an E.coli expression vector, more preferably pET-28a (+).

In a third aspect of the invention there is provided a host cell comprising an expression vector provided in the second aspect of the invention; or alternatively

The host cell has integrated into its genome a polynucleotide as provided in the first aspect of the invention.

In some preferred embodiments, the host cell is E.coli (Escherichia coli).

In some preferred embodiments, the host cell is an E.coli BL21 (DE 3) strain.

In a fourth aspect, the present invention provides a method for preparing an acyl-coa synthetase, the method comprising the steps of: culturing the host cell of the third aspect of the invention to express the protein of interest; and

separating the target protein to obtain the acyl-CoA synthetase;

in some preferred embodiments, the host cell is obtained by transforming E.coli with a plasmid comprising a polynucleotide according to the first aspect of the invention.

In some preferred embodiments, the host cell is cultured using SB, TB, LB, SOC medium, more preferably using TB medium.

In some preferred embodiments, the host cell is cultured in a shaking environment.

In some preferred embodiments, the host cell is cultured at a temperature of 16 to 19 ℃ or 35 to 39 ℃, more preferably at a temperature of 16 to 19 ℃.

In some preferred embodiments, the medium used in culturing the host cell comprises a kanamycin resistance gene.

In some preferred embodiments, the host cell is cultured using IPTG to induce expression of the protein of interest.

In some preferred embodiments, the host cell is cultured until an OD600 of 0.6 to 0.8 is reached, and is then induced with IPTG to express the protein of interest.

In some preferred embodiments, the step of isolating the protein of interest comprises:

eluting the crushed target protein supernatant through a chromatographic column when the flow is the same as that of the target protein supernatant, and collecting the eluent.

In some preferred embodiments, the chromatography column is a Ni-column affinity chromatography column (Ni-NTA).

In a fifth aspect, the invention provides a kit comprising: a polynucleotide as provided in the first aspect of the invention; or alternatively

An expression vector as provided in the second aspect of the invention; or alternatively

A host cell according to the third aspect of the invention; or alternatively

Or an acyl-CoA synthetase prepared according to the method of the fourth aspect of the invention.

Compared with the prior art, the invention has at least the following advantages:

(1) The invention develops a preparation method of high-activity recombinant acyl-CoA synthetase, which has the advantages of large expression quantity of soluble protein, simple purification steps and high product activity, and is suitable for large-scale industrial production;

(2) In the preferred embodiment of the invention, optimized codons with high soluble expression are obtained through synonymous codon preference optimization screening, so that the yield and the production efficiency are further improved.

It is understood that within the scope of the present invention, the above-described technical features of the present invention and technical features specifically described below (e.g., in the examples) may be combined with each other to constitute new or preferred technical solutions. And are limited to a space, and are not described in detail herein.

Drawings

One or more embodiments are illustrated by way of example and not limitation in the figures of the accompanying drawings.

FIG. 1 is a SDS-PAGE identification of the expression product of a Bacillus derived acyl-CoA synthetase according to an embodiment of the present invention (recombinant plasmid containing optimized codon I);

FIG. 2 is a SDS-PAGE identification of expression products of acyl-CoA synthetase derived from Mycobacterium tuberculosis according to an embodiment of the present invention;

FIG. 3 is a SDS-PAGE identification of the expression products of the Pseudomonas derived acyl-CoA synthetase in accordance with an embodiment of the present invention;

FIG. 4 is a SDS-PAGE identification of purified Bacillus derived acyl-CoA synthetase according to an embodiment of the present invention;

FIG. 5 is a SDS-PAGE identification of purified pseudomonas derived acyl-CoA synthetase according to an embodiment of the invention;

FIG. 6 is a graph showing the standard activity of acyl-CoA synthetase in accordance with an embodiment of the present invention;

FIG. 7 is a SDS-PAGE identification of expression products of Bacillus derived acyl-CoA synthetase according to an embodiment of the invention (recombinant plasmid containing optimized codon IV).

Detailed Description

The inventor of the present invention has developed a method for preparing acyl-CoA synthetase with high enzyme activity based on genetic engineering, which improves the expression level of soluble protein and is suitable for industrial mass production. The development of the method of the present invention for producing an acyl-CoA synthetase having a high enzymatic activity based on genetic engineering is based on the following procedure: s1, screening strain sources by a genetic engineering technology, and discarding strain sources with expression products as inclusion bodies in escherichia coli; s2, collecting a crude product of the supernatant soluble protein for enzyme activity detection, further discarding strain sources with no enzyme activity of an expression product in the escherichia coli, and selecting strain sources with soluble expression and high enzyme activity in the escherichia coli; s3, optimizing synonymous codon preference of a gene sequence for encoding acyl-CoA synthetase in a finally selected strain source, selecting an optimized codon with high soluble protein yield from a plurality of optimized codons, developing a matched acyl-CoA synthetase expression method based on the optimized codon, and culturing to obtain a large amount of soluble acyl-CoA synthetase with high enzyme activity.

The invention relates to a method for preparing acyl-CoA synthetase suitable for industrial mass production, which comprises 1) obtaining target genes/obtaining target protein related nucleic acid sequences; 2) Optimizing the synonymous codon of the target gene to obtain an optimized codon; 3) Introducing the optimized codon into a vector; 4) A step of introducing a vector into a host cell; and 5) culturing the host cell and obtaining the protein of interest. Preferably also 6) a step of purifying the protein of interest.

