CN111826393B

CN111826393B - Gene for simultaneously regulating grain weight and resistance of rice grain type and application of encoded protein thereof

Info

Publication number: CN111826393B
Application number: CN202010772178.3A
Authority: CN
Inventors: 唐文帮; 肖云华; 张俊文; 邓化冰; 张桂莲; 陈桂华; 卢学丹; 余桂媛
Original assignee: Hunan Agricultural University
Current assignee: Hunan Agricultural University
Priority date: 2020-08-04
Filing date: 2020-08-04
Publication date: 2022-02-08
Anticipated expiration: 2040-08-04
Also published as: CN111826393A

Abstract

The invention provides a gene for simultaneously regulating and controlling grain weight and resistance of rice and application of a coding protein thereof, belonging to the technical field of genetic engineering. Application of OsPUP1 gene or coded protein OsPUP1 in regulation and control of rice grain type and/or grain weight. The OsPUP1 gene or the coded protein OsPUP1 is applied to the regulation and control of the salt tolerance andor heat resistance of rice. Experiments show that the OsPUP1 gene or the coded protein OsPUP1 influences the resistance or grain size weight of rice through negative regulation.

Description

Gene for simultaneously regulating grain weight and resistance of rice grain type and application of encoded protein thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a gene for simultaneously regulating and controlling grain weight and resistance of rice and application of a protein coded by the gene.

Background

Rice is one of the important food crops and is also a model plant for monocot research, and nearly half of the world's population takes it as staple food (Sakamoto and Matsuoka 2008). However, as the global population continues to increase and the area of cultivated land continues to decrease, maintaining a corresponding increase in rice yield has become a significant challenge. Grain weight is one of the major factors determining crop yield, and is closely related to grain shape and grain filling (Xing and Zhang 2010). Although some QTL sites and genes related to grain weight have been cloned, most functional studies on these genes are still independent of each other, the relationship between them is not clear, and most of them are related to plant hormones (Zuo and Li 2014; Li et al.2018). For example, TGW6 regulates cell number and grain length and grain weight by affecting auxin supply (Ishimaru et al 2013); BG1 increases grain by activating transport of auxin (Liu et al 2015); GL2 can augment grain by activating brassinolide signal (Che et al 2015); GW5/GSE5 also increased grain size by increasing BR signal (Duan et al.2016; Liu et al.2017). Besides auxin and brassinolide, cytokinin also has a significant effect on the regulation of grain size. The cytokinin oxidase/dehydrogenase OsCKX4 has the function of degrading cytokinin, and grains of a dominant activation mutant ren1-D become small due to the reduction of the content of cytokinin (Gao et al.2014); BG3/OsPUP4 and its homologous protein OsPUP7 increase grain by regulating cytokinin transport (Xiao et al.2018).

In fact, cytokinins play a number of essential roles in the growth and development of plants, including cell division differentiation, leaf senescence, nutrient partitioning, neoplasia formation, stress response, and auxin role and distribution, among others (Osugi and Sakakibara 2015). The cytokinin not only has an important regulation and control effect on the size and the grain number per ear of rice, but also has a very obvious regulation and control effect on stress tolerance. The interfering plants of OsAHP1 and OsAHP2, due to reduced cytokinin signaling, exhibited a range of cytokinin-deficient phenotypes including shortened internodes, increased lateral roots, premature senescence, decreased divisions , reduced fertility, and, in addition, increased sensitivity to salt (Sun et al 2014). Cytokinins in the interfering plants of OsCKX2 were increased and resistance to salt was increased (Joshi et al 2017). The promoter of the mature and stress induced expression gene SARK drives the IPT expression of the cytokinin synthesis gene, and can improve the drought resistance of rice plants (Reguera et al.2013). The high temperature can obviously reduce the cytokinin content in the high-temperature sensitive rice variety ears, and the application of exogenous cytokinin can reduce the high-temperature heat damage (Wu et al.2016; Wu et al.2017). Nevertheless, regulation of high temperature resistance of rice by cytokinin-related genes has been rarely reported.

Since cytokinins can be transported in the xylem and phloem, there should be a system for the introduction and export of cytokinins responsible for transmembrane transport in higher plants (Cedzich et al 2008; Hirose et al 2008). In Arabidopsis thaliana, the ATP-binding cassette transporter subfamily G14(ABCG14) is located on the cell membrane, is mainly expressed in the vascular tissue of roots, can transport cytokinins into the vascular tissue, and is involved in the transport of cytokinins from roots to the upper part of the ground (Ko et al 2014; Zhang et al 2014). The homologous protein of ABCG18 in rice has similar functions (ZHao et al 2005). Protein-balanced nucleotide transporters (ENT) have the ability to transport iP and tZ in the nucleoside states in yeast, and such proteins include AtENT3, AtENT6 and AtENT7 in Arabidopsis, and OsENT2 in rice (Hirose et al 2005; Hirose et al 2008). In addition, proteins of the purine permease (PUP) family are considered to be a class of proteins with the ability to transport cytokinins (Gillissen et al 2000; Burkle et al 2003; Qi and Xiong 2013; Girke et al 2014). AtPUP1 has the ability to transport adenine in yeast and is also capable of transporting cytokinins including tZ (Burkle et al 2003). Results of competitive inhibition experiments showed that AtPUP2 is also able to transport cytokinins (Burkle et al 2003). AtPUP14 also has the ability to transport cytokinins, which are localized on the cell membrane and are capable of introducing biologically active cytokinins into the cell, thereby reducing the amount of cytokinins available for recognition by membrane receptors (Zurcher et al.2016). In rice, there is also a member of the ability of OsPUP7 to transport a cytokinin derivative caffeine in yeast, and the increased cytokinin content in its related mutants suggests its potential function for transport of cytokinins (Qi and Xiong 2013). Recent research results show that the homologous protein BG3/OsPUP4 of OsPUP7 can act synergistically with the homologous protein to participate in the transport of cytokinins into vascular tissues (Xiao et al.2018). However, the OsPUP1 protein has not been reported to transport cytokinins.

Disclosure of Invention

In view of the above, the present invention aims to provide a novel application of the OsPUP1 gene or its encoded protein, and an application of the OsPUP1 gene or its encoded protein in regulation of rice grain weight and/or resistance.

The invention provides application of an OsPUP1 gene or an encoding protein OsPUP1 in regulation and control of rice grain type and/or grain weight.

Preferably, the rice grain type includes the grain width of rice.

Preferably, the OsPUP1 gene or the encoding protein OsPUP1 influences the rice grain type and/or grain weight through negative regulation.

The invention provides application of an OsPUP1 gene or an encoding protein OsPUP1 in regulation and control of rice heat resistance.

Preferably, the OsPUP1 gene or the coded protein OsPUP1 influences the heat resistance of rice through negative regulation.

The invention provides application of an OsPUP1 gene or an encoding protein OsPUP1 in regulation and control of rice salt tolerance.

Preferably, the OsPUP1 gene or the coded protein OsPUP1 influences the salt tolerance of rice through negative regulation.

Preferably, the nucleotide sequence of the OsPUP1 gene is shown as SEQ ID NO. 1.

Preferably, the amino acid sequence of the encoded protein OsPUP1 is shown in SEQ ID NO. 2.

The OsPUP1 gene or the coding protein thereof provided by the invention can be applied to regulation and control of rice grain type and/or grain weight. By constructing OsPUP1 overexpression rice, rice kernel analysis shows that compared with wild rice (WT), OsPUP1 overexpression plant (OE) shows the conditions of reduced grain width and thousand grain weight, and has positive correlation with OsPUP1 gene expression level (figure 1). The results show that OsPUP1 has significant negative regulation and control effects on grain width and grain weight.

The invention provides application of an OsPUP1 gene or an encoding protein OsPUP1 in regulation and control of rice heat resistance. After the seeds of the over-expressed OsPUP1 rice and the wild type Zhonghua 11 after budding grow for 10 days, the seeds are treated at high temperature of 45 ℃ (12h light/12 h dark), and the seeds are moved to 28 ℃ after being treated for 29h to recover the growth. And 7d, counting the survival rate of the seedlings. Compared with wild rice, the survival rate of seedlings of OsPUP1 overexpression plants (OE) after high-temperature treatment is obviously reduced. Therefore, OsPUP1 can significantly negatively regulate the heat resistance of rice.

The invention provides application of an OsPUP1 gene or an encoding protein OsPUP1 in regulation and control of rice salt tolerance. OsPUP1 overexpresses rice and wild type midflower 11, treats with Mucuna B nutrient solution containing 200mM NaCl for 45h, cultures with normal Mucuna B nutrient solution for 7d, and then counts the survival rate of seedlings. The survival rate of seedlings of OsPUP1 over-expressed rice (OE) after salt treatment was significantly reduced compared to wild-type rice. The results show that OsPUP1 can significantly negatively regulate the salt tolerance of rice.

Drawings

FIG. 1 shows the grain size weight of OsPUP1 overexpression plant, wherein A is the appearance diagram of grains; B. analyzing grain length; C. analyzing grain width; D. re-analyzing dry particles; E. analyzing the expression quantity of the OsPUP1 gene; significance analysis was performed with t-test, indicating P < 0.01;

FIG. 2 is a heat tolerance analysis of OsPUP1 overexpression plant, wherein A is before high temperature treatment; B. recovering after high-temperature treatment; C. analyzing the survival rate; significance analysis was performed with t-test, indicating P < 0.01;

FIG. 3 is a salt tolerance analysis of OsPUP1 overexpression plants; A. recovering after salt treatment; B. analyzing the survival rate; significance analysis was performed with t-test, indicating P < 0.01;

FIG. 4 shows the expression pattern of OsPUP1 in rice tissues analyzed by real-time fluorescent quantitative PCR;

FIG. 5 is an expression pattern of OsPUP1 analyzed by GUS staining; A. a whole root; B. root cross section; C. cross section of the stem; D. leaf cross section; E. cross section of glume;

FIG. 6 is a subcellular localization analysis of OsPUP1 in rice protoplasts; ER denotes the endoplasmic reticulum and BF denotes the bright field.

Detailed Description

In the invention, the nucleotide sequence of the OsPUP1 gene is shown as SEQ ID NO.1 (acccaagcagattaagctaattaactaccatcaacacaccctaatccaaaggtgccaagcttgcaggaaacagtaagctagctagcagtctagcactgcttcatttgatcatggccaccattactgctgctagtcccagacccagtgctgctcctgcagccatggaagagaccagcaaggcgatgcctactagcgagtggcctgccgccagcggcggcaatgcgtcgccgccggcgaggtcccggccgtcgctgctggtcatattcagcgcgtgcctcgtcctcctcggcgccggcgggccgctcctcctccgcgtctacttcgtgcacggcgggacccggctgtggctgtccgccacgctccagatctccggctggccgctgctgctgccgccgctgtgcgtgtcgctctaccgcggccgcaggcacgggatcggcaacctcctcctcccgcggcgcctcgtcggcgccgccgccgtgctcggcgggctgtacgccgtgtcgtgcttcgtgtacgcgctggggtcgcaggcgctgccgctgtccacgtcgtcgctgctgctggcgacgcagctggccttcaccgccgtgttcgcgttcctcttcgtgggcctccggttcacgccgttctcggccaacgccgtcgtgctgctcaccatcggcccggcggtgctgggcgtcgggccgtcgtcggggaagccggcgggggagtcctccagggcgtactggacggggttctgcgaggccatcggcgcggcggcgctagccgggctggtgatcccgctcgtcgaggtcgccacggcgaggtacgggcgccgcacggggcccgcggcgagggtgccgcctccctacgcgacggtgatgcagatgcaggcggtgatgggcgcggcgggcacggcggtgtgcgtgctcggcatggcgatcaagggcgacttccaggcggtggcgcgggaagcggcggcgttcgggctcggcgcggccaactactacctcgtcctcgcctgggacgccgtgtcgtggcagctgctcaacctgggcatcatggggctcatcacctgcgcgtcgtcgctgctcgccggcatcatgatcgccgtgctcctgccgctctcgcaggtcctcgccgtcatcttcctccacgagaagttcgacgggacgaagggcatcgcgctcgtgctctcgctctggggattcgcctcctacctctacggcgagaaggcgcagaagaagaaggaggcgcagaagatgcgcgagcgcgagcaggaggtggcgctggcacagaagaccgcagacgtggagtcagcggcgccttagtttacaatgggattgtacgtgtctacttgggtgggtcgtatacatatttacgggtgtagtgaacatgtttctcagtgtagttttacagtacagtggcatgcataaattttgtacgagattgtttcaaattctgtatgacattgtttcattatatggtactagcacgcagaaaaagcaagtgctatagttgtatcaac). The coding sequence of the OsPUP1 gene is shown as SEQ ID NO.3 (atggccaccattactgctgctagtcccagacccagtgctgctcctgcagccatggaagagaccagcaaggcgatgcctactagcgagtggcctgccgccagcggcggcaatgcgtcgccgccggcgaggtcccggccgtcgctgctggtcatattcagcgcgtgcctcgtcctcctcggcgccggcgggccgctcctcctccgcgtctacttcgtgcacggcgggacccggctgtggctgtccgccacgctccagatctccggctggccgctgctgctgccgccgctgtgcgtgtcgctctaccgcggccgcaggcacgggatcggcaacctcctcctcccgcggcgcctcgtcggcgccgccgccgtgctcggcgggctgtacgccgtgtcgtgcttcgtgtacgcgctggggtcgcaggcgctgccgctgtccacgtcgtcgctgctgctggcgacgcagctggccttcaccgccgtgttcgcgttcctcttcgtgggcctccggttcacgccgttctcggccaacgccgtcgtgctgctcaccatcggcccggcggtgctgggcgtcgggccgtcgtcggggaagccggcgggggagtcctccagggcgtactggacggggttctgcgaggccatcggcgcggcggcgctagccgggctggtgatcccgctcgtcgaggtcgccacggcgaggtacgggcgccgcacggggcccgcggcgagggtgccgcctccctacgcgacggtgatgcagatgcaggcggtgatgggcgcggcgggcacggcggtgtgcgtgctcggcatggcgatcaagggcgacttccaggcggtggcgcgggaagcggcggcgttcgggctcggcgcggccaactactacctcgtcctcgcctgggacgccgtgtcgtggcagctgctcaacctgggcatcatggggctcatcacctgcgcgtcgtcgctgctcgccggcatcatgatcgccgtgctcctgccgctctcgcaggtcctcgccgtcatcttcctccacgagaagttcgacgggacgaagggcatcgcgctcgtgctctcgctctggggattcgcctcctacctctacggcgagaaggcgcagaagaagaaggaggcgcagaagatgcgcgagcgcgagcaggaggtggcgctggcacagaagaccgcagacgtggagtcagcggcgccttag). The amino acid sequence of the encoded protein OsPUP1 is shown in SEQ ID NO.2 (MATITAASPRPSAAPAAMEETSKAMPTSEWPAASGGNASPPARSRPSLLVIFSACLVLLGAGGPLLLRVYFVHGGTRLWLSATLQISGWPLLLPPLCVSLYRGRRHGIGNLLLPRRLVGAAAVLGGLYAVSCFVYALGSQALPLSTSSLLLATQLAFTAVFAFLFVGLRFTPFSANAVVLLTIGPAVLGVGPSSGKPAGESSRAYWTGFCEAIGAAALAGLVIPