CN115993348A - A biosensing chip for SPR detects - Google Patents

Abstract

The invention relates to the technical field of biological detection and detection, and specifically discloses a biosensing chip for SPR detection, including a metal film for carrying a substance to be tested, and a metal film and a light-transmitting medium for SPR detection. Light-transmitting medium-metal film interface, the metal film is a metal film in the form of an electrode array, and the electrode array is connected to an AC signal source. The biosensing chip solves the technical problem that the biocombination reaction time is too long in the traditional SPR detection, which makes the result inaccurate.

Description

A biosensor chip for SPR detection

technical field

The invention belongs to the technical field of biological detection and detection, and in particular relates to a biological sensor chip for SPR detection.

Background technique

The biosensor chip used for SPR detection in the prior art uses a whole piece of metal film, which only allows the analyte to be naturally combined with the surface of the SPR chip, which takes a long time, usually more than 2 hours. Due to the influence of the external environment such as temperature on the experimental results, and if the time is too long, the solution will evaporate and the experiment will fail.

Contents of the invention

The present invention intends to provide a biosensor chip for SPR detection, so as to solve the technical problem of inaccurate results caused by too long biocombination reaction time in traditional SPR detection.

The biosensor chip for SPR detection in the present invention includes a metal film for carrying the substance to be tested, and the metal film and the light-transmitting medium establish a light-transmitting medium-metal film interface for SPR detection, so The metal film is in the form of an electrode array, and the electrode array is connected to an alternating current signal source.

Further, the thickness of the metal film is 50-100 nm.

Further, the metal film is a metal film in the form of interdigitated electrode pairs.

Further, the interdigital electrode pair includes two sets of contact electrode parts and interdigital electrode parts, wherein the interdigital electrode parts are a plurality of parallel strip electrodes, one end of these strip electrodes is connected to the contact electrode part, the The contact electrode part is used to connect the alternating current signal source; the interdigital electrode parts connected to each other of the two groups of contact electrode parts are interlaced with each other.

Further, the metal film is coated on the prism in the SPR detection system.

Further, the metal film is coated on one side of the transparent material substrate, and the other side of the transparent material substrate is coupled to the prism in the SPR detection system.

Further, the transparent material substrate is made of K9 glass.

Further, the transparent material substrate and the prism used for testing are bonded by a refractive index matching liquid, and the refractive index of the refractive index matching liquid is basically the same as that of the transparent material substrate or the prism.

Further, the AC signal source is an impedance analyzer.

The working principle and beneficial effect of the biosensing chip for SPR detection in the present invention are that first, the metal film is functionalized for the substance to be tested, and when the SPR detection is implemented, an AC signal is applied to the electrodes in the electrode array, Excite the alternating current electrokinetic effect (ACEK) on its surface, thereby accelerating the enrichment of the substance to be tested on the surface of the electrode, and speeding up the fixation of the substance to be tested on the surface of the functionalized electrode, thereby shortening the overall time-consuming effect of SPR detection and avoiding The biological binding reaction time in the traditional SPR detection system is too long, and the external environment such as temperature has a great influence on the experimental results during the detection period. At the same time, if the time is too long, the solution will evaporate and the experiment will fail, and the accuracy of SPR detection is improved.

In some embodiments of the invention, the impedance analyzer is used as the AC signal source, and the interface capacitance data measured by the impedance analyzer can also be used to complete the concentration test based on the ACEK effect (ACEK detection for short), and the ACEK test and the SPR test will meet At the same time, the spectral data and the interface capacitance data are obtained. The two data are independent and can complement each other. The capacitance data obtained by the impedance analyzer can reflect the sample concentration, so the two test methods can be mutually verified. For the same sample detection, it can be detected by optical The relationship between the SPR resonance wavelength measured by the system and the sample concentration and the relationship between the interface capacitance change rate measured by the electrical system and the sample concentration are analyzed together to make the detection results more reliable; in addition, when problems occur in the experiment, they can be compared with each other, making it easier Find out what's wrong.

Description of drawings

FIG. 1 is a schematic logical block diagram of a fast SPR detection system in an embodiment of the present invention.

