CN116818721A - Quick SPR detection system - Google Patents
Quick SPR detection system Download PDFInfo
- Publication number
- CN116818721A CN116818721A CN202211522218.4A CN202211522218A CN116818721A CN 116818721 A CN116818721 A CN 116818721A CN 202211522218 A CN202211522218 A CN 202211522218A CN 116818721 A CN116818721 A CN 116818721A
- Authority
- CN
- China
- Prior art keywords
- metal film
- spr detection
- detection system
- spr
- rapid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 238000001514 detection method Methods 0.000 title claims abstract description 67
- 239000002184 metal Substances 0.000 claims abstract description 52
- 229910052751 metal Inorganic materials 0.000 claims abstract description 52
- 239000000126 substance Substances 0.000 claims abstract description 13
- 238000012360 testing method Methods 0.000 claims description 44
- 239000000758 substrate Substances 0.000 claims description 16
- 239000011521 glass Substances 0.000 claims description 9
- 239000012530 fluid Substances 0.000 claims description 2
- 238000009739 binding Methods 0.000 abstract description 6
- 230000035484 reaction time Effects 0.000 abstract description 5
- 239000000523 sample Substances 0.000 description 27
- 230000000694 effects Effects 0.000 description 19
- 230000003287 optical effect Effects 0.000 description 16
- 238000001228 spectrum Methods 0.000 description 13
- 238000000034 method Methods 0.000 description 11
- 238000002474 experimental method Methods 0.000 description 10
- 239000000243 solution Substances 0.000 description 10
- 230000008859 change Effects 0.000 description 8
- 230000008878 coupling Effects 0.000 description 8
- 238000010168 coupling process Methods 0.000 description 8
- 238000005859 coupling reaction Methods 0.000 description 8
- 239000013307 optical fiber Substances 0.000 description 8
- 230000005284 excitation Effects 0.000 description 7
- 239000007788 liquid Substances 0.000 description 7
- 230000008569 process Effects 0.000 description 7
- 239000000872 buffer Substances 0.000 description 5
- 239000012780 transparent material Substances 0.000 description 5
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 description 4
- 230000027455 binding Effects 0.000 description 4
- 230000000903 blocking effect Effects 0.000 description 4
- 238000006243 chemical reaction Methods 0.000 description 4
- 238000004140 cleaning Methods 0.000 description 4
- 238000007865 diluting Methods 0.000 description 4
- 238000011534 incubation Methods 0.000 description 4
- 230000003595 spectral effect Effects 0.000 description 4
- 238000002198 surface plasmon resonance spectroscopy Methods 0.000 description 4
- 229910021642 ultra pure water Inorganic materials 0.000 description 4
- 239000012498 ultrapure water Substances 0.000 description 4
- 238000004458 analytical method Methods 0.000 description 3
- 238000010586 diagram Methods 0.000 description 3
- 238000007306 functionalization reaction Methods 0.000 description 3
- 239000010931 gold Substances 0.000 description 3
- 206010006187 Breast cancer Diseases 0.000 description 2
- 208000026310 Breast neoplasm Diseases 0.000 description 2
- 108020004414 DNA Proteins 0.000 description 2
- 108020003215 DNA Probes Proteins 0.000 description 2
- 239000003298 DNA probe Substances 0.000 description 2
- VYPSYNLAJGMNEJ-UHFFFAOYSA-N Silicium dioxide Chemical compound O=[Si]=O VYPSYNLAJGMNEJ-UHFFFAOYSA-N 0.000 description 2
- 238000005102 attenuated total reflection Methods 0.000 description 2
- 238000011109 contamination Methods 0.000 description 2
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical compound [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 description 2
- 229910052737 gold Inorganic materials 0.000 description 2
- 229910052736 halogen Inorganic materials 0.000 description 2
- 150000002367 halogens Chemical class 0.000 description 2
- 238000005259 measurement Methods 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 230000009149 molecular binding Effects 0.000 description 2
- 229910052757 nitrogen Inorganic materials 0.000 description 2
- 230000036632 reaction speed Effects 0.000 description 2
- 230000004044 response Effects 0.000 description 2
- 230000035945 sensitivity Effects 0.000 description 2
- 238000004904 shortening Methods 0.000 description 2
- 239000000741 silica gel Substances 0.000 description 2
- 229910002027 silica gel Inorganic materials 0.000 description 2
- 239000011550 stock solution Substances 0.000 description 2
- 238000006557 surface reaction Methods 0.000 description 2
- UGZAJZLUKVKCBM-UHFFFAOYSA-N 6-sulfanylhexan-1-ol Chemical compound OCCCCCCS UGZAJZLUKVKCBM-UHFFFAOYSA-N 0.000 description 1
- 102000053602 DNA Human genes 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 206010028980 Neoplasm Diseases 0.000 description 1
- 101150063858 Pik3ca gene Proteins 0.000 description 1
- 108020004682 Single-Stranded DNA Proteins 0.000 description 1