Acquisition of a Gene of interest/acquisition of a nucleic acid sequence related to a protein of interest

The nucleic acid sequence related to the target gene or target protein in the invention obtains the nucleic acid sequence information by analyzing the amino acid sequences of the acyl-CoA synthetase contained in different bacterial sources. Homologous proteins of different biological origin have different amino acid sequences, and the recombinant expression products thereof often have unpredictable functional activities, based on the gene sequences obtained from the proteins of interest of different origin. In one embodiment of the invention, the NCBI database is used for analyzing the amino acid sequences of a plurality of target proteins from different sources to obtain the sequence information of the target genes from different sources. In some embodiments, the corresponding acyl-coa synthase gene sequence information is obtained by analysis of bacillus, tubercle bacillus, and pseudomonas source acyl-coa synthetases by NCBI databases.

After obtaining the information about the sequence of the protein of interest, the polynucleotide sequence may be prepared by methods well known to those skilled in the art. The full-length nucleotide sequence of the target protein or its element or a fragment thereof of the present invention can be usually obtained by PCR amplification, recombinant methods or artificial synthesis. For the PCR amplification method, primers can be designed based on the disclosed nucleotide sequences, particularly open reading frame sequences, and amplified to obtain the relevant sequences using a commercially available cDNA library or a cDNA library prepared according to a conventional method known to those skilled in the art as a template. When the sequence is longer, it is often necessary to perform two or more PCR amplifications, and then splice the amplified fragments together in the correct order.

Once the relevant sequences are obtained, recombinant methods can be used to obtain the relevant sequences in large quantities. This is usually done by cloning it into a vector, transferring it into a cell, and isolating the relevant sequence from the propagated host cell by conventional methods.

Furthermore, the sequences concerned, in particular fragments of short length, can also be synthesized by artificial synthesis. In general, fragments of very long sequences are obtained by first synthesizing a plurality of small fragments and then ligating them.

Methods of amplifying DNA/RNA using PCR techniques are preferred for obtaining the genes of the present invention. Primers for PCR can be appropriately selected according to the sequence information of the present invention disclosed herein, and can be synthesized by a conventional method. The amplified DNA/RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.

Synonymous codon bias optimization

The present invention relates to synonymous codon bias optimized polynucleotide sequences. And (3) carrying out synonymous codon preference optimization on the obtained target gene sequence, wherein the target gene sequence subjected to synonymous codon preference optimization can express the amino acid sequence identical to the target protein. In some embodiments of the invention, optimization of E.coli synonymous codon bias is performed by a gene sequence of Bacillus origin, resulting in several optimized codons, exemplified by optimized codon I shown in SEQ ID NO.1, optimized codon IV shown in SEQ ID NO. 4. In another embodiment, several optimized codons are obtained by optimizing the synonymous codon bias of E.coli for the gene sequence of the source of B.coli, exemplary optimized codon II as shown in SEQ ID NO. 2. In another embodiment, several optimized codons are obtained by optimization of E.coli synonymous codon preference for the gene sequence of Pseudomonas origin, exemplified by optimized codon III as shown in SEQ ID NO. 3.

Several optimized codons obtained by optimizing codon preference in the same kind of source target protein gene in different modes, and these optimized codons can express target protein with corresponding activity in host cell normally, but the expression amount is different. In some embodiments of the invention, the optimized codons obtained by optimization of the synonymous codon bias of E.coli by the acyl-CoA synthetase gene sequence of Bacillus origin are expressed in large amounts of inclusion bodies, with partial presence of soluble expression, such as, illustratively, optimized codon I and optimized codon IV. Under the same conditions, there are optimizing codons for soluble expression, and the expression amount of soluble protein is also obviously different, for example, optimizing codon I and optimizing codon IV, and the expression amount of soluble protein introduced into escherichia coli by optimizing codon I is obviously higher than that of optimizing codon IV.

The target protein genes from different sources have larger activity difference after being optimized by synonymous codon preference, and the expression products obtained by introducing the target protein genes into host cells. In one embodiment, the activity difference of the expression product in E.coli is remarkable between the optimized codon I of the bacillus source and the optimized codon II of the tubercle bacillus source after optimization of synonymous codon preference of E.coli, and only the optimized codon I of the bacillus source has enzyme activity.

The invention also relates to polynucleotides having a homology of more than 80%, preferably more than 85%, more preferably more than 90%, more preferably more than 91%, more preferably more than 95% to the sequences shown in SEQ ID NOS.1-4; and polynucleotides complementary to the sequences shown in SEQ ID NOS.1-4.

Vector of target gene

The invention also relates to vectors comprising the polynucleotides (optimized codons) of the invention. "vector" in the present invention means a linear or circular DNA molecule comprising a fragment encoding a protein of interest operably linked to other fragments providing for its transcription. Such additional fragments may include promoter and terminator sequences, and may optionally include one or more origins of replication, one or more selectable markers, an enhancer, a polyadenylation signal, a vector, and the like. The vector fragment may be derived from the host organism, another organism, plasmid or viral DNA, or may be synthetic. The vector may be any expression vector, synthetic or conveniently subjected to recombinant DNA procedures, the choice of vector generally being dependent on the host cell into which the vector is to be introduced. Thus, the vector may be an autonomously replicating vector, i.e. a vector, which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid. Alternatively, the vector may be one that, when introduced into the host cell, integrates into the host cell genome and replicates with the chromosome with which it is integrated. In one embodiment, the vector of the invention is an expression vector. In one embodiment of the invention pET-28a (+) is selected as a vector to obtain higher expression efficiency.

Methods well known to those skilled in the art can be used to construct expression vectors containing the coding DNA sequences of the proteins of the invention and appropriate transcriptional/translational control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence may be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Illustratively, the insertion of the exogenous DNA fragment is accomplished by cleaving the vector DNA molecule with a DNA endonuclease into a linear molecule that can be linked to the exogenous gene, and then ligating the codon optimized fragment of the gene of interest to the vector, optionally with a single restriction site cohesive end ligation, double restriction site directional cloning, cohesive end ligation of different restriction sites, blunt end ligation, artificial linker ligation, or end ligation with an oligonucleotide.

Transformation of host cells with vectors containing genes of interest

The invention also relates to host cells genetically engineered with the vector or fusion protein coding sequences of the invention. The vector containing the codon-optimized gene of interest may be inserted, transfected or otherwise transformed into a host cell by known methods to obtain a transformant containing the codon-optimized gene of interest of the present invention and capable of expressing the protein of interest. A "host cell" in the present invention is a cell into which an exogenous polynucleotide and/or vector has been introduced. The host cell may be a eukaryotic host cell or a prokaryotic host cell, the host cell is preferably a bacterium, and is preferably E.coli, more preferably E.coli ROSETTA (DE 3) strain (Escherichia coli Rosetta (DE 3) strain).

Method for producing target protein

The invention also relates to a method for preparing the target protein, and the polynucleotide sequence can be used for expressing or producing recombinant protein. Generally, there are the following steps:

(1) Transforming or transducing a suitable host cell with a polynucleotide (or variant) encoding a protein of the invention, or with a recombinant expression vector comprising the polynucleotide;

(2) A host cell cultured in a suitable medium;

(3) Separating and purifying the protein from the culture medium or the cells.

Wherein, the transformation or transduction of the recombinant expression vector containing the polynucleotide of the step (1) into a suitable host cell can be performed by conventional techniques well known to those skilled in the art, and when the host is E.coli, a heat shock method, an electrotransformation method, etc. can be selected.

The transformant obtained can be cultured by a conventional method to express the polypeptide encoded by the gene of the present invention. Depending on the host cell used, the medium used in the culture may be selected from a variety of conventional media, preferably SB, TB, LB or SOC media. The culture is carried out under conditions suitable for the growth of the host cell. After the host cells have grown to the appropriate cell density, the selected promoters are induced by suitable means (e.g., temperature switching or chemical induction) and the cells are cultured for an additional period of time. In order to promote the expression of the target protein and to increase the expression level of the soluble protein, a preferred embodiment of the present invention uses a host cell cultured in TB or LB medium, and the medium used contains a kanamycin resistance gene.

To further facilitate the soluble expression of the protein of interest,in a preferred embodiment of the invention, the host cell is cultured to OD ₆₀₀ After 0.6-0.8 induction with IPTG and further incubation at 17 to 19 ℃ or 35 to 39 ℃ for about 8 to 12 hours.

The protein in the above method may be expressed in the cell, or on the cell membrane, or secreted outside the cell. If desired, the proteins can be isolated and purified by various separation methods using their physical, chemical and other properties. Thus, in the present invention, after the successful culture to obtain the target protein, it also involves a step of separating and purifying it, for example, in step (3), separating and purifying the protein from the culture medium to obtain the target protein in high purity. Although methods for purifying the protein of interest may be conventional means well known to those skilled in the art, including but not limited to: conventional renaturation treatment, treatment with a protein precipitant (salting-out method), centrifugation, osmotic sterilization, super-treatment, super-centrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques and combinations of these methods. In a preferred embodiment of the present invention there is provided a method for isolating a protein of interest, the steps comprising: eluting the crushed target protein supernatant through a chromatographic column when the flow is the same as that of the target protein supernatant, and collecting eluent; the mobile phase comprises BufferA, bufferB and/or BufferC; wherein, the BufferA comprises Tris (Tris, concentration 50 mM) and NaCl solution (concentration 50 mM); bufferB includes Tris (Tris, 50mM concentration), naCl solution (50 mM concentration) and Imidazole (500 mM concentration); bufferC includes Tris (Tris, 50mM concentration) and NaCl solution (1M concentration).

Preferably, in the eluting step, the eluting procedure includes a first stage and a second stage; in the first stage, the mobile phase used is BufferA; in the second stage, the mobile phase is a mixture of BufferA and BufferB, wherein the volume percentage of BufferA is gradually reduced from 100% to 40%, and the volume percentage of BufferB is gradually increased from 0% to 60%.

More preferably, the elution procedure further comprises a third stage in which the mobile phase used is BufferB.

Dialyzing the eluted and purified target protein product, and collecting a dialyzed sample. The dialysis samples were measured for concentration by BCA method and the yield was calculated.

In the present disclosure, any exemplary or exemplary language (e.g., ") provided for certain embodiments herein is used merely to better present the disclosure and does not limit the scope of the disclosure as otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

If the definition or use of a term in a reference is inconsistent or inconsistent with the definition of that term described herein, the definition of the term described herein applies and the definition of the term in the reference does not apply.

Various terms used herein are shown below. If a term used in a claim is not defined below, the broadest definition persons in the pertinent art have given that term are given as reflected in publications or issued patents that are printed at the time of application.

As used herein, the term "isolated" refers to a nucleic acid or polypeptide that is separated from at least one other component (e.g., a nucleic acid or polypeptide) that the nucleic acid or polypeptide is found in its natural source. In one embodiment, the nucleic acid or polypeptide is found to be present only (if any) in solvents, buffers, ions or other components that are normally present in its solution. The terms "isolated" and "purified" do not include nucleic acids or polypeptides that are present in their natural source.

As used herein, the terms "polynucleotide" and "polynucleotide sequence" may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. The DNA may be single-stranded or double-stranded. The DNA may be a coding strand or a non-coding strand.

The invention also relates to variants of the above polynucleotides which encode protein fragments, analogs and derivatives having the same amino acid sequence as the invention. Variants of the polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. Such nucleotide variants include substitution variants, deletion variants and insertion variants. As known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the encoded polypeptide.

As used herein, the term "codon optimization" refers to a manner of improving the efficiency of gene synthesis by avoiding the use of low-availability or rare codons according to codon usage differences exhibited by organisms (including e.coli, yeast, mammalian blood cells, plant cells, insect cells, etc.) that actually do protein expression or production.

As used herein, the terms "homology" and "identity" are used interchangeably to refer to the percentage of identical (i.e., identical) nucleotides or amino acids between two or more polynucleotides or polypeptides. Sequence identity between two or more polynucleotides or polypeptides can be measured by the following methods. The nucleotide or amino acid sequence of a polynucleotide or polypeptide is aligned, the number of positions in the aligned polynucleotide or polypeptide that contain the same nucleotide or amino acid residue is scored and compared to the number of positions in the aligned polynucleotide or polypeptide that contain a different nucleotide or amino acid residue. Polynucleotides may differ at one position, for example, according to the inclusion of different nucleotides (i.e., substitutions or variations) or deletions of nucleotides (i.e., insertions or deletions of one or two nucleotides in the polynucleotide). The polypeptides may differ at one position, for example, by containing an amino acid (i.e., substitution or variation) or a deletion of an amino acid (i.e., an amino acid or deletion of an amino acid inserted into one or both polypeptides). Sequence identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of amino acid residues in the polynucleotide or polypeptide. For example, percent identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of nucleotide or amino acid residues in the polynucleotide or polypeptide, and then multiplying by 100.

As used herein, the terms "sequence complementary" and "reverse sequence complementary" are used interchangeably to refer to a sequence that is opposite in direction to and complementary to the original polynucleotide sequence. For example, if the original polynucleotide sequence is actaac, then its reverse complement is GTTCAT.

As used herein, the term "expression" includes any step involving the production of a polypeptide in a host cell, including, but not limited to, transcription, translation, post-translational modification, and secretion. After expression, the host cells or expression products can be harvested, i.e.recovered.

The present invention will be further described with reference to specific embodiments in order to make the objects, technical solutions and advantages of the embodiments of the present invention more apparent. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental methods, in which specific conditions are not noted in the following examples, are generally conducted under conventional conditions or under conditions recommended by the manufacturer. Percentages and parts are weight percentages and parts unless otherwise indicated. The experimental materials and reagents used in the following examples were obtained from commercial sources unless otherwise specified.

Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs, it is to be noted that the terms used herein are used merely to describe specific embodiments and are not intended to limit the exemplary embodiments of this application.

Example 1

In this example, plasmids containing optimized codons encoding acyl-CoA synthetase derived from Bacillus, mycobacterium tuberculosis and Pseudomonas were synthesized and introduced into E.coli for culture to obtain a monoclonal.

(1) Construction of acyl-CoA synthetase plasmid

The gene sequence of bacillus-derived acyl-coa synthetase was obtained and optimized for e.coli synonymous codon preference to obtain optimized codon i (SEQ ID No. 1), ligated into pET-28a (+) vector and delegated synthesis by su Jin Weizhi biotechnology limited.

Obtaining the gene sequence of acyl-CoA synthetase from mycobacterium tuberculosis, and optimizing the synonymous codon preference of escherichia coli to obtain an optimized codon II (SEQ ID NO. 2). Was ligated into pET-28a (+) vector and was delegated to Suzhou Jin Weizhi Biotechnology Co.

Obtaining the gene sequence of the acyl-CoA synthetase from pseudomonas, and optimizing the synonymous codon preference of the escherichia coli to obtain an optimized codon III (SEQ ID NO. 3). Was ligated into pET-28a (+) vector and was delegated to Suzhou Jin Weizhi Biotechnology Co.

(2) Recombinant plasmid introduction into host E.coli

Taking 1 mu L of the expression plasmid prepared in the step (1), adding the expression plasmid into 30 mu L of escherichia coli competent BL21 (DE 3) under ice bath condition, standing for 30min in ice bath, standing for 45s in water bath at 42 ℃, standing for 2min on ice immediately, adding 400 mu L of SOC culture medium without antibiotics, and culturing for 45min at 37 ℃ and 230rpm in an oscillating way. mu.L of the bacterial liquid was uniformly spread on LB plates containing 100. Mu.g/mL of kana resistance, and incubated overnight at 37 ℃.

(3) Expression of the Gene of interest

Picking the monoclonal prepared in the step (2), inoculating the monoclonal into TB medium containing 100 mug/mL kana resistance in a sterile operation, culturing the monoclonal in shaking mode at 220rpm at 37 ℃ until OD600 is between 0.6 and 0.8, inducing the monoclonal by IPTG, and culturing the monoclonal in shaking mode at 37 ℃ and 18 ℃ for overnight. Sampling and ultrasonication for SDS-PAGE identification. The results of the identification are shown in FIGS. 1 to 3.

According to FIGS. 1 to 3, the acyl-CoA synthetases derived from Bacillus and Pseudomonas can be expressed as supernatants in E.coli, and the acyl-CoA synthetase derived from Mycobacterium tuberculosis is expressed as inclusion bodies.

(4) Purification of the protein of interest

About 4g of the bacillus and pseudomonas derived recombinant strain prepared in the step (3) was weighed, and 20mL of Lysis Buffer was added thereto to disperse on ice using a disperser. Ultrasonic disruption of cells: the phi 10 probe has 10 percent of power, works for 5.5 seconds, stops for 9.9 seconds and is subjected to ultrasonic crushing for 30 minutes. Centrifugation was carried out at 20000rpm at 4℃for 30min, and the supernatant was collected and filtered through a 0.22 μm membrane. Purification with 1mL Ni-NTA, formulation of mobile phase fractions referring to Table 1, mobile phase flow rate of 0.5mL/min, UV and conductance to baseline were rinsed with 20mL Lysis Buffer for the run-on. The elution procedure included: step 1:0% B,10CV,1.5ml/min; step 2:0-60% B,20CV,1.5ml/min; step 3:100% B,15CV,1.5ml/min.

TABLE 1

The purified product was collected for subsequent enzyme activity testing. The results of electrophoresis of the purified expression products of the acyl-CoA synthetase derived from Bacillus and Pseudomonas are shown in FIGS. 4 and 5, respectively.

According to FIG. 4, elution was started at an imidazole concentration of 60mM, and the eluate F8-G2 of the purified expression product of Bacillus acyl-CoA synthetase was packed into a 10KD dialysis bag and dialyzed overnight in 2000mL of dialysate, and the dialyzed sample was collected the next morning and mixed well to obtain 9.5mL of sample. The BCA was used to measure the concentration, resulting in: r is R ² =0.996, its concentration is 2.248mg/mL, yield is 21.3275mg, yield is 5.332mg/g bacteria.

The Pseudomonas source expression product is treated in the same manner as the purification of the Bacillus source expression product sample. According to FIG. 5, a total of 16ml of purified sample 2C5-2D9 of Pseudomonas derived expression product was taken, put into a 10KD dialysis bag, put into 2000ml of dialysate for overnight dialysis, collected the next morning after dialysis, mixed well to obtain 15ml of sample, measured for concentration by BCA method, R ² =0.995, the sample concentration was measured to be 1.173mg/ml, the yield was 17.6mg, and the yield was 4.4mg/g bacteria.

SEQ ID NO.1

GCTAACGTAACTACTCGTCTGGCACAGATCGCAAAACAGCTGCCGGATAAAGAGGCTTACGTGTTCATGAAGGAACGTTGCACTTATCAGCAACTGGATGAAGCGATTTCCCGTTTTGCTGATGGTCTGGCACGTCTGGGTGTTCGTCGTGGCGATCATATCGCTCTGCTGCTGGGCAACTCCCCGCAGTTCGTAATCGGTCTGTATGGTGCTCTGCGTCTGGGTGCGACCGTTATTCCGATCAACCCGATTTACACCCCGGAGGAAATTTCTTATATCCTGCACAACGGCGATGTTAAAGCGGTGATTGGTCTGGACCTGCTGGCTCCGCTGTTCGTGGAGGCTAAAAAGCGTCTGCCGCTGCTGGAACACGCCATCGTGTGTGAAACCCCGGAAGGCAAAGAAAAAGGCGTTTCTCTGTCTGAGGGCATGAAAAGCTTTGCGGAAGTCCTGGCTGACGGTTCCCCGGATTTCACCGGTCCGGAACTGGGTGATGATGATGTAGCTGTTATCCTGTATACTTCTGGCACCACCGGTAAACCGAAAGGCGCAATGCTGACCCACAAAAACATCTACTCCAACGCACAGGATACCGCCGACTACCTGGGTATTAATGAGAACGACCGTGTTATTGCAGCACTGCCGATGTTCCACGTCTTCTGCCTGACCGTTGCGCTGAACGCTCCTCTGATGAATGGTGGTACTGTCCTGATTATGCCGAAGTTCAGCCCAGCAAAACTGTTCCAGCTGGCTCGTGAAGAAAAAGCGACCATCTTTGCGGGTGTTCCGACTATGTATAATTTCCTGTATCAGTACGAAGGCGGTTCTGCAGATGATCTGCGCACGCTGCGTCTGTGCATTTCTGGTGGTGCGAGCATGCCGGTTGCACTGCTGGAAAACTTCGAAAAGAAATTTAACGTTATCATCAGCGAAGGCTATGGTCTGTCTGAAGCTTCTCCGGTAACCTGTTTCAACCCACTGGACCGTCCACGTAAACCGGGTTCCATCGGCACTAACATCAAAAACGTAGAAAATAAAGTCGTGAATGAGTATGGTGAAGAAGTTCCAGTAGGTGAAGTAGGTGAACTGGTAGTGCGTGGTCCGAACGTAATGAAAGGCTACTACAAAATGCCGGAAGAAACTTCTGCGGCACTGCGTGATGGTTGGCTGCATACGGGTGACCTGGCTCGCATGGATGAAGATGGTTACTTCTATATTGTTGACCGTAAAAAAGAGATGATCATCGTTGGCGGTTACAACGTTTATCCGCGTGAAGTAGAAGAAGTCCTGTATTCTCACCCGGACGTGGTGGAAGCAGCAGTGATCGGCGTTCCGGATCCGGACTACGGTGAAGCGGTCCGTGCTTATGTTGTCGCGAAAAACCCTGAACTGACCGAAGCTGAACTGATCGCATACTGTCGTGAACGCCTGGCCAAATATAAAGTCCCGTCCGCAATTGATTTCCTGGACGAACTGCCAAAAAACGCTACCGGCAAAATTCTGCGTCGTGCACTGAAAGAACGTCTGGCA

SEQ ID NO.2

ATGCGTATTCGTCAAGCGTTTGGCCTGATTGCCACCATGCGTCGTGCAGGTCTGATTGCTCCGCTGCGTCCGGATCGTTACCTGCGTATCGTCGCGGCTATGCGTCGTGAAGGCATGGGCTTTACTGCTGGTTTCGCTGGTGCAGCACGTCGTTGTCCGGATCGTCCGGGTCTGATCGATGAGCTGGGTACTCTGACTTGGCGCCAGCTGGATGAACGTGGCAACGCACTGGCTGCGGCACTGCAAGCACTGCCTGCAGGTCCTCCACGTGTTGTGGGTATCATGTGTCGCAACCACCGTGGTTTCGTAGACGCGCTGCTGGCTGTTAATCGCATCGGCGCCCACATCCTGCTGCTGAACACTAGCTTCGCTGGCCCGGCTCTGGCGGAAGTTGTTACCCGTGAGGGTGTGGATACCGTCGTGTACGACGAGGAGTTCTCCGCGACCGTAGATCGTGCACTGGCCGAAAAACCGCAGGCAACCCGTATTGTCGCATGGACCGACGAAGATCACGATCTGACTGTAGAAAAACTGGTTGCAGCACACGCAGGTCGTCGTCCGGAACACACTGGCTCTCACGGCAAAGTCATCCTGCTGACTTCTGGTACTACCGGCACTCCGAAAGGCGCGCGTCATTCCGGTGGTGGTATCGGTACTCTGAAAGCTATCCTGGATCGTACCCCGTGGCGCGCTGAAGAAGTGACCGTAATTGTGGCTCCGATGTTCCACGCCTGGGGTTTCTCTCAGCTGGTTCTGGCATCTAGCCTGGCGTGCACTATCGTGACTCGTCGTCGTTTCGACCCGGAAGCTACCCTGGATCTGATCGACCGTCATCACGCGACCGGCCTGGTCGTAGTTCCGGTTATGTTTGATCGTATCATGGACCTGCCGGCAGAAATCCGTAACCGTTACGACGGTCGTTCTCTGCGTTTTGCGGCTGCTTCTGGTTCTCGTATGCGCCCGGACGTTGTAATCGCCTTCATGGACCAGTTCGGCGACGTAATCTACAACAATTACAACGCTACCGAAGCTGGCATGATCGCTACTGCTACTCCAGCTGACCTGCGCACCGCACCTGATACCGCTGGTCGTCCAGCAGAAGGTACCGAAATTCGCATTCTGGACCAGCAATTCACCGAAGTCCCGACTGGTGAAGTTGGTACCATCTACGTTCGTAACGACTCCCAGTTCGACGGCTATACCTCTGGTGCGGCCAAGGACTTCCACGCAGGTTTCATGAGCTCCGGTGATGTGGGCTATCTGGATGAGAATGGTCGTCTGTTCGTCGTAGGCCGTGATGACGAAATGATCGTTTCTGGTGGTGAAAACATCTACCCTATCGAGGTGGAGAAGACCCTGGCAACGCACCCAGACGTTGCAGAAGCGGCTGTTATCGGCGTAGATGATCAGCAGTACGGCCAGCGTCTGGCCGCTTTCGTGGTTCTGAAACCTGGTGTGTCTGCGACTCCAGAGACCCTGAAACAGCATGTTCGTGACAACCTGGCGAATTACAAAGTCCCGCGTGACATCGCAGTGCTGGACGAACTGCCGCGTGGCATCACCGGTAAAATCCTGCGTACCGAGCTGCAGAGCCGTGTTGGCTCT

SEQ ID NO.3

ATGTCTGCAGCATCTCTGTACCCAGTTCGCCCTGAAGTTGCTGCTACCACTCTGACTGATGAAGCGACCTACAAAGCGATGTATCAGCAGAGCGTCGTTAACCCGGATGGCTTCTGGCGTGAACAAGCACAGCGTCTGGACTGGATCAAACCATTCAGCGTCGTTAAACAGACCTCTTTCGACGATCACCGTGTTGACATCAAGTGGTTCGCGGATGGCACTCTGAACGTGGCTTACAACTGCCTGGACCGCCATCTGGCTGAACGTGGTGATACCATTGCGATCATCTGGGAAGGTGATAACCCTTCTGAACACCGTGAAATCACCTACCGTGAACTGCATGCCGAAGTTTGTAAATTCGCTAACGCTCTGCGTGGCCAAGACGTTCATCGTGGTGACGTAGTTACCATCTACATGCCGATGATCCCGGAAGCAGTCGTTGCTATGCTGGCGTGTGCACGCATTGGCGCGATTCATAGCGTGGTTTTCGGTGGCTTCTCCCCTGAAGCACTGGCAGGCCGTATCATCGACTGCTCCAGCAAAGTCGTAATTACTGCGGACGAAGGTCTGCGCGGCGGTAAAAAAACTGCACTGAAAGCGAACGTAGATCGCGCACTGACCAACCCGGAGACTTCTTCCGTGCAAAAAGTTATCGTGTGTAAACGTACCGGCGGTGAAATTGAATGGAACCGCCACCGTGACATCTGGTACCACAGCCTGCTGGAAGTTGCGTCTTCCACCTGCGCACCGAAAGAAATGGGCGCTGAAGAATCTCTGTTCATCCTGTACACCAGCGGCTCTACCGGTAAGCCGAAAGGCGTTCTGCATACCACCGCGGGTTACCTGCTGTATGCTGCTCTGACCCATGAACGTGTTTTCGACTACAAACCTGGTGAGATTTACTGGTGTACCGCAGATGTAGGTTGGGTTACCGGTCATAGCTACATTGTATACGGCCCGCTGGCTAACGGTGCGACTACTCTGCTGTTCGAAGGTGTCCCTAACTACCCGGACATTACCCGTGTTAGCAAAATCATCGATAAACACAAAGTTAACATCCTGTATACGGCGCCGACCGCAATCCGTGCAATGATGGCGGAAGGCACTAAGTCCGTCGAAGGCGCTGATGGTTCCTCCCTGCGTCTGCTGGGTTCCGTAGGCGAACCGATCAACCCGGAAGCGTGGGGTTGGTACTATAACACCGTAGGCAAACAGAACTGCCCGATCGTGGACACTTGGTGGCAGACCGAAACCGGCGGTATTCTGATCTCTCCGCTGCCGGGTGCTACTGCACTGAAACCTGGTAGCGCAACCCGCCCGTTCTTTGGCGTAATCCCGGCTCTGGTAGACAACCTGGGTAACCTGATCGAAGGTGCCGCAGAAGGCAACCTGGTAATCCTGGACTCTTGGCCAGGTCAGTCTCGTAGCCTGTATGGCGATCACGATCGCTTCGTTGATACTTATTTCAAAACGTTTCGTGGTATGTACTTCACCGGTGACGGTGCTCGCCGTGATGAAGATGGTTATTATTGGATCACCGGCCGTGTGGACGATGTTCTGAACGTTTCTGGCCACCGTATGGGTACCGCTGAAATCGAATCCGCTATGGTAGCCCATCCGAAAGTTGCCGAAGCGGCGGTAGTTGGTGTTCCGCACGATCTGAAAGGTCAGGGCATTTATGTTTACGTCACTCTGAACGGCGGCGAAGAACCATCCGATGCCCTGCGTACCGAACTGCGTAACTGGGTTCGCAAGGAAATTGGTCCGATCGCATCCCCGGATTTCATTCAATGGGCACCAGGTCTGCCGAAAACCCGCTCTGGTAAAATTATGCGTCGCATCCTGCGTAAAATCGCGACCGCAGAATACGATGCGCTGGGCGATATCTCTACGCTGGCCGACCCAGGTGTTGTGCAGCATCTGATCGATACTCACAAAACGATGAACGCTGCT

Example 2

In this example, purified bacillus and pseudomonas derived acyl-coa synthetases were taken for subsequent enzyme activity detection experiments. The method comprises the following specific steps:

(1) Solution preparation

1M L-malic acid: 1.34g of L-malic acid was weighed out and dissolved in 10mL of deionized water.

1M potassium acetate: 0.98g of potassium acetate was weighed out and dissolved in 10mL of deionized water.

100mM NAD+: 0.066g of NAD+ powder was weighed and dissolved in 1mL of deionized water and stored protected from light.

10mM CoA: 0.076g CoA powder was weighed and dissolved in 10mL deionized water.

1M MgCl2: 0.95g of magnesium chloride was weighed out and dissolved in 10mL of deionized water.

1mL of working fluid formulation was referenced in Table 2.

TABLE 2

Reagent(s)	Volume of	Final concentration
			0.2M Tris-HCl(pH 8.0)	500μL	100mM
1M MgCl2	10μL	10mM
			100mM NAD+	10μL	1mM
10mM CoA	20μL	0.2mM
			1M L-malic acid	10μL	10mM
Malate dehydrogenase	10U
			Citrate synthase	1U
1M Potassium acetate	100μL	100mM
			0.1M ATP	80μL	8mM
ddH2O	270μL

Positive enzyme preparation: positive enzyme (commercial acyl-CoA synthetase control) was dissolved in PBS pH 7.4 buffer to prepare 0.5U/. Mu.L of enzyme solution, which was gradually diluted according to the gradient, and the dilution was PBS pH 7.4 buffer.

(2) Instrument detection

The enzyme label instrument is preheated for 30min, 100 mu L of reaction liquid is added, the absorbance A1 is detected at 340nm, then 5 mu L of enzyme liquid with each concentration is added, the mixture is uniformly mixed for 5s by shaking, the reaction is carried out for 20min, and the absorbance A2 is detected at 340 nm. The standard curve is shown in fig. 6. The OD difference A2-A1 of the sample and the blank was calculated and the sample concentration was determined from the difference. The results are shown in Table 3.

TABLE 3 Table 3

The concentration of the purified bacillus source recombinant acyl-CoA synthesis zymogen liquid stock solution is 2.248mg/mL, the average activity is 0.06642U/mu L, and the specific activity is (0.06642 x 1000)/2.248= 29.54U/mg. The recombinant acyl-CoA synthetase from Pseudomonas is detected, and no enzyme activity is generated.

Example 3

In the embodiment, the bacillus source acyl-coa synthetase with good enzyme activity of the purified product is selected, the encoding genes of the bacillus source acyl-coa synthetase are optimized in different modes for synonymous codon preference of escherichia coli, and optimized codons with higher soluble expression quantity are obtained by screening.

The nucleotide sequence of the bacillus source acyl-coa synthetase gene was selected, optimized for synonymous codon bias different from example 1, to obtain a number of optimized codons, exemplified by the optimized codons shown in SEQ ID No.4, and recombinant plasmids were synthesized and cultured in e.coli in the same manner as example 1, with soluble expression, and the SDS-PAGE identification of the expressed crude product was shown in fig. 7. After purification of the soluble expression product, the calculated yield was 6.16mg, with a yield of 1.54mg/g bacteria.

SEQ ID NO.4

GCAAACGTAACAACGCGCTTAGCACAAATTGCTAAGCAGCTGCCTGATAAGGAAGCTTATGTCTTTATGAAAGAGCGGTGCACATACCAGCAACTTGATGAAGCAATTTCACGCTTTGCTGATGGTCTGGCGCGCCTTGGTGTTAGACGTGGCGATCACATTGCTTTATTGCTGGGCAATAGTCCGCAGTTTGTGATCGGACTTTATGGAGCGTTACGCTTGGGTGCAACTGTCATCCCTATCAATCCTATTTACACGCCGGAGGAAATCTCTTATATTCTCCATAATGGTGACGTCAAAGCGGTGATTGGCTTAGATCTGTTAGCGCCGCTTTTCGTCGAAGCAAAAAAACGACTGCCTCTTCTTGAACATGCTATTGTATGCGAAACACCGGAGGGGAAAGAAAAAGGCGTATCACTGAGCGAAGGCATGAAAAGCTTTGCTGAAGTACTGGCGGATGGATCTCCTGATTTCACGGGCCCTGAATTGGGAGACGATGACGTTGCAGTGATTCTTTACACGAGTGGCACGACCGGCAAACCAAAAGGAGCAATGCTTACGCATAAAAATATTTATAGCAATGCCCAAGATACCGCCGACTACCTTGGAATTAATGAAAATGATAGAGTAATTGCGGCACTGCCGATGTTTCACGTCTTTTGTCTCACAGTTGCCCTTAATGCGCCGCTGATGAATGGAGGAACAGTCCTTATCATGCCGAAGTTTTCGCCGGCCAAACTTTTTCAGCTCGCGCGAGAGGAAAAGGCCACTATATTTGCCGGGGTCCCTACTATGTATAACTTTCTTTATCAGTATGAAGGCGGATCCGCCGATGATTTGAGAACGTTGCGGTTATGTATCTCTGGCGGCGCCTCAATGCCTGTCGCTCTGTTAGAGAACTTTGAAAAAAAGTTTAATGTAATCATATCAGAAGGCTATGGCTTATCGGAAGCCTCGCCGGTCACATGTTTTAACCCTTTGGATCGACCTCGAAAACCGGGATCAATTGGCACGAATATTAAAAACGTTGAGAATAAAGTCGTTAATGAATATGGTGAAGAAGTGCCAGTGGGAGAAGTAGGCGAATTGGTTGTACGGGGACCTAATGTGATGAAAGGTTATTATAAAATGCCTGAGGAAACGAGCGCCGCTTTACGAGATGGTTGGTTACATACGGGAGACCTCGCTAGAATGGACGAAGACGGATACTTTTACATAGTTGACCGCAAAAAAGAAATGATCATAGTCGGAGGGTATAACGTGTACCCACGCGAGGTCGAGGAAGTTTTATATTCGCATCCGGATGTCGTCGAAGCTGCGGTAATCGGAGTGCCGGACCCAGATTATGGAGAAGCGGTGCGTGCGTATGTTGTTGCCAAAAATCCTGAGTTAACAGAGGCGGAATTGATTGCCTATTGCCGAGAACGCTTGGCAAAATATAAGGTGCCGTCTGCTATCGACTTTTTAGATGAACTCCCTAAAAATGCTACAGGAAAGATCCTCAGAAGAGCGCTTAAAGAAAGACTTGCTTCTTCGCATGCC

It will be understood by those of ordinary skill in the art that the foregoing embodiments are specific examples of carrying out the invention and that various changes in form and details may be made therein without departing from the spirit and scope of the invention.

Claims (10)

1. An isolated polynucleotide encoding an acyl-coa synthetase, wherein the polynucleotide is codon optimized and the polynucleotide is selected from any one of:

(i) A polynucleotide as shown in SEQ ID NO. 1;

(ii) A polynucleotide having a homology of greater than 95% with the sequence shown in SEQ ID NO. 1; and

(iii) A polynucleotide complementary to the sequence set forth in (i) or (ii).

2. An expression vector comprising the polynucleotide of claim 1.

3. The expression vector according to claim 3, characterized in that it is an E.coli expression vector, preferably pET-28a (+).

4. A host cell comprising the expression vector of claim 2 or 3; or alternatively

The polynucleotide of claim 1 integrated into the genome of the host cell.

5. A method for preparing an acyl-coa synthetase, comprising the steps of:

transforming a host cell with a vector comprising the polynucleotide of claim 1;

culturing the host cell to express the acyl-coa synthetase.

6. The method of claim 5, wherein the host cells are cultured using TB medium.

7. The method of claim 5, wherein the host cell is cultured at a temperature of 16 to 19 ℃.

8. The method according to claim 5, wherein the medium used in culturing the host cell comprises a kanamycin resistance gene.

9. The method of claim 5, wherein the host cell is cultured to express the protein of interest by IPTG induction.

10. A kit, comprising: the polynucleotide of claim 1; or alternatively

The expression vector of claim 2 or 3; or alternatively

The host cell of claim 4; or alternatively

An acyl-coa synthetase prepared according to the method of any one of claims 5 to 9.

Images