FIG. 2 is a schematic structural diagram of a metal film in the form of an electrode array in an embodiment of the present invention.

Fig. 3 is a schematic diagram of a coupling manner between a prism and a biosensor chip for SPR detection in an embodiment of the present invention.

Fig. 4 is a schematic structural diagram of a rapid SPR detection system in an experimental example of the present invention.

Fig. 5 is a schematic diagram of the optical path in the experimental example of the present invention.

Fig. 6 is a biosensing sequence test diagram obtained in an experimental example of the present invention.

The reference signs in Fig. 1 include, 01-light source, 02-R1 macroscopic angle-resolved spectrometer, 03-prism, 04-impedance analyzer, 05-fiber optic spectrometer, 06-computer;

The reference numerals in FIG. 2 include, 01-contact electrode part, 02-interdigital electrode part.

Detailed ways

The biosensor chip used for SPR detection in this embodiment is applied to a fast SPR detection system, which is basically shown in Figure 1, based on a typical prism-coupled SPR detection basic platform structure, including a light source, R1 macro angle A resolution spectrometer, a prism coupled with a biosensing chip for SPR detection, a fiber optic spectrometer and a computer, to which an impedance analyzer was added.

The light source is used to generate incident light of different frequencies and different powers.

The R1 macro angle-resolved spectrometer is an optical platform in the SPR detection basic platform in this embodiment, and is used to carry a prism coupled with a biosensor chip; the light source is connected to the incident end of the R1 macro-angle-resolved spectrometer through an optical fiber .

The fiber optic spectrometer is connected to the output end of the R1 macroscopic angle-resolved spectrometer through an optical fiber, and is used to receive optical signals and perform data measurement;

The computer is connected with the fiber optic spectrometer for acquiring data from the fiber optic spectrometer and processing it.

Optical surface plasmon resonance (Surface Plasmon Resonance, SPR) is an optical physical phenomenon. When a beam of P-polarized light is incident on the interface between the light-transmitting medium and the metal film within a certain angle range, a surface will appear on the interface. plasma wave. When the propagation constant of the incident light wave matches that of the surface plasmon wave, it will cause the free electrons in the metal film to resonate, that is, the surface plasmon resonance. When using the SPR detection method for detection and analysis, a layer of biomolecular recognition film is first fixed on the metal film of the SPR biosensing chip, and then the sample to be tested flows over the surface of the metal film. Molecules that interact with the molecular recognition membrane will cause changes in the refractive index of the gold film surface, which will eventually lead to changes in the SPR angle. By detecting the changes in the SPR angle, information such as the concentration, affinity, kinetic constant, and specificity of the analyte can be obtained.

The light-transmitting medium-metal film interface for SPR detection established in this embodiment is a prism-metal film interface (Kretschmann structure). According to the existing SPR detection technology and the principle of SPR detection, another aspect of the present invention In some embodiments, it is allowed to establish various light-transmitting medium-metal film interfaces that can generate the SPR effect and then be used for SPR detection, such as prism-gap-metal film interface (Otto structure), optical fiber-metal film interface ( Optical fiber type attenuated total reflection coupling), optical waveguide-metal film interface (optical waveguide type attenuated total reflection coupling), etc., the basic detection systems corresponding to these interface settings are relatively existing, and are not pressed here, and in these embodiments The metal films used to carry the substances to be tested are all metal films in the form of electrode arrays, and therefore are not excluded from the scope of protection of the present invention.

In this embodiment, the metal film used to carry the substance to be measured on the biosensing chip is a metal film in the form of an electrode array, and in this embodiment, an impedance analyzer is used to electrically connect with the metal film for feeding the electrode array Apply an alternating current signal that can produce an alternating electrokinetic effect, and measure the capacitance change of the biosensing chip at the same time.

In some other embodiments, electrical instruments such as an impedance analyzer can also be used to measure changes in one or several parameters of the biosensing chip such as impedance, phase, resistance, capacitance, and inductance.