- 238000010521 absorption reaction Methods 0.000 description 1
- 239000002253 acid Substances 0.000 description 1
- 239000012491 analyte Substances 0.000 description 1
- 238000003491 array Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 239000007853 buffer solution Substances 0.000 description 1
- 238000004364 calculation method Methods 0.000 description 1
- 230000015556 catabolic process Effects 0.000 description 1
- 239000010627 cedar oil Substances 0.000 description 1
- 230000009194 climbing Effects 0.000 description 1
- 230000000295 complement effect Effects 0.000 description 1
- 239000002131 composite material Substances 0.000 description 1
- 239000008358 core component Substances 0.000 description 1
- 238000007405 data analysis Methods 0.000 description 1
- 238000006731 degradation reaction Methods 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 238000009792 diffusion process Methods 0.000 description 1
- 239000003640 drug residue Substances 0.000 description 1
- 238000001035 drying Methods 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 230000007613 environmental effect Effects 0.000 description 1
- 238000001704 evaporation Methods 0.000 description 1
- 230000008020 evaporation Effects 0.000 description 1
- 239000000835 fiber Substances 0.000 description 1
- 238000001914 filtration Methods 0.000 description 1
- 239000010794 food waste Substances 0.000 description 1
- 239000003205 fragrance Substances 0.000 description 1
- 239000003574 free electron Substances 0.000 description 1
- 238000009499 grossing Methods 0.000 description 1
- 150000002632 lipids Chemical class 0.000 description 1
- 230000007774 longterm Effects 0.000 description 1
- 239000012528 membrane Substances 0.000 description 1
- 244000005700 microbiome Species 0.000 description 1
- 239000003921 oil Substances 0.000 description 1
- 238000007747 plating Methods 0.000 description 1
- 229920001184 polypeptide Polymers 0.000 description 1
- 108090000765 processed proteins & peptides Proteins 0.000 description 1
- 102000004196 processed proteins & peptides Human genes 0.000 description 1
- 238000012545 processing Methods 0.000 description 1
- 238000003672 processing method Methods 0.000 description 1
- 238000001055 reflectance spectroscopy Methods 0.000 description 1
- 238000002310 reflectometry Methods 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000007789 sealing Methods 0.000 description 1
- 238000004088 simulation Methods 0.000 description 1
- -1 small molecule compound Chemical class 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 238000004381 surface treatment Methods 0.000 description 1
- 238000010998 test method Methods 0.000 description 1
- 150000003573 thiols Chemical class 0.000 description 1
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/17—Systems in which incident light is modified in accordance with the properties of the material investigated
- G01N21/55—Specular reflectivity
- G01N21/552—Attenuated total reflection
- G01N21/553—Attenuated total reflection and using surface plasmons
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/6825—Nucleic acid detection involving sensors
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/02—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating impedance
- G01N27/22—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating impedance by investigating capacitance
- G01N27/226—Construction of measuring vessels; Electrodes therefor
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Electrochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Investigating Or Analysing Materials By Optical Means (AREA)
Abstract
The invention relates to the technical field of biological detection, and particularly discloses a rapid SPR detection system, which comprises a biological sensing chip for SPR detection, wherein the biological sensing chip comprises a metal film for bearing a substance to be detected, a light-transmitting medium-metal film interface for SPR detection is established between the metal film and a light-transmitting medium, the metal film is in the form of an electrode array, and the electrode array is connected to an alternating current signal source. The system solves the technical problems of inaccurate results caused by overlong biological binding reaction time in the traditional SPR detection.
Description
Technical Field
The invention belongs to the technical field of biological detection, and particularly relates to a rapid SPR detection system.
Background
The biosensor chip for SPR detection in the prior art adopts a whole metal film, only allows the object to be detected to be naturally combined with the surface of the SPR chip, takes a long time, usually more than 2 hours, greatly influences experimental results due to the influence of external environments such as air temperature during detection, and meanwhile, the solution can be evaporated for too long to cause experimental failure.
Disclosure of Invention
The invention aims to provide a rapid SPR detection system to solve the technical problem that the biological binding reaction time is too long in the traditional SPR detection, so that the result is inaccurate.
The rapid SPR detection system comprises a metal film for bearing a substance to be detected, wherein a light-transmitting medium-metal film interface for SPR detection is established between the metal film and a light-transmitting medium, the metal film is in the form of an electrode array, and the electrode array is connected to an alternating current signal source.
Further, the thickness of the metal film is 50-100nm.
Further, the metal film is in the form of an interdigital electrode pair.
Further, the interdigital electrode pair comprises two groups of electrode parts and an interdigital electrode part, wherein the interdigital electrode part is a plurality of parallel strip-shaped electrodes, one ends of the strip-shaped electrodes are connected with the contact electrode part, and the contact electrode part is used for being connected with an alternating current signal source; the interdigital electrode parts connected with the two groups of electrode parts are arranged in a staggered way.
Further, the metal film is plated on a prism in the SPR detection system.
Further, the metal film is coated on one side of the transparent material substrate, and the other side of the transparent material substrate is coupled to a prism in the SPR detection system.
Further, the transparent material substrate is made of K9 glass.
Further, the transparent material substrate is bonded with the prism used for testing through an index matching liquid, and the index of refraction of the index matching liquid is basically consistent with that of the transparent material substrate or the prism.
Further, the alternating current signal source is an impedance analyzer.
The working principle and the beneficial effects of the rapid SPR detection system are that firstly, functionalization aiming at a substance to be detected is implemented on a metal film, and when SPR detection is implemented, an alternating current signal is applied to electrodes in an electrode array, and an alternating current electrokinetic effect (ACEK) is excited on the surfaces of the electrodes, so that enrichment of the substance to be detected on the surfaces of the electrodes is accelerated, the fixing speed of the substance to be detected on the functionalized surfaces of the electrodes is accelerated, the effect of shortening the whole time consumption of SPR detection is achieved, the problems that the biological combination reaction time in the traditional SPR detection system is overlong, the influence of the external environment such as air temperature on experimental results is greatly influenced during detection, meanwhile, the problem that the experiment fails due to solution evaporation is caused due to overlong time are solved, and the accuracy of SPR detection is improved.
In some embodiments of the invention, an impedance analyzer is used as an alternating current signal source, and further concentration test (abbreviated as ACEK detection) based on ACEK effect can be completed by using interface capacitance data measured by the impedance analyzer, spectral data and interface capacitance data can be obtained by the ACEK test and the SPR test simultaneously, the two data are independent and can be mutually supplemented, the capacitance data obtained by the impedance analyzer can reflect sample concentration, so that two test methods can mutually verify, and for the same sample detection, the relationship between SPR resonance wavelength measured by an optical system and sample concentration and the relationship between interface capacitance change rate measured by an electrical system and sample concentration can be analyzed together, so that a detection result is more reliable; in addition, when problems occur in the experiment, the problems can be compared with each other, and the problem can be found out more easily.
Drawings
FIG. 1 is a schematic logic diagram of a fast SPR detection system in an embodiment of the present invention.
Fig. 2 is a schematic structural view of a metal film in the form of an electrode array in an embodiment of the present invention.
FIG. 3 is a schematic diagram of a coupling mode between a prism and a biosensor chip for SPR detection according to an embodiment of the present invention.
FIG. 4 is a schematic diagram of a rapid SPR detection system according to an embodiment of the present invention.
Fig. 5 is a schematic view of an optical path in an experimental example of the present invention.
Fig. 6 is a chart of a biosensing time sequence test obtained in an experimental example of the present invention.
Reference numerals in fig. 1 include, 01-light source, 02-R1 macroscopic angle-resolved spectrometer, 03-prism, 04-impedance analyzer, 05-fiber spectrometer, 06-computer;
reference numerals in fig. 2 include 01-contact electrode portions, 02-interdigital electrode portions.
Detailed Description
The biosensing chip for SPR detection in this embodiment is applied to a rapid SPR detection system, which is basically as shown in FIG. 1, and is based on a typical prism coupling type SPR detection base platform structure, and comprises a light source, an R1 macroscopic angle resolution spectrum measuring instrument, a prism coupled with the biosensing chip for SPR detection, an optical fiber spectrometer and a computer, and an impedance analyzer is additionally arranged.
And the light source is used for generating incident light with different frequencies and different powers.
