CN219475395U - Quick SPR detection system - Google Patents

Abstract

The utility model relates to the technical field of biological inspection and additional measurement, and particularly discloses a rapid SPR detection system, which comprises a base platform for SPR detection, wherein a lens in the base platform is coupled with a biological sensing chip; the metal film used for bearing the substance to be detected on the biological sensing chip is a metal film in the form of an electrode array; the electrode array is characterized by further comprising an alternating current signal source electrically connected with the metal film and used for applying alternating current signals capable of generating alternating current electromotive effect to the electrode array. The system solves the technical problems of inaccurate results caused by overlong biological binding reaction time in the traditional SPR detection system.

Description

Quick SPR detection system

Technical Field

The utility model belongs to the technical field of biological detection, and particularly relates to a rapid SPR detection system.

Background

Optical surface plasmon resonance (Surface Plasmon Resonance, SPR) is an optical physical phenomenon in which when a P-polarized light beam is incident on the interface between a light-transmitting medium and a metal film (Au or Ag) within a certain angular range, a surface plasmon wave is generated at the interface. When the propagation constant of the incident light wave matches that of the surface plasmon wave, free electrons in the metal film are caused to resonate, that is, surface plasmon resonance. When the SPR detection method is used for detection analysis, a layer of biomolecule recognition film is fixed on a metal film of an SPR biosensing chip, then a sample to be detected flows through the surface of the metal film, if molecules capable of interacting with the biomolecule recognition film on the surface of the metal film exist in the sample, the refractive index change of the surface of the gold film can be caused, the SPR angle change is finally caused, and the information such as the concentration, affinity, kinetic constant and specificity of an analyte can be obtained by detecting the SPR angle change.

Among the existing biomolecule detection technologies, the Surface Plasmon Resonance (SPR) detection technology has the characteristics of simple pretreatment method, no need of marking, high sensitivity, real-time dynamic detection, high automation degree, small sample consumption and the like, becomes a novel biochemical detection technology for analyzing the interaction between biomolecules, can be widely applied to the fields of immunology, proteomics, drug screening, cell signal transfer and the like, and has very good clinical development potential.

In the prior art, the SPR detection method and system mostly adopt a mode of naturally combining an object to be detected with the surface of the SPR chip to realize detection, the time is long, usually more than 2 hours, the influence of the external environment such as air temperature on the experimental result is greatly affected during the detection, and meanwhile, the solution can be evaporated for too long to cause experimental failure.

Disclosure of Invention

The utility model aims to provide a rapid SPR detection system to solve the technical problems that the biological binding reaction time is too long and the result is inaccurate in the traditional SPR detection system.

The rapid SPR detection system comprises a basic platform for SPR detection, wherein a prism in the basic platform is coupled with a biological sensing chip;

the metal film used for bearing the substance to be detected on the biological sensing chip is a metal film in the form of an electrode array;

the electrode array is characterized by further comprising an alternating current signal source electrically connected with the metal film and used for applying alternating current signals capable of generating alternating current electromotive effect to the electrode array.

Further: the thickness of the metal film is 50-100nm.

Further, the metal film is in the form of an interdigital electrode pair.

Further, the interdigital electrode pair comprises two groups of electrode parts and an interdigital electrode part, wherein the interdigital electrode part is a plurality of parallel strip-shaped electrodes, one ends of the strip-shaped electrodes are connected with the contact electrode part, and the contact electrode part is used for being connected with an alternating current signal source; the interdigital electrode parts connected with the two groups of electrode parts are arranged in a staggered way.

Further, the metal film is plated on the bottom surface of the prism.

Further, the biosensing chip comprises a transparent material substrate, the metal film is plated on one side surface of the transparent material substrate, and one side surface of the transparent material substrate opposite to the metal film is coupled on the bottom surface of the prism.

Further, the refractive index of the transparent material substrate is basically consistent with that of the prism.

Further, the prism and the transparent substrate are made of K9 glass.

Further, the transparent material substrate and the prism are bonded through an index matching liquid, and the index of refraction of the index matching liquid is basically consistent with that of the transparent material substrate or the prism.

Further, the alternating current signal source is an impedance analyzer.

When the rapid SPR detection system is used for implementing SPR detection, alternating current signals are applied to the electrode array, alternating current electric effect (ACEK) is excited on the surface of the electrode array, so that enrichment of substances to be detected on the surface of the electrode is accelerated, the fixing speed of the substances to be detected on the functionalized electrode surface is accelerated, the effect of shortening the whole time consumption of SPR detection is achieved, the problems that the biological combination reaction time is too long, the influence of the external environment such as air temperature on experimental results is greatly affected during detection, meanwhile, the solution is evaporated to cause experimental failure due to too long time are avoided, and the accuracy of SPR detection is improved.

In some embodiments of the utility model, the impedance analyzer is used as an alternating current signal source, and further concentration test based on ACEK effect (ACEK test for short) can be completed by using interface capacitance data measured by the impedance analyzer, spectral data and interface capacitance data can be obtained by the ACEK test and SPR test at the same time, the two data are independent and can be mutually supplemented, the capacitance data obtained by the impedance analyzer can reflect sample concentration, so that two test methods can mutually verify, for the same sample detection, the relationship between SPR resonance wavelength measured by an optical system and sample concentration and the relationship between interface capacitance change rate measured by an electrical system and sample concentration can be analyzed together, and the detection result is more reliable; in addition, when problems occur in the experiment, the problems can be compared with each other, and the problem can be found out more easily.

Drawings

FIG. 1 is a schematic logic diagram of a fast SPR detection system in an embodiment of the present utility model.

Fig. 2 is a schematic structural view of a metal film in the form of an electrode array in an embodiment of the present utility model.

Fig. 3 is a schematic diagram of a coupling manner between a prism and a bio-sensor chip according to an embodiment of the present utility model.

Fig. 4 is a schematic view of an optical path in an experimental example of the present utility model.

Fig. 5 is a chart of a biosensing time sequence test obtained in an experimental example of the present utility model.

Reference numerals in fig. 1 include, 01-light source, 02-R1 macroscopic angle-resolved spectrometer, 03-prism, 04-impedance analyzer, 05-fiber spectrometer, 06-computer;

reference numerals in fig. 2 include 1-contact electrode portions, 2-interdigital electrode portions.

Detailed Description

The rapid SPR detection system in this embodiment is basically as shown in FIG. 1, and is based on a typical prism coupling SPR detection base platform structure, including a light source, an R1 macroscopic angle resolution spectrum measuring instrument, a prism coupled with a biosensing chip, an optical fiber spectrometer and a computer, and in addition, an impedance analyzer is added.

And the light source is used for generating incident light with different frequencies and different powers.

The R1 macroscopic angle resolution spectrum measuring instrument is an optical platform in an SPR detection basic platform in the embodiment and is used for carrying a prism coupled with a biological sensing chip; the light source is connected to the incident end of the R1 macroscopic angle resolution spectrum measuring instrument through an optical fiber.

The optical fiber spectrometer is connected to the emergent end of the R1 macroscopic angle resolution spectrometer through an optical fiber and is used for receiving optical signals and measuring data;

the computer is connected with the optical fiber spectrometer and is used for acquiring data from the optical fiber spectrometer and processing the data.

The biosensing chip in this embodiment includes a metal film for carrying a substance to be measured.

In this embodiment, the metal film on the biosensing chip for carrying the substance to be detected is a metal film in the form of an electrode array, and in this embodiment, an impedance analyzer is electrically connected to the metal film, so as to apply an ac signal capable of generating an ac electromotive effect to the electrode array, and measure the capacitance change of the biosensing chip.

In other embodiments, an electrical instrument such as an impedance analyzer may be used to measure the change in one or more parameters such as impedance, phase, resistance, capacitance, inductance, etc. of the bio-sensor chip.

An exemplary metal film in the form of an electrode array is shown in fig. 2, and includes a contact electrode portion and an interdigital electrode portion, where the metal film is made of gold (Au) and has a thickness of 50nm to 100nm, and a pair of contact electrode portions and interdigital electrode portions are respectively disposed on the left and right sides of the metal film, where the interdigital electrode portions are a plurality of parallel strip electrodes, one ends of the strip electrodes are connected to the contact electrode portion, and the contact electrode portions are used to connect an ac signal source, and the interdigital electrodes respectively connected to the contact electrode portions on the left and right sides are staggered with each other, so as to form an interdigital electrode pair.

In some embodiments the gaps between adjacent fingers are 5um, the stripe electrode length is 400um, the stripe electrode width is 5um;

in other embodiments the gaps between adjacent fingers are 5um, the stripe electrode length 400um, the stripe electrode width 10um.

Before the metal film on the biosensing chip is used for detection, different surface modifications are needed according to different substances to be detected, namely, the biosensing chip is functionalized, and specific processes are well known to those skilled in the art and are not described in detail herein.

As shown in part (a) of fig. 3, the coupling mode of the biosensing chip and the prism can be, but not limited to, directly plating a metal film on the bottom of the prism, forming the biosensing chip by depending on the prism, directly generating a prism-metal film interface, and the mode has high sensitivity and good stability, but has poor recycling property and is not suitable for multiple use.

As shown in part (b) of fig. 3, the coupling mode between the biosensing chip and the prism may be, but not limited to, that a metal film is coated on a glass substrate with a refractive index substantially identical to that of the prism to form a biosensing chip with a base, and then the glass substrate is adhered to the bottom of the prism by the refractive index matching liquid.

In some embodiments, the prism and glass substrate are K9 with refractive index of 1.514, and the corresponding index matching fluid is a fragrance oil with refractive index of 1.5148-1.5152.

When the system in the embodiment is used for implementing SPR detection, an alternating current signal capable of generating an alternating current electrokinetic effect is applied to the electrode array, and the alternating current electrokinetic effect (ACEK) is excited on the surface of the electrode array, so that enrichment of substances to be detected on the surface of the electrode is accelerated, the fixed speed of the substances to be detected on the functionalized electrode surface is accelerated, and the effect of shortening the whole time consumption of SPR detection is achieved.

Experimental example

The experimental example is based on the SPR detection system provided in the example, and performs breast cancer ctDNA molecular detection by combining ACEK and SPR, and the main body of an optical system used in the overall system design is an R1 macroscopic angle resolution spectrum measuring instrument, which provides a test platform and is used for angle modulation of incident light and receiving reflected light. One end of the device is connected with a halogen lamp light source, the light source irradiates the test platform through an incident arm, the other end of the R1 macroscopic angle resolution spectrum measuring instrument is connected with the spectrometer through an optical fiber, and reflected light information is received through the spectrometer and displayed on a computer.

Before testing, the testing platform is required to be horizontally adjusted through an adjusting knob of the R1 macroscopic angle resolution spectrum measuring instrument, and is calibrated by a level meter, so that the plane of the platform is ensured to be parallel to an incident arm. And then adhering the customized K9 rectangular prism and the functionalized sensing chip together through the refractive index matching liquid, putting the sensing chip into a testing device, placing the sensing chip on a testing platform, adjusting the height of the testing platform and an attenuator, and finding the optimal incidence height of the testing platform by observing the spectrum intensity, so that the light incident from the incidence arm is received by the reflection arm as much as possible after being reflected by the prism, thereby ensuring that the subsequent measurement can generate enough spectral response. So far, the optical system has been built. In the electrical system, the impedance analyzer is the core component for generating the alternating current excitation required for the ACEK effect, and simultaneously, the interface capacitance change of the sensing electrode surface due to the combination of the probe and ctDNA is collected and displayed on the computer.

In this experiment, a breast cancer ctDNA molecule (sequence: 5'-AACAGCTCAAAGCAATTTCTACACGAGATCCTCTCTCTGAAATCACTGAGCAGGAG AAAGATTTTCTATGGAGTC-3') was synthesized by mutating the E542K site of the PIK3CA gene, and a single-stranded DNA (sequence: 5'-AGTGATTTCAGAGAG-3') having a complementary sequence to the ctDNA and modified at the 5' -end with a thiol (-HS) group was used as a probe; diluting 1 XPBS (pH 7.2-7.4) buffer to 0.05 XPBS with ultrapure water, and diluting 100. Mu.M probe stock solution to 20. Mu.M with 0.05 XPBS buffer as background solution of probe; diluting 20 XSSC (pH 7.4) buffer to 1 XSSC with ultrapure water, diluting 100. Mu.M ctDNA stock solution to four concentration gradients of 0.01pM, 0.1pM, 1pM and 10pM with 1 XSSC buffer as a background solution of ctDNA; 6-mercaptohex-1-ol (6-mercapto-1-hexanol, 6-MH) was used as a blocking solution and diluted to 1mM with 0.05 XPBS; in addition, cedar oil is used as a prism refractive index matching liquid, the refractive index is 1.5148-1.5152, and the acid value is less than 60.

In the prism-coupled SPR excitation process, light enters from one side of the prism and exits from the other side, and the optical path thereof is shown in fig. 4. Firstly, incident light enters the prism through the side refraction of the prism, then total reflection occurs at the prism-metal film interface and the surface plasma effect is stimulated, and finally, the incident light exits through the refraction of the other side of the prism and is received by the photoelectric detector. In the prior art, simulation experiments are carried out on the total reflection incidence angle of excitation SPR in prism coupling, and the spectrum absorption is most obvious when the incidence angle is 70 degrees, and the angle can be assumed to be the optimal incidence angle for generating surface plasmon resonance. Based on this, the incident angle of light into the prism and the incident angle of the light source of the R1 macroscopic angle-resolved spectrometer can be calculated. In this experimental example, a K9 isosceles rectangular prism was used as a coupling prism, and the refractive index n=1.514 of the K9 prism was known. Prism side incidence angle θ according to the law of refraction of light _in Incidence angle θ of total reflection _c Light source incident angle theta of spectrum measuring instrument with R1 macroscopic angle resolution _R1 The relationship between them is as follows:

θ _in ＝arcsin(nsin(θ _c -45°))

θ _R1 ＝θ _in +45°，

calculate the available theta _in ＝39.780°，θ _R1 = 84.780 °, which may be approximately 85 °. Thus, 85 ° can be determined as the optimum incident angle of the P1 light source.

In this example, the biosensing chip uses a K9 glass substrate as a base, a metal film on the base for carrying a substance to be detected is in the form of an interdigital electrode pair, the thickness is 50nm, the gap between adjacent interdigital electrodes is 5 μm, the length of a strip electrode is 400 μm, the width of the strip electrode is 5 μm, and the specific surface functionalization process is as follows:

(1) cleaning, namely taking a new biosensing chip with no scratch on the surface, cleaning an upper interdigital electrode pair of the biosensing chip by acetone-ultrasonic-ultrapure water-isopropanol-ultrasonic-ultrapure water, and drying by nitrogen; the resistance at both ends of the interdigital electrode pair is measured by a universal meter, and the resistance is required to reach more than 100MΩ.

(2) Ultraviolet-ozone surface treatment to increase the hydrophilicity of the interdigital electrode to the surface.

(3) And fixing a silica gel fence on the interdigital electrode part to form a measuring cavity.

(4) The DNA probe was incubated, 20. Mu.L of DNA probe solution was dropped into the immobilized silica gel rail, and then the chip was put into a humidifier, and incubated at a constant temperature of 5℃for 24 hours in a constant temperature oven.

(5) Site blocking, after probe incubation was completed, buffer was used for 2-3 times, and 20. Mu.L of 6-mercaptohex-1-ol (6-MH) blocking solution was added dropwise, and blocking was performed under constant temperature and humidity conditions for 1 hour.

(6) After cleaning and sealing, cleaning for 2-3 times by using buffer solution, and functionalizing the surface of the interdigital electrode.

The spectrometer used in the experimental example is a composite ultraviolet-visible spectrometer PG2000-Pro with the wave band of 200-1100 nm; the minimum rotating step angle of the turntable of the R1 macroscopic angle resolution spectrum measuring instrument is 0.0012 degrees; TH2839 impedance analyzer, test frequency: when f is less than or equal to 2MHz and is 20Hz-10MHz, the AC voltage range is 5 mVrms-2 Vrms; in addition, the device also comprises a matched halogen lamp light source, a K9 glass isosceles right triangular prism and the like.

Before testing, a proper amount of refractive index matching liquid is dripped on the surface of the K9 prism, the biosensing chip with the surface functionalized is adhered to the bottom of the prism, and the biosensing chip is fixed by a testing device.

In the test, a biosensor chip without solution dropwise added is used as a reference, background solution is tested firstly, then the test is carried out sequentially according to the concentration gradient of a sample, and the test is repeated for 3-5 times for each concentration.

After the test, the used biological sensing chip is washed by isopropanol-ultrasonic-ultrapure water, dried by nitrogen and sealed for later use.

In this experimental example, besides the SPR test, the ACEK test is completed by using the interface capacitance data measured by the impedance analyzer, and the ACEK test and the SPR test can obtain the spectrum data and the interface capacitance data at the same time, which are independent and can be mutually complemented, and the capacitance data obtained by the impedance analyzer can reflect the sample concentration, so that the analysis processing method is described in the prior art, and is not needed. The relation between the reflectivity and the wavelength of the sample can be obtained by SPR wavelength modulation test, different samples are dripped, and the resonance wavelengths generating the SPR effect are different due to the different refractive indexes, so that the initial resonance wavelengths of ctDNA samples with different concentrations can be obtained; under the enrichment effect of ACEK, the probes on the surfaces of the interdigital electrode pairs are combined with ctDNA, at the moment, SPR resonance wavelengths are changed along with the combination, different resonance wavelengths are obtained for ctDNA samples with different concentrations, polynomial fitting is carried out on spectral images after specific combination, formant positions are found, and the corresponding relation between the SPR formant positions and the ctDNA concentrations is analyzed, so that a functional expression between the SPR formant positions and the ctDNA concentrations can be obtained. In addition, because the spectrum image contains a certain amount of noise, the original spectrum is filtered by adopting a least square smoothing filtering method in the example.

According to the foregoing embodiment, in the SPR test process of the present experiment, an ac signal needs to be applied to the pair of interdigital electrodes, in the present experiment example, the biosensing chip with the surface functionalized is placed in the test cavity, the test cavity is closed and buckled, the metal contact post of the test cavity housing can be connected with the test clamp of the impedance analyzer, the ac signal generated by the impedance analyzer is applied to two ends of the pair of interdigital electrodes through the contact post, and the biosensing chip bonded together with the prism through the refractive index matching liquid works based on the optical system.

In order to verify the enrichment effect of ACEK effect on ctDNA molecules, it is proved that the method can indeed accelerate the combination of the surface probe of the electrode and the molecules to be detected, shorten the reaction time, and perform SPR contrast test in a time sequence measurement mode in the experiment; wherein ctDNA with concentration of 1pM is used as a test sample, a biosensing chip with surface functionalization under the same condition is adopted, and one biosensing chip is used for single SPR sensing test and is only connected with an optical system without alternating current excitation; the other was connected to both the optical and electrical systems and an alternating current of 20khz,100mv was applied to the sensing electrode, except that the experimental conditions were the same and the test results were as shown in fig. 5.

Fig. 5 (a) shows a timing chart of SPR sensing test alone without ac voltage excitation, and fig. 5 (b) shows a timing chart of SPR test using ACEK effect with ac voltage excitation applied. The difference in spectral response is the same from the start of the reaction with the drop of sample to the point where the binding is near saturation, i.e. the curve is flat. In this procedure, the SPR test time alone was 2500s, whereas the reaction used only 660s after AC excitation. This shows that the ACEK effect has enrichment effect on ctDNA molecules, shortens the reaction time by 73.6%, and effectively improves the intermolecular binding efficiency. Secondly, although both figures show a tendency that the early reaction speed is faster, the later gradually slows down and finally becomes gentle, the reaction speed is already small after 1500s in fig. 5 (a), and slow climbing begins, which indicates that intermolecular bonding at this time is very slow; whereas the curve in FIG. 5 (b) does not flatten until the final 100s and rises at a small rate over a period of time thereafter, indicating that the latter increases not only the binding rate but also the final amount of molecular binding throughout the reaction. However, because ctDNA molecules have a short half-life and are more susceptible to degradation due to contamination in natural environments, long-term testing is not desirable, otherwise, there is a large error in the test results, and it is significant to improve the accuracy of the test to shorten the test time.

In the prior art, the detection method based on ACEK effect can only be judged based on later data analysis, and as the reaction process cannot be monitored in real time, if a certain experiment fails in laboratory research, the problem cannot be found in time, whether the applied alternating current is problematic or the electrode is contacted, or the electrode is in a functionalization process, namely the probe is not successfully incubated on the surface of the electrode. Whereas single SPR biosensing relies only on free diffusion of ctDNA molecules, binding to probes on the surface of the metal membrane, this process is very slow, meaning that each detection takes a long time and ctDNA molecules may be disabled by environmental contamination during this process. In the experimental example, the mode of combining ACEK effect and SPR technology not only can realize rapid detection, but also can monitor the molecular binding state in real time; the two methods can also mutually verify, and for the same sample detection, the SPR resonance wavelength and sample concentration relation measured by an optical system and the interface capacitance change rate and sample concentration relation measured by an electrical system can be analyzed together, so that the detection result is more reliable; in addition, when problems occur in the experiment, the problems can be compared with each other, and the problem can be found out more easily. For example, if it is not determined whether the cause of failure of an experiment is due to failure of incubation of probes on the surface of the electrode, reflectance spectroscopy analysis can be performed on the electrode before and after functionalization, respectively, and if the front and back resonance wavelengths are the same or very different, then it is indicated that the incubation of probes failed or that the incubation amount of probes is too small to obtain a measurable signal. According to the test result of the combination of ACEK and SPR, the concentration calculated according to the respective standard equation is in a certain numerical value interval, and if the two numerical values are unequal, the data with higher sensitivity can be taken as a final result; if the calculation results of the two are larger in phase difference and the numerical values are still far in phase difference through repeated experiments, the fact that one or two standard equations need to be further corrected is indicated, so that self-checking of the system can be achieved, and misjudgment in sample detection is reduced.

The detection system in this embodiment may be applied to, but not limited to, different detection of food or drug residues, in addition to the detection of tumor. The substance to be detected may be, but is not limited to, one or more of antigen-antibody, DNA/RNA, enzyme, lipid, polypeptide, small molecule compound or microorganism.

The above embodiments are only for illustrating the technical solution of the present utility model, and are not limiting; although the utility model has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some or all of the technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit of the utility model.

Claims (10)

1. The rapid SPR detection system comprises a basic platform for SPR detection, wherein a prism in the basic platform is coupled with a biological sensing chip;

the biological sensing chip is characterized in that a metal film for bearing a substance to be detected on the biological sensing chip is a metal film in the form of an electrode array;

the electrode array is characterized by further comprising an alternating current signal source electrically connected with the metal film and used for applying alternating current signals capable of generating alternating current electromotive effect to the electrode array.

2. The system of claim 1, wherein the metal film has a thickness of 50-100nm.

3. The system of claim 1, wherein the metal film is in the form of an interdigitated electrode pair.

4. A system according to claim 3, wherein the pair of interdigitated electrodes comprises two sets of contact electrode portions and an interdigitated electrode portion, wherein the interdigitated electrode portion is a plurality of parallel strip-shaped electrodes, one end of each of the strip-shaped electrodes is connected to the contact electrode portion, and the contact electrode portion is connected to an ac signal source; the interdigital electrode parts connected with the two groups of electrode parts are arranged in a staggered way.

5. The system of claim 1, wherein the metal film is plated on the bottom surface of the prism.

6. The system of claim 1, wherein the bio-sensor chip comprises a transparent substrate, the metal film is coated on a side surface of the transparent substrate, and a side surface of the transparent substrate opposite to the metal film is coupled to the bottom surface of the prism.

7. The system of claim 6, wherein the refractive index of the transparent material substrate is substantially the same as the refractive index of the prism.

8. The system of claim 6, wherein the prism and transparent material substrate are K9 glass.

9. The system of claim 6, wherein the transparent substrate and the prism are bonded by an index matching fluid having a refractive index substantially identical to the refractive index of either the transparent substrate or the prism.

10. The system of claim 1, wherein the ac signal source is an impedance analyzer.