Figure 2 shows an exemplary metal film in the form of an electrode array, including a contact electrode part and an interdigital electrode part. The metal film is made of gold (Au) and has a thickness of 50nm-100nm. It can be seen from the figure A group of contact electrode parts and interdigital electrode parts are arranged on the left and right sides, wherein the interdigital electrode parts are a plurality of parallel strip electrodes, one end of these strip electrodes is connected to the contact electrode part, and the contact electrode part is used For connecting the AC signal source, the interdigital electrodes connected to the contact electrode parts on the left and right sides are interlaced with each other, thereby forming an interdigital electrode pair.

In some embodiments, the gap between adjacent fingers is 5um, the length of the strip electrode is 400um, and the width of the strip electrode is 5um;

In other embodiments, the gap between adjacent fingers is 5um, the length of the strip electrode is 400um, and the width of the strip electrode is 10um.

Before the metal film on the biosensing chip is used for detection, it is necessary to carry out different surface modifications according to the different substances to be tested, that is, to functionalize the biosensing chip. The specific process is well known to those skilled in the art and will not be discussed here Do repeat.

As shown in part (a) of Figure 3, the coupling method between the biosensor chip and the prism can be, but not limited to, directly plating the metal film on the bottom of the prism, and relying on the prism to directly generate the prism-metal film interface. High sensitivity, good stability, but poor recyclability, not suitable for repeated use.

As shown in part (b) of Figure 3, the coupling method between the biosensor chip and the lens can also be, but not limited to, coating a metal film on a glass substrate whose refractive index is basically the same as that of the prism to form a biosensor chip with a substrate. The glass substrate is attached to the bottom of the prism through the refractive index matching liquid. The glass substrate is viewed as the extension of the prism, and the interface between the glass substrate and the metal film is the interface between the prism and the metal film. The performance will be reduced, but the chip can be reused, which greatly reduces the cost.

In some embodiments, the lens and the glass substrate use but not limited to K9 with a refractive index of 1.514, and the corresponding refractive index matching liquid uses cedar oil with a refractive index of 1.5148-1.5152.

When using the system in this embodiment to implement SPR detection, an AC signal capable of generating an AC electrokinetic effect is applied to the electrode array, and the AC electrokinetic effect (ACEK) is excited on its surface, thereby accelerating the enrichment of the substance to be tested on the electrode surface, Accelerate the immobilization speed of the substance to be measured on the surface of the functionalized electrode, thereby shortening the overall time-consuming effect of SPR detection.

Experimental example

This experimental example is based on the SPR detection system given in the examples to implement the ctDNA molecular detection of breast cancer combined with ACEK and SPR. The overall system design is shown in Figure 4. The main body of the optical system used is the R1 macroscopic angle-resolved spectrometer , which provides a test platform and is used for angle modulation of incident light and reception of reflected light. One end of it is connected with a halogen light source, and the light source is irradiated onto the test platform through the incident arm. The other end of the R1 macro angle-resolved spectrometer is connected to the spectrometer through an optical fiber, and the reflected light information is received by the spectrometer and displayed on the computer.

Before the test, the test platform needs to be adjusted horizontally through the adjustment knob of the R1 macroscopic angle-resolved spectrometer, and calibrated with a level to ensure that the platform plane is parallel to the incident arm. Then stick the customized K9 right-angle prism and the functionalized sensor chip together through the refractive index matching liquid, put it into the test device, place it on the test platform, adjust the height of the test platform and the attenuator, and find out by observing the spectral intensity. The optimal incident height of the test bench makes the light incident from the incident arm reflected by the prism and received by the reflective arm as much as possible, so as to ensure that the subsequent measurement can produce sufficient spectral response. So far, the optical system has been built. In the electrical system, the impedance analyzer is the core component, which is used to generate the AC excitation required for the ACEK effect, and at the same time collect the interface capacitance change on the surface of the sensing electrode due to the combination of the probe and ctDNA, and display it on the computer.

In this experiment, a breast cancer ctDNA molecule (sequence: 5'-AACAGCTCAAAGCAATTTCTACACGAGATCCTCTCTCTGAAATCACTGAGCAGGAG AAAGATTTTCTATGGAGTC-3') was synthesized by mutation of the E542K site of the PIK3CA gene, so as to have a complementary sequence to the above ctDNA and be modified with a sulfhydryl group (-HS ) single-stranded DNA (sequence: 5'-AGTGATTTCAGAGAG-3') as a probe; dilute 1×PBS (PH7.2-7.4) buffer to 0.05×PBS with ultrapure water, and use 0.05×PBS buffer as For the background solution of the probe, dilute the 100 μM probe stock solution to 20 μM; dilute the 20×SSC (PH7.4) buffer solution to 1×SSC with ultrapure water, and use the 1×SSC buffer solution as the background solution of ctDNA, put 100μM ctDNA stock solution was diluted into four concentration gradients of 0.01pM, 0.1pM, 1pM and 10pM; 6-mercapto-1-hexanol (6-MH) was used as a blocking solution and diluted with 0.05×PBS To 1mM; in addition, cedar oil is used as the prism refractive index matching liquid, the refractive index is 1.5148-1.5152, and the acid value is <60.

During prism-coupled SPR excitation, light is incident from one side of the prism and exits from the other side, and its optical path is shown in Figure 5. First, the incident light enters the prism through the refraction on the side of the prism, then it is totally reflected at the prism-metal film interface and stimulates the surface plasmon effect, and finally refracts through the other side of the prism and is received by the photodetector. In the prior art, a simulation experiment was carried out on the incident angle of total reflection to excite SPR in prism coupling, and it was found that when the incident angle is 70°, the spectral absorption is the most obvious, and this angle can be formulated as the optimal incident angle for surface plasmon resonance. Based on this, the incident angle of the light entering the prism and the incident angle of the light source of the R1 macroscopic angle-resolved spectrometer can be calculated. In this experimental example, a K9 isosceles rectangular prism is used as the coupling prism, and it is known that the refractive index of the K9 prism is n=1.514. According to the law of refraction of light, the relationship between the incident angle θ _in on the side of the prism, the incident angle θ _c of total reflection and the incident angle θ _R1 of the light source of the R1 macroscopic angle-resolution spectrometer is as follows:

_θin = arcsin(nsin( _θc -45°))

θ _R1 = θ _in +45°,

It can be calculated that θ _in =39.780°, θ _R1 =84.780°, which can be approximated as 85°. Therefore, 85° can be determined as the best incident angle of P1 light source.

In this example, the biosensing chip uses a K9 glass substrate as the substrate. The metal film on the substrate used to carry the substance to be tested is in the form of interdigitated electrode pairs, with a thickness of 50nm and a gap of 5μm between adjacent interdigitated fingers. The electrode length is 400um, and the strip electrode width is 5um. The specific process of surface functionalization is as follows:

①Cleaning, take a new biosensing chip with no scratches on the surface, clean the upper interdigitated electrode pair through acetone-ultrasound-ultrapure water-isopropanol-ultrasonic-ultrapure water, nitrogen Blow dry; use a multimeter to measure the resistance at both ends of the interdigitated electrode pair, and it must be above 100MΩ.

②Ultraviolet-ozone surface treatment to increase the hydrophilicity of the interdigitated electrode to the surface.

③ Fix the silicone fence on the interdigital electrode part to form a measurement chamber.

④ For DNA probe incubation, add 20 μL of DNA probe solution dropwise to the fixed silica gel fence, then place the chip in a humidifier, and incubate at a constant temperature of 5°C in an incubator for 24 hours.

⑤ Site blocking, after the probe incubation is completed, wash with buffer 2-3 times, then add 20 μL of 6-mercaptohexan-1-ol (6-MH) blocking solution dropwise, and block under constant temperature and humidity conditions for 1 Hour.

⑥ Cleaning, after sealing, wash 2-3 times with buffer solution, and the surface functionalization of interdigitated electrodes is completed.

The spectrometer used in this experiment example is Fuxiang UV-Vis spectrometer PG2000-Pro, with a wave band of 200-1100nm; R1 macroscopic angle-resolved spectrometer, the minimum rotation step angle of the turntable is 0.0012°; TH2839 impedance analyzer, test frequency: 20Hz-10MHz , When f≤2MHz, the AC voltage range is 5mVrms～2Vrms; in addition, there are matching halogen light sources and K9 glass isosceles right-angled prisms, etc.

Before the test, drop an appropriate amount of refractive index matching liquid on the surface of the K9 prism, glue the biosensing chip with the surface functionalization to the bottom of the prism, and fix it with the test device.

In the test, the biosensing chip without solution was used as a reference, the background solution was tested first, and then the test was performed sequentially according to the sample concentration gradient, and the test was repeated 3-5 times for each concentration.

After the test, the used biosensor chip was rinsed with isopropanol-ultrasound-ultrapure water, dried with nitrogen gas, and sealed for future use.

In this experiment example, in addition to the SPR test, the ACEK test will be completed using the interface capacitance data measured by the impedance analyzer. The ACEK test and the SPR test will obtain spectral data and interface capacitance data at the same time. The two data are independent and can be established. Complementary to each other, the capacitance data obtained by the impedance analyzer can reflect the concentration of the sample, and its analysis and processing methods are mostly recorded in the prior art, which will not be followed here. The SPR wavelength modulation test can obtain the relationship between the reflectance of the sample and the wavelength. Dropping different samples, because of their different refractive indices, the resonance wavelength of the SPR effect is different. At this time, the initial resonance wavelength of the ctDNA sample with different concentrations will be obtained; in ACEK Under the effect of enrichment, the probes on the surface of the interdigitated electrode pairs bind to ctDNA, and the SPR resonance wavelength will also change at this time. Different concentrations of ctDNA samples will obtain different resonance wavelengths. Spectral images after specific binding are analyzed. Polynomial fitting, finding the position of the resonance peak, analyzing the corresponding relationship between the position of the SPR resonance peak and the concentration of ctDNA, can obtain the functional expression between the two. In addition, because the spectral image contains certain noise, in this example, the least squares smoothing filtering method is also used to filter the original image.

According to the foregoing examples, it can be seen that during the SPR test of this experiment, an alternating current signal needs to be applied to the interdigitated electrode pair. The cavity is closed and buckled, and the metal contact column of the test cavity shell can be connected with the test clip of the impedance analyzer. The AC signal generated by the impedance analyzer is applied to both ends of the interdigitated electrode pair through the contact column, and is matched with the prism through the refractive index. The liquid-glued biosensing chip works based on an optical system.

In order to verify the enrichment effect of the ACEK effect on ctDNA molecules, and prove that it can indeed accelerate the combination of the electrode-to-surface probe and the molecule to be tested, and shorten the reaction time, the SPR comparison test was performed in the time series measurement mode in this experiment; among them, ctDNA at a concentration of 1pM is used as a test sample, and a biosensor chip with surface functionalization under the same conditions is used. One is used for a separate SPR sensing test and is only connected to the optical system without AC excitation; the other is connected to the optical system at the same time And the electrical system, and apply 20kHz, 100mV alternating current on the sensing electrode, other experimental conditions are the same, the test results are shown in Figure 6.

Figure 6(a) shows the timing spectrogram of the SPR sensing test without AC voltage excitation, and Figure 6(b) shows the timing spectrogram of the SPR test using the ACEK effect with AC voltage excitation. In both graphs, the difference in spectral response is the same from when the sample is added dropwise to when the binding is close to saturation, that is, when the curve becomes flat. In this process, the single SPR test time is 2500s, but after the AC excitation is added, the reaction takes only 660s. This shows that the ACEK effect has enriched ctDNA molecules, shortened the reaction time by 73.6%, and effectively improved the intermolecular binding efficiency. Secondly, although both figures show a trend that the reaction speed is faster in the early stage, then gradually slows down and finally flattens out, but the reaction speed in Figure 6(a) has been very small since 1500s and began to climb slowly, indicating that at this time The intermolecular combination of β is already very slow; while the curve in Figure 6(b) does not become flat until the last 100s, and will rise at a small rate for a period of time after that, indicating that the latter not only depends on the combination rate during the entire reaction process Increased, the final molecular binding amount will also increase. However, due to the short half-life of ctDNA molecules and the high risk of degradation due to pollution in the natural environment, it is not suitable for long-term testing, otherwise there will be large errors in the test results. It can be seen that shortening the test time is of great significance for improving the accuracy of the test .

In the prior art, the detection method based on the ACEK effect can only be judged based on the later data analysis, and because the reaction process cannot be monitored in real time, in the laboratory research, if a certain experiment fails, the problem cannot be found in time, and it is impossible to judge the cause. Either there is a problem with the applied AC current, or there is a problem with the electrode contact, or there is a problem during the functionalization of the electrode, ie the probe is not successfully incubated on the electrode surface. However, a single SPR biosensing can only rely on the free diffusion of ctDNA molecules to combine with the probes on the surface of the metal film. This process is very slow, which means that each detection will take a long time, and in this process ctDNA molecules may be invalidated by environmental pollution. In this experimental example, the combination of ACEK effect and SPR technology can not only realize rapid detection, but also monitor the molecular binding state in real time; the two methods can also be mutually verified. For the detection of the same sample, the SPR resonance measured by the optical system can The relationship between wavelength and sample concentration and the relationship between the change rate of interface capacitance measured by the electrical system and the sample concentration are analyzed together to make the detection results more reliable; in addition, when problems occur in the experiment, they can be compared with each other, making it easier to find out the problem. For example, if you are not sure whether the failure of an experiment is caused by the failure to incubate the probe on the electrode surface, you can analyze the reflection spectra of the electrodes before and after the functionalization. Needle incubation failed or the amount of probe incubated was too small to obtain a measurable signal. The combined test results of ACEK and SPR, the concentration calculated according to their respective standard equations should be within a certain range of values, if the two values are not equal, the data with higher sensitivity can be taken as the final result; if the two are calculated The results are quite different, and after repeated experimental verification, the values are still far apart, which means that one or two of the standard equations need to be further revised, which can realize the self-examination of the system and reduce the misjudgment in the sample detection.

The biosensor chip for SPR detection in this embodiment, in addition to being applied to tumor-related detection as above, can also be applied to, but not limited to, different detections such as food or drug residues. The substance to be tested in the detection can be, but not limited to, one or more of antigens and antibodies, DNA/RNA, enzymes, lipids, polypeptides, small molecular compounds or microorganisms.

The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: it can still be applied to the foregoing embodiments Modifications are made to the recorded technical solutions, or equivalent replacements are made to some or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.

Claims (10)

1. The biological sensing chip for SPR detection includes one metal film for bearing matter to be detected, and features that the metal film and the transparent medium establish one transparent medium-metal film interface for SPR detection, and the metal film is one electrode array connected to one AC signal source.

2. The biosensing chip of claim 1, wherein the thickness of the metal film is 50-100nm.

3. The biosensing chip of claim 1, wherein said metal film is in the form of an interdigitated electrode pair.

4. The biosensing chip of claim 3, wherein said pair of interdigitated electrodes comprises two sets of contact electrode portions and an interdigitated electrode portion, wherein the interdigitated electrode portion is a plurality of parallel strip-shaped electrodes, one end of each of the strip-shaped electrodes is connected to the contact electrode portion, and said contact electrode portion is connected to an ac signal source; the interdigital electrode parts connected with the two groups of electrode parts are arranged in a staggered way.

5. The biosensing chip of claim 1, wherein said metal film is plated on prisms in an SPR detection system.

6. The chip of claim 1, wherein the metal film is coated on one side of a transparent substrate, and the other side of the transparent substrate is coupled to a prism in the SPR detection system.

7. The chip of claim 6, wherein the refractive index of the transparent substrate is substantially the same as the refractive index of the prism used for the test.

8. The biosensor chip according to claim 6, wherein the transparent substrate is made of K9 glass.

9. The biosensor chip according to claim 6, wherein the transparent substrate and the prism used for the test are bonded by a refractive index coupling liquid, and the refractive index of the refractive index coupling liquid is substantially identical to that of the transparent substrate or the prism.

10. The biosensing chip of claim 1, wherein said alternating current signal source is an impedance analyzer.

Images