The R1 macroscopic angle resolution spectrum measuring instrument is an optical platform in an SPR detection basic platform in the embodiment and is used for carrying a prism coupled with a biological sensing chip; the light source is connected to the incident end of the R1 macroscopic angle resolution spectrum measuring instrument through an optical fiber.
The optical fiber spectrometer is connected to the emergent end of the R1 macroscopic angle resolution spectrometer through an optical fiber and is used for receiving optical signals and measuring data;
the computer is connected with the optical fiber spectrometer and is used for acquiring data from the optical fiber spectrometer and processing the data.
Optical surface plasmon resonance (Surface Plasmon Resonance, SPR) is an optical physical phenomenon in which when a P-polarized light beam is incident on the interface between a light-transmitting medium and a metal film within a certain angular range, a surface plasmon wave is generated at the interface. When the propagation constant of the incident light wave matches that of the surface plasmon wave, free electrons in the metal film are caused to resonate, that is, surface plasmon resonance. When the SPR detection method is used for detection analysis, a layer of biomolecule recognition film is fixed on a metal film of an SPR biosensing chip, then a sample to be detected flows through the surface of the metal film, if molecules capable of interacting with the biomolecule recognition film on the surface of the metal film exist in the sample, the refractive index change of the surface of the gold film can be caused, the SPR angle change is finally caused, and the information such as the concentration, affinity, kinetic constant and specificity of an analyte can be obtained by detecting the SPR angle change.
The light-transmitting medium-metal film interface for SPR detection established in this embodiment is a prism-metal film interface (Kretschmann structure), and according to the existing SPR detection technique and principles of SPR detection, it is known that in other embodiments of the present invention, it is allowed to establish various light-transmitting medium-metal film interfaces capable of generating SPR effect, such as prism-gap-metal film interface (Otto structure), optical fiber-metal film interface (optical fiber attenuated total reflection coupling), optical waveguide-metal film interface (optical waveguide attenuated total reflection coupling), etc., which are not required for the present invention, and the basic detection system corresponding to these interface arrangements is not required, but the metal films for carrying the substances to be detected in these embodiments are all metal films in the form of electrode arrays, and thus are not excluded from the scope of the present invention.
In this embodiment, the metal film on the biosensing chip for carrying the substance to be detected is a metal film in the form of an electrode array, and in this embodiment, an impedance analyzer is electrically connected to the metal film, so as to apply an ac signal capable of generating an ac electromotive effect to the electrode array, and measure the capacitance change of the biosensing chip.
In other embodiments, an electrical instrument such as an impedance analyzer may be used to measure the change in one or more parameters such as impedance, phase, resistance, capacitance, inductance, etc. of the bio-sensor chip.
An exemplary metal film in the form of an electrode array is shown in fig. 2, and includes a contact electrode portion and an interdigital electrode portion, where the metal film is made of gold (Au) and has a thickness of 50nm to 100nm, and a pair of contact electrode portions and interdigital electrode portions are respectively disposed on the left and right sides of the metal film, where the interdigital electrode portions are a plurality of parallel strip electrodes, one ends of the strip electrodes are connected to the contact electrode portion, and the contact electrode portions are used to connect an ac signal source, and the interdigital electrodes respectively connected to the contact electrode portions on the left and right sides are staggered with each other, so as to form an interdigital electrode pair.
In some embodiments the gaps between adjacent fingers are 5um, the stripe electrode length is 400um, the stripe electrode width is 5um;
in other embodiments the gaps between adjacent fingers are 5um, the stripe electrode length 400um, the stripe electrode width 10um.
Before the metal film on the biosensing chip is used for detection, different surface modifications are needed according to different substances to be detected, namely, the biosensing chip is functionalized, and specific processes are well known to those skilled in the art and are not described in detail herein.
As shown in part (a) of fig. 3, the coupling mode of the biosensing chip and the prism can be, but not limited to, directly plating a metal film on the bottom of the prism, and directly generating a prism-metal film interface by depending on the prism.
As shown in part (b) of fig. 3, the coupling mode of the biosensing chip and the lens may be, but not limited to, that a metal film is coated on a glass substrate with a refractive index substantially identical to that of the prism to form a biosensing chip with a base, then the glass substrate is adhered to the bottom of the prism through a refractive index matching liquid, the glass substrate is extended by the prism, and the glass substrate-metal film interface is a prism-metal film interface, so that the sensitivity and stability of the mode are reduced, but the chip can be reused, and the cost is greatly reduced.
In some embodiments, the lens and glass substrate are K9 with refractive index of 1.514, and the corresponding index matching fluid is a fragrance oil with refractive index of 1.5148-1.5152.
When the system in the embodiment is used for implementing SPR detection, an alternating current signal capable of generating an alternating current electrokinetic effect is applied to the electrode array, and the alternating current electrokinetic effect (ACEK) is excited on the surface of the electrode array, so that enrichment of substances to be detected on the surface of the electrode is accelerated, the fixed speed of the substances to be detected on the functionalized electrode surface is accelerated, and the effect of shortening the whole time consumption of SPR detection is achieved.
Experimental example
The experimental example is based on the SPR detection system provided in the example, and the breast cancer ctDNA molecular detection of the combination of ACEK and SPR is implemented, the whole system design is shown in fig. 4, and the main body of the used optical system is an R1 macroscopic angle resolution spectrum measuring instrument which provides a test platform and is used for angle modulation of incident light and receiving reflected light. One end of the device is connected with a halogen lamp light source, the light source irradiates the test platform through an incident arm, the other end of the R1 macroscopic angle resolution spectrum measuring instrument is connected with the spectrometer through an optical fiber, and reflected light information is received through the spectrometer and displayed on a computer.
Before testing, the testing platform is required to be horizontally adjusted through an adjusting knob of the R1 macroscopic angle resolution spectrum measuring instrument, and is calibrated by a level meter, so that the plane of the platform is ensured to be parallel to an incident arm. And then adhering the customized K9 rectangular prism and the functionalized sensing chip together through the refractive index matching liquid, putting the sensing chip into a testing device, placing the sensing chip on a testing platform, adjusting the height of the testing platform and an attenuator, and finding the optimal incidence height of the testing platform by observing the spectrum intensity, so that the light incident from the incidence arm is received by the reflection arm as much as possible after being reflected by the prism, thereby ensuring that the subsequent measurement can generate enough spectral response. So far, the optical system has been built. In the electrical system, the impedance analyzer is the core component for generating the alternating current excitation required for the ACEK effect, and simultaneously, the interface capacitance change of the sensing electrode surface due to the combination of the probe and ctDNA is collected and displayed on the computer.
In this experiment, a breast cancer ctDNA molecule (sequence: 5'-AACAGCTCAAAGCAATTTCTACACGAGATCCTCTCTCTGAAATCACTGAGCAGGAG AAAGATTTTCTATGGAGTC-3') was synthesized by mutating the E542K site of the PIK3CA gene, and a single-stranded DNA (sequence: 5'-AGTGATTTCAGAGAG-3') having a complementary sequence to the ctDNA and modified at the 5' -end with a thiol (-HS) group was used as a probe; diluting 1 XPBS (pH 7.2-7.4) buffer to 0.05 XPBS with ultrapure water, and diluting 100. Mu.M probe stock solution to 20. Mu.M with 0.05 XPBS buffer as background solution of probe; diluting 20 XSSC (pH 7.4) buffer to 1 XSSC with ultrapure water, diluting 100. Mu.M ctDNA stock solution to four concentration gradients of 0.01pM, 0.1pM, 1pM and 10pM with 1 XSSC buffer as a background solution of ctDNA; 6-mercaptohex-1-ol (6-mercapto-1-hexanol, 6-MH) was used as a blocking solution and diluted to 1mM with 0.05 XPBS; in addition, cedar oil is used as a prism refractive index matching liquid, the refractive index is 1.5148-1.5152, and the acid value is less than 60.
In the prism-coupled SPR excitation process, light enters from one side of the prism and exits from the other side, and the optical path thereof is shown in fig. 5. Firstly, incident light enters the prism through the side refraction of the prism, then total reflection occurs at the prism-metal film interface and the surface plasma effect is stimulated, and finally, the incident light exits through the refraction of the other side of the prism and is received by the photoelectric detector. In the prior art, simulation experiments are carried out on the total reflection incidence angle of excitation SPR in prism coupling, and the spectrum absorption is most obvious when the incidence angle is 70 degrees, and the angle can be assumed to be the optimal incidence angle for generating surface plasmon resonance. Based on the above, the incident angle of light entering the prism and the incident angle of the light source of the R1 macroscopic angle-resolved spectrometer can be calculated. In this experimental example, a K9 isosceles rectangular prism was used as a coupling prism, and the refractive index n=1.514 of the K9 prism was known. Prism side incidence angle θ according to the law of refraction of light in Incidence angle θ of total reflection c Light source incident angle theta of spectrum measuring instrument with R1 macroscopic angle resolution R1 The relationship between them is as follows:
θ in ＝arcsin(nsin(θ c -45°))
θ R1 ＝θ in +45°，
calculate the available theta in ＝39.780°，θ R1 = 84.780 °, which may be approximately 85 °. Thus, 85 ° can be determined as the optimum incident angle of the P1 light source.
In this example, the biosensing chip uses a K9 glass substrate as a base, a metal film on the base for carrying a substance to be detected is in the form of an interdigital electrode pair, the thickness is 50nm, the gap between adjacent interdigital electrodes is 5 μm, the length of a strip electrode is 400 μm, the width of the strip electrode is 5 μm, and the specific surface functionalization process is as follows:
(1) cleaning, namely taking a new biosensing chip with no scratch on the surface, cleaning an upper interdigital electrode pair of the biosensing chip by acetone-ultrasonic-ultrapure water-isopropanol-ultrasonic-ultrapure water, and drying by nitrogen; the resistance at both ends of the interdigital electrode pair is measured by a universal meter, and the resistance is required to reach more than 100MΩ.
(2) Ultraviolet-ozone surface treatment to increase the hydrophilicity of the interdigital electrode to the surface.
(3) And fixing a silica gel fence on the interdigital electrode part to form a measuring cavity.
(4) The DNA probe was incubated, 20. Mu.L of DNA probe solution was dropped into the immobilized silica gel rail, and then the chip was put into a humidifier, and incubated at a constant temperature of 5℃for 24 hours in a constant temperature oven.
(5) Site blocking, after probe incubation was completed, buffer was used for 2-3 times, and 20. Mu.L of 6-mercaptohex-1-ol (6-MH) blocking solution was added dropwise, and blocking was performed under constant temperature and humidity conditions for 1 hour.
(6) After cleaning and sealing, cleaning for 2-3 times by using buffer solution, and functionalizing the surface of the interdigital electrode.
The spectrometer used in the experimental example is a composite ultraviolet-visible spectrometer PG2000-Pro with the wave band of 200-1100 nm; the minimum rotating step angle of the turntable of the R1 macroscopic angle resolution spectrum measuring instrument is 0.0012 degrees; TH2839 impedance analyzer, test frequency: when f is less than or equal to 2MHz and is 20Hz-10MHz, the AC voltage range is 5 mVrms-2 Vrms; in addition, the device also comprises a matched halogen lamp light source, a K9 glass isosceles right triangular prism and the like.
Before testing, a proper amount of refractive index matching liquid is dripped on the surface of the K9 prism, the biosensing chip with the surface functionalized is adhered to the bottom of the prism, and the biosensing chip is fixed by a testing device.
In the test, a biosensor chip without solution dropwise added is used as a reference, background solution is tested firstly, then the test is carried out sequentially according to the concentration gradient of a sample, and the test is repeated for 3-5 times for each concentration.
After the test, the used biological sensing chip is washed by isopropanol-ultrasonic-ultrapure water, dried by nitrogen and sealed for later use.
In this experimental example, besides the SPR test, the ACEK test is completed by using the interface capacitance data measured by the impedance analyzer, and the ACEK test and the SPR test can obtain the spectrum data and the interface capacitance data at the same time, which are independent and can be mutually complemented, and the capacitance data obtained by the impedance analyzer can reflect the sample concentration, so that the analysis processing method is described in the prior art, and is not needed. The relation between the reflectivity and the wavelength of the sample can be obtained by SPR wavelength modulation test, different samples are dripped, and the resonance wavelengths generating the SPR effect are different due to the different refractive indexes, so that the initial resonance wavelengths of ctDNA samples with different concentrations can be obtained; under the enrichment effect of ACEK, the probes on the surfaces of the interdigital electrode pairs are combined with ctDNA, at the moment, SPR resonance wavelengths are changed along with the combination, different resonance wavelengths are obtained for ctDNA samples with different concentrations, polynomial fitting is carried out on spectral images after specific combination, formant positions are found, and the corresponding relation between the SPR formant positions and the ctDNA concentrations is analyzed, so that a functional expression between the SPR formant positions and the ctDNA concentrations can be obtained. In addition, because the spectrum image contains a certain amount of noise, the original spectrum is filtered by adopting a least square smoothing filtering method in the example.
According to the foregoing embodiment, in the SPR test process of the present experiment, an ac signal needs to be applied to the pair of interdigital electrodes, in the present experiment example, the biosensing chip with the surface functionalized is placed in the test cavity, the test cavity is closed and buckled, the metal contact post of the test cavity housing can be connected with the test clamp of the impedance analyzer, the ac signal generated by the impedance analyzer is applied to two ends of the pair of interdigital electrodes through the contact post, and the biosensing chip bonded together with the prism through the refractive index matching liquid works based on the optical system.
In order to verify the enrichment effect of ACEK effect on ctDNA molecules, it is proved that the method can indeed accelerate the combination of the surface probe of the electrode and the molecules to be detected, shorten the reaction time, and perform SPR contrast test in a time sequence measurement mode in the experiment; wherein ctDNA with concentration of 1pM is used as a test sample, a biosensing chip with surface functionalization under the same condition is adopted, and one biosensing chip is used for single SPR sensing test and is only connected with an optical system without alternating current excitation; the other was connected to both the optical and electrical systems and an alternating current of 20khz,100mv was applied to the sensing electrode, except that the experimental conditions were the same and the test results were as shown in fig. 6.
Fig. 6 (a) shows a timing chart of SPR sensing test alone without ac voltage excitation, and fig. 6 (b) shows a timing chart of SPR test using ACEK effect with ac voltage excitation applied. The difference in spectral response is the same from the start of the reaction with the drop of sample to the point where the binding is near saturation, i.e. the curve is flat. In this procedure, the SPR test time alone was 2500s, whereas the reaction used only 660s after AC excitation. This shows that the ACEK effect has enrichment effect on ctDNA molecules, shortens the reaction time by 73.6%, and effectively improves the intermolecular binding efficiency. Secondly, although both figures show a tendency that the early reaction speed is faster, the later gradually slows down and finally becomes gentle, the reaction speed is already small after 1500s in fig. 6 (a), and slow climbing begins, which indicates that intermolecular bonding at this time is very slow; whereas the curve in FIG. 6 (b) does not flatten out until the final 100s and rises at a small rate over a period of time thereafter, indicating that the latter increases not only the binding rate but also the final amount of molecular binding throughout the reaction. However, because ctDNA molecules have a short half-life and are more susceptible to degradation due to contamination in natural environments, long-term testing is not desirable, otherwise, there is a large error in the test results, and it is significant to improve the accuracy of the test to shorten the test time.
In the prior art, the detection method based on ACEK effect can only be judged based on later data analysis, and as the reaction process cannot be monitored in real time, if a certain experiment fails in laboratory research, the problem cannot be found in time, whether the applied alternating current is problematic or the electrode is contacted, or the electrode is in a functionalization process, namely the probe is not successfully incubated on the surface of the electrode. Whereas single SPR biosensing relies only on free diffusion of ctDNA molecules, binding to probes on the surface of the metal membrane, this process is very slow, meaning that each detection takes a long time and ctDNA molecules may be disabled by environmental contamination during this process. In the experimental example, the mode of combining ACEK effect and SPR technology not only can realize rapid detection, but also can monitor the molecular binding state in real time; the two methods can also mutually verify, and for the same sample detection, the SPR resonance wavelength and sample concentration relation measured by an optical system and the interface capacitance change rate and sample concentration relation measured by an electrical system can be analyzed together, so that the detection result is more reliable; in addition, when problems occur in the experiment, the problems can be compared with each other, and the problem can be found out more easily. For example, if it is not determined whether the cause of failure of an experiment is due to failure of incubation of probes on the surface of the electrode, reflectance spectroscopy analysis can be performed on the electrode before and after functionalization, respectively, and if the front and back resonance wavelengths are the same or very different, then it is indicated that the incubation of probes failed or that the incubation amount of probes is too small to obtain a measurable signal. According to the test result of the combination of ACEK and SPR, the concentration calculated according to the respective standard equation is in a certain numerical value interval, and if the two numerical values are unequal, the data with higher sensitivity can be taken as a final result; if the calculation results of the two are larger in phase difference and the numerical values are still far in phase difference through repeated experiments, the fact that one or two standard equations need to be further corrected is indicated, so that self-checking of the system can be achieved, and misjudgment in sample detection is reduced.
The biosensor chip for SPR detection in this embodiment may be applied to various detection of food or drug residues, in addition to the detection of tumor as described above. The substance to be detected may be, but is not limited to, one or more of antigen-antibody, DNA/RNA, enzyme, lipid, polypeptide, small molecule compound or microorganism.
The above embodiments are only for illustrating the technical solution of the present invention, and are not limiting; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some or all of the technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit of the invention.
Claims (10)
1. The rapid SPR detection system comprises a metal film for bearing a substance to be detected, and is characterized in that a light-transmitting medium-metal film interface for SPR detection is established between the metal film and a light-transmitting medium, the metal film is in the form of an electrode array, and the electrode array is connected to an alternating current signal source.
2. The rapid SPR detection system of claim 1, wherein the metal film has a thickness of 50-100nm.
3. The rapid SPR detection system of claim 1, wherein the metal film is in the form of an interdigitated electrode pair.
4. The rapid SPR detection system of claim 3, wherein the pair of interdigital electrodes comprises two sets of electrode parts and an interdigital electrode part, wherein the interdigital electrode part is a plurality of parallel strip electrodes, one ends of the strip electrodes are connected to the contact electrode part, and the contact electrode part is used for connecting an alternating current signal source; the interdigital electrode parts connected with the two groups of electrode parts are arranged in a staggered way.
5. The rapid SPR detection system of claim 1, wherein the metal film is plated on prisms in the SPR detection system.
6. The rapid SPR detection system of claim 1, wherein the metal film is coated on one side of a transparent substrate, and the other side of the transparent substrate is coupled to a prism in the SPR detection system.
7. The rapid SPR detection system of claim 6, wherein the refractive index of the transparent substrate is substantially identical to the refractive index of the prism used for the test.
8. The rapid SPR detection system of claim 6, wherein the transparent substrate is K9 glass.
9. The rapid SPR detection system of claim 6, wherein the transparent substrate is bonded to the prism for testing by an index matching fluid having a refractive index substantially identical to the refractive index of either the transparent substrate or the prism.
10. The rapid SPR detection system of claim 1, wherein the ac signal source is an impedance analyzer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211522218.4A CN116818721A (en) | 2022-11-30 | 2022-11-30 | Quick SPR detection system |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211522218.4A CN116818721A (en) | 2022-11-30 | 2022-11-30 | Quick SPR detection system |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116818721A true CN116818721A (en) | 2023-09-29 |
Family
ID=88117277
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211522218.4A Pending CN116818721A (en) | 2022-11-30 | 2022-11-30 | Quick SPR detection system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116818721A (en) |
-
2022
- 2022-11-30 CN CN202211522218.4A patent/CN116818721A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US4072576A (en) | Method for studying enzymatic and other biochemical reactions | |
| JP6280632B2 (en) | Device and method for accurately monitoring pH with a transparent microarray | |
| Hänel et al. | Comparison of reflectometric interference spectroscopy with other instruments for label-free optical detection | |
| Fattinger et al. | The difference interferometer: a highly sensitive optical probe for quantification of molecular surface concentration | |
| US20210063334A1 (en) | Apparatus and methods for detection of diabetes-associated molecules using electrochemical impedance spectroscopy | |
| US11714083B2 (en) | Point-of-care apparatus and methods for analyte detections using electrochemical impedance or capacitance | |
| JP2008513772A (en) | Surface plasmon resonance and quartz crystal microbalance sensor | |
| JP2018009824A (en) | Sample analysis method and sample analyzer | |
| CN107741409A (en) | A kind of cancer markers detection means and method based on slant Bragg grating | |
| TWI486584B (en) | Electric resistance type biosensor and its manufacturing method | |
| CN115096829A (en) | Optical fiber biosensor, biological detection device and detection method thereof | |
| CN219573914U (en) | A biosensing chip for SPR detects | |
| CN219475395U (en) | Quick SPR detection system | |
| US7330263B2 (en) | Measurement method and apparatus | |
| CN116818721A (en) | Quick SPR detection system | |
| CN115993348A (en) | A biosensing chip for SPR detects | |
| CN115753693A (en) | Rapid SPR detection method | |
| CN111208066B (en) | Biological detection device and method | |
| CN101393202A (en) | Evanescent wave optical fiber biosensor and use thereof | |
| CN105891466A (en) | Device and method for detecting biomolecules | |
| JP7177913B2 (en) | High-sensitivity biosensor chip, measurement system, and measurement method using high-extinction-coefficient marker and dielectric substrate | |
| Hu et al. | Design and fabrication of an angle-scanning based platform for the construction of surface plasmon resonance biosensor | |
| Chen et al. | Online pH monitoring based on a wireless electrodeless quartz crystal microbalance with dissipation | |
| TWI837817B (en) | Biological sensing system and sensing device thereof | |
| CN112881312B (en) | Detection device for simultaneously monitoring solution change and sensor solid/liquid interface change |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |