CN115992167A - Application of dry gene WOX14 in control of plant bud regeneration - Google Patents

Abstract

The invention discloses an application of a dry gene WOX14 in promoting plant bud regeneration, belonging to the technical field of plant biology. The invention discovers that the dry gene WOX14 has the application of controlling plant bud regeneration, can enable the dry gene WOX14 to be over-expressed by means of gene engineering through gene editing or over-expression, improves the bud regeneration capability in plant tissue culture, and can also reduce the bud regeneration capability of plants in tissue culture by knocking out the dry gene WOX 14.

Description

Application of dry gene WOX14 in control of plant bud regeneration

Technical Field

The invention belongs to the technical field of plant biology, and particularly relates to application of a dry gene WOX14 in promoting plant bud regeneration.

Background

Tissue culture is one of the common plant biotechnology means for achieving vegetative propagation and large-scale propagation of plants. Specifically, under the condition of aseptic culture, the plant hormone type, content and proportion in the culture medium are regulated, and the plant hormone type and the cytokinin type are mainly included, so that proper explants are induced to form embryogenic callus, the embryogenic callus is further subjected to the processes of callus proliferation, differentiation and the like to obtain high-quality regeneration buds, the regeneration buds are subjected to rooting under the action of proper growth regulators, generally high-concentration cytokinins, and a large number of regeneration seedlings are finally obtained through the steps of seedling training and the like. The acquisition of high-quality regeneration buds is a key link affecting the success and failure of plant tissue culture.

The shoot regeneration process commonly used for tissue culture requires two stages: the first step forms embryogenic callus with multipotency under the induction of high-concentration auxin, and the second step starts bud regeneration under the induction of high-concentration cytokinin. The process of shoot regeneration is related to plant stem cell activity, but is different from shoot tip meristem development and root tip meristem development, and is related to factors such as plant species, genotype, explant type, culture conditions, and growth regulators, but the specific regulatory mechanism is not yet clear. For tissue culture production, the research on the method for promoting bud regeneration has wide application value.

Genotype is an intrinsic factor affecting plant callus formation and shoot regeneration. The gene which controls the main effect of plant bud regeneration and has conserved functions is discovered, and the expression activity of the gene is controlled by genetic engineering, thus being a feasible biotechnology means for improving the plant bud regeneration capability.

WUSCHEL (WUS) -RELATED HOMEOBOX 14 (WOX 14) belongs to a HOMEOBOX gene, maintains stem cell activity of the meristematic region of Arabidopsis thaliana stem tip, WOX14 regulates plant vascular tissue Development together with its cognate gene WOX4 (Etchells J P, provost C M, mishra L, et al WOX4 and WOX14act downstream of the PXY receptor kinase to regulate plant vascular proliferation independently of any role in vascular organisation [ J ]. Development,2013,140 (10): 2224-2234.). Which physiological functions WOX14 has, whether WOX14 has a new function different from its homologous gene (e.g. WOX 4) has not yet been reported publicly.

The acquisition of high-quality regeneration buds is a key link affecting the success and failure of plant tissue culture. Even if attempts are made to adjust factors such as the type, content and proportion of phytohormones in the culture medium, it is difficult for some plants to regenerate buds. For tissue culture production, the regulation mechanism affecting bud regeneration is researched, and the regulation genes are discovered, so that the capability of bud regeneration is improved by means of genetic engineering, and the method has wide application value.

Disclosure of Invention

The invention aims at providing the application of a dry gene WOX14 in controlling plant bud regeneration.

Compared with the wild type, the invention discovers that the number of regeneration buds formed by hypocotyl explants of WOX14 over-expressed plants on a bud induction medium (SIM) is obviously increased, which indicates that WOX14 is a positive control factor for controlling the regeneration of arabidopsis buds.

According to the invention, compared with a wild type, the callus of the WOX14 over-expression plant can form regeneration buds on a culture medium without cytokinin, so that WOX14 can promote the regeneration of arabidopsis buds through a way independent of cytokinin. The overexpression of WOX14 homologous gene WOX4 or the regeneration bud phenotype of the mutant plant was not different from that of the wild type, indicating that the function of WOX14 to promote regeneration of Arabidopsis buds was specific.

The invention discovers that the deletion of the WOX14 coding gene leads to the significant reduction of the number of regeneration buds formed by the arabidopsis hypocotyl explant on a bud induction medium (SIM), and further supports the conclusion at the genetic level that WOX14 is a positive control factor for controlling the regeneration of the arabidopsis buds.

Based on the above findings, the present invention provides the use of the dryness gene WOX14 in controlling plant bud regeneration. The amino acid sequence of WOX14 protein coded by the dry gene WOX14 is shown as SEQ ID NO. 1. The control of plant bud regeneration is to increase or decrease the bud regeneration capability of the plant in tissue culture.

In some embodiments, WOX14 gene may be overexpressed by gene editing knock-in or transgenesis to achieve enhanced gene expression activity and to increase plant shoot regeneration in tissue culture.

In some embodiments, the WOX14 gene may be knocked out by gene editing or other genetic mutation methods to achieve the goal of inhibiting gene expression activity and to reduce the ability of the plant to regenerate shoots in tissue culture.

In some embodiments, the nucleotide sequence of the dry gene WOX14 is shown in SEQ ID No. 2.

In some embodiments, the plant is a plant containing the dryness gene WOX14 or a homologous gene thereof.

In some embodiments, the plant is arabidopsis thaliana.

The invention has the advantages that:

(1) The invention discovers a novel function of promoting plant bud regeneration of a homologous heteroframe gene WOX14 which is commonly conserved in higher plants.

(2) WOX14 functions to promote plant bud regeneration, a specific function that is different from its homologous gene.

(3) Current plant gene editing techniques are becoming mature and more plant genomes are sequenced, making it feasible to knock out, knock in or overexpress genes in different plants. Knocking in or over-expressing WOX14 will significantly increase the ability of the buds to regenerate during plant tissue culture, an application particularly important for plants where buds are difficult to regenerate from callus.

Drawings

FIG. 1 shows the gene expression level of WOX 4-overexpressing material. And detecting the target gene expression level of the over-expressed transgenic material by using real-time fluorescence quantitative PCR (RT-qPCR). Col-0 is wild type Arabidopsis thaliana, and is a control. WOX14 is an overexpressing transgenic material.

FIG. 2 is a graph showing the statistics of the number of regeneration shoots of WOX14 overexpressing material, WOX deletion mutant and wild-type. Col-0 is wild type Arabidopsis thaliana, and is a control. WOX14 is an overexpressing transgenic material. WOX14-1 is a WOX14 deletion mutant. WOX4-1 WOX14-1 is a double mutant of WOX4 and WOX 14. (A) phenotype map. (B) statistical graphs. Asterisks represent significant differences. The statistical method comprises the following steps: dunnett multiple comparison test, one-way anova (< 0.05, <0.01, <0.0001, < P).

FIG. 3 is the phenotype of WOX14 overexpressing material and wild-type calli in normal medium (without cytokinin). Col-0 is wild type Arabidopsis thaliana, and is a control. WOX14 is an overexpressing transgenic material.

FIG. 4 is a graph showing the statistics of regeneration bud numbers of WOX4 overexpressing material, WOX deletion mutant and wild-type. Col-0 is wild type Arabidopsis thaliana, and is a control. WOX4 is an overexpressing transgenic material. WOX4-1 is a WOX4 deletion mutant. (A) phenotype map. (B) statistical graphs. Asterisks represent significant differences. The statistical method comprises the following steps: dunnett multiple comparison test, one-way anova (< 0.05, <0.01, <0.0001, < P).

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but embodiments of the present invention are not limited thereto.

The technical means used in the following examples are conventional means well known to those skilled in the art unless otherwise indicated; the experimental methods used are all conventional and can be carried out according to the described recombinant techniques (see molecular cloning guidelines, 4 th edition, cold spring harbor laboratory Press, cold spring harbor, N.Y.); the materials, reagents, and the like used are all commercially available.

The culture medium and culture conditions used for tissue culture in the following examples are as follows, and the CIM medium formulation is: 4.4g MS base salt (vitamin; basal medium with vitamins), 0.5g/L methyl sulfonate (methylester sulfonate), 20g/L sucrose, 2.2mM 2,4-D,0.2mM kinetin and 8g/L agar, pH 5.7; the formula of the SIM culture medium is as follows: 4.4g MS base salt (containing vitamins), 0.5g/L methyl sulfonate, 20g/L sucrose, 5mM kinetin, 0.9mM indole-3-acetic acid (indole-3-acetic acid) and 8g/L agar, pH 5.7; the incubation temperature was 22℃and the photoperiod was 16h light/8 h dark.

Example 1 the shoot regeneration ability of WOX14 overexpressing plants (35S: WOX 14) was significantly enhanced compared to the wild type.

And using a 35S strong promoter to drive WOX14 to obtain the transgenic super-expression material. And carrying out regeneration bud phenotype investigation on the over-expression material.

The 35S WOX14 overexpressing plants involved in example 1 were created as follows: genomic fragments containing WOX14 coding regions were amplified by PCR and cloned into pPLV26 vector containing 35S promoter by Gibson homologous recombination (De Rybel B, van den Berg W, lokerse AS, et al, A versatile set of ligation-independent cloning vectors for functional studies in plants [ J ]. Plant physiology,2011,156 (3): 1292-1299.), and sequence fidelity was confirmed by sequencing to obtain 35S WOX14 overexpressing vector. After the vector is transformed into agrobacterium, the agrobacterium is transformed into arabidopsis by using an inflorescence dip-dyeing method, the target gene of the obtained transgenic family is detected by RT-qPCR, and finally the stable WOX14 over-expression transgenic family is obtained. The RT-qPCR detection result is shown in figure 1, and the expression level of WOX14 gene is obviously increased in WOX14 over-expression transgenic materials (figure 1).

The cloned primer sequences were:

WOX14-OE-F：5'-AGGACACGGGGCCCCCCCTCGAGATGGTAAAAAAAAAAAAGGAAAAGGAG-3'，

WOX14-OE-R：5'-TGAACGATCGGGGATCGGATCCTTAAGTCTCCATAAATTTCCCTATACTCAAC-3'。

the RT-qPCR primer sequences were as follows:

qRT-WOX14-PCF：CCGTTATTTGTGACCAACTCG，

qRT-WOX14-PCR：AAAGTATCCGCCAACCATTG。

WOX14 overexpressing transgenic material was dark cultured for 7 days, taking 1cm hypocotyl as explant. After transferring the explants to CIM medium, culture was continued for 7 days until callus formation occurred. The calli were transferred to SIM medium and cultured for 21 days. The number of regeneration shoots per explant callus was observed, photographed and counted using a Nikon SMZ745T whole microscope. Regeneration bud is defined as a meristematic structure surrounded by 3 leaves. All experimental data were collected for 3 biological replicates. The results showed that WOX14 overexpression significantly promoted the formation of regeneration buds in the SIM medium by arabidopsis hypocotyl explants (fig. 2).

Example 2 deletion of the WOX14 encoding gene resulted in a significant reduction in the number of regenerated shoots formed by arabidopsis hypocotyl explants on shoot induction medium compared to wild type.

The Arabidopsis thaliana material referred to in example 2 amounted to 3 parts. Col-0 is wild type Arabidopsis thaliana, and is a control. WOX14-1 is a WOX14 deletion mutant. WOX4-1 WOX14-1 is a double mutant of WOX4 and WOX 14. WOX4-1, WOX14-1 and WOX-1 WOX14-1 are described in detail in the literature, etchells J P, provost C M, mishra L, et al, WOX4 and WOX14act downstream of the PXY receptor kinase to regulate plant vascular proliferation independently of any role in vascular organisation [ J ]. Development,2013,140 (10): 2224-2234.

All materials were dark cultured for 7 days, and 1cm hypocotyl was taken as explant. After transferring the explants to CIM medium, culture was continued for 7 days until callus formation occurred. The calli were transferred to SIM medium and cultured for 21 days. The number of regeneration shoots per explant callus was observed, photographed and counted using a Nikon SMZ745T whole microscope. Regeneration bud is defined as a meristematic structure surrounded by 3 leaves. All experimental data were collected for 3 biological replicates. The results showed that the deletion of the WOX14 encoding gene resulted in a significant reduction in the number of regenerated shoots formed by the arabidopsis hypocotyl explants on shoot induction medium compared to the wild type (fig. 2). Taken together, WOX14 is a positive regulator controlling plant bud regeneration demonstrated from a genetic level.

Example 3 compared to wild type, calli of WOX14 overexpressing plants can form regeneration shoots on medium without cytokinin, suggesting that WOX14 can promote arabidopsis shoot regeneration by a cytokinin independent pathway.

All materials were dark cultured for 7 days, and 1cm hypocotyl was taken as explant. After transferring the explants to CIM medium, culture was continued for 7 days until callus formation occurred. The calli were transferred to normal medium (MS medium, cytokinin free) and cultured for 21 days. The number of regeneration shoots per explant callus was observed, photographed and counted using a Nikon SMZ745T whole microscope. Regeneration bud is defined as a meristematic structure surrounded by 3 leaves. All experimental data were collected for 3 biological replicates. The results showed that the calli of WOX14 overexpressing plants formed regenerated shoots even on medium without cytokinin (fig. 3), further supporting the strong shoot regeneration promoting effect of WOX14 compared to wild type.

Example 4 overexpression of WOX14 homologous gene WOX4 or regeneration shoot phenotype of mutant plants was not different from wild type, indicating that the function of WOX14 to promote regeneration of arabidopsis shoots was specific.

WOX4 over-expressed plants 35S WOX4 were prepared as described in Suer S, agusti J, sanchez P, et al WOX4im parts auxin responsiveness to cambium cells in Arabidopsis [ J ]. The Plant Cell 2011,23 (9): 3247-3259. Mutant plants WOX-1 of WOX4 were prepared as described in example 2.

All materials were dark cultured for 7 days, and 1cm hypocotyl was taken as explant. After transferring the explants to CIM medium, culture was continued for 7 days until callus formation occurred. The calli were transferred to normal medium (cytokinin-free) medium and culture continued for 21 days. The number of regeneration shoots per explant callus was observed, photographed and counted using a Nikon SMZ745T whole microscope. Regeneration bud is defined as a meristematic structure surrounded by 3 leaves. All experimental data were collected for 3 biological replicates. The results showed that the overexpression of WOX4 or the regeneration bud phenotype of the mutant plants was not different from the wild type (fig. 4), and that the function of WOX14 to promote regeneration of arabidopsis buds was specific from the side, unlike the known function of its homologous genes.

Taken together, these in vivo genetic evidence, i.e., overexpression and regenerative shoot phenotype analysis results of mutant material, indicate that WOX14 is a regulator of shoot regeneration. From the viewpoint of plant phylogenetic analysis, the invention provides an implementation method for controlling the efficiency of regeneration buds of different plant tissue culture by genetic manipulation WOX 14.

The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.

Sequence listing

<110> university of Shaanxi

Hubei Medical College

<120> application of dry gene WOX14 in controlling plant bud regeneration

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 211

<212> PRT

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 1

Met Val Lys Lys Lys Lys Glu Lys Glu Lys Ser Lys Glu Ile Glu Glu

1 5 10 15

Met Asp Arg Glu Ile Gln Asn Gly Ala Tyr Ser Gly Arg Val Met Thr

20 25 30

Glu Glu Gln Met Glu Ile Leu Arg Lys Gln Ile Ala Val Tyr Ala Val

35 40 45

Ile Cys Asp Gln Leu Val Leu Leu His Asn Ser Leu Ser Ser Tyr His

50 55 60

Pro Leu Ser Ser Gly Val Arg Pro Met Val Gly Gly Tyr Phe Asp Pro

65 70 75 80

Met Gly Ala Ser Ser Ser Ser His Arg Ile Ser Thr Arg His Arg Trp

85 90 95

Thr Pro Thr Ser Thr Gln Leu Gln Ile Leu Glu Ser Ile Tyr Asp Glu

100 105 110

Gly Ser Gly Thr Pro Asn Arg Arg Arg Ile Arg Glu Ile Ala Thr Glu

115 120 125

Leu Ser Glu His Gly Gln Ile Thr Glu Thr Asn Val Tyr Asn Trp Phe

130 135 140

Gln Asn Arg Arg Ala Arg Ser Lys Arg Lys Gln Pro Gln Thr Thr Thr

145 150 155 160

Ala Asn Gly Gln Ala Asp Asp Val Ala Val Thr Thr Glu Glu Arg Arg

165 170 175

Ser Cys Gly Asp Ser Gly Gly Leu Glu Ser Tyr Glu His Ile Leu Phe

180 185 190

Pro Ser Pro Asp Leu Gly Ile Glu His Leu Leu Ser Ile Gly Lys Phe

195 200 205

Met Glu Thr

210

<210> 2

<211> 636

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 2

atggtaaaaa aaaaaaagga aaaggagaaa agcaaagaaa tagaggagat ggatagagag 60

atccaaaacg gtgcgtatag tgggagagtg atgactgagg agcagatgga gattctccgt 120

aagcagatcg ccgtttacgc cgttatttgt gaccaactcg tcctcctcca caactccctc 180

tcttcttacc atccactctc atcaggagtg aggccaatgg ttggcggata ctttgatccg 240

atgggggcat cgtcaagttc tcataggata tcgactaggc atcggtggac tccgacttca 300

acacagcttc agatacttga gagcatttac gacgaaggaa gtggaacacc gaatcgacgg 360

aggattagag agatcgcgac ggagctgtct gaacatggac agatcacgga gacaaatgtc 420

tacaattggt ttcaaaaccg gcgagctcgg tccaaacgaa agcagcctca aacgacgaca 480

gctaatggtc aggctgacga tgtggcggtg acaacggagg aaaggaggag ttgtggagat 540

tcagggggat tagagtctta tgagcatata ctcttcccaa gtcctgactt agggattgag 600

catttgttga gtatagggaa atttatggag acttaa 636

Claims (6)

1. Dry genesWOX14Use in controlling plant bud regeneration, characterized by: said dryness geneWOX14The amino acid sequence of the coded WOX14 protein is shown as SEQ ID NO. 1; the control of plant bud regeneration is to increase or decrease the bud regeneration capability of the plant in tissue culture.

2. The use according to claim 1, characterized in that: by enhancing the dryness geneWOX14The expression activity improves the bud regeneration capability of the plant in the tissue culture process.

3. The use according to claim 1, characterized in that: by inhibition of the xerogenic genesWOX14Expression activity decreases the plant's ability to regenerate shoots in tissue culture.

4. A use according to any one of claims 1-3, characterized in that: the plant contains a dry geneWOX14Or a homologous gene thereof.

5. A use according to any one of claims 1-3, characterized in that: the plant is Arabidopsis thaliana.

6. A use according to any one of claims 1-3, characterized in that: said dryness geneWOX14The nucleotide sequence of (2) is shown as SEQ ID NO. 2.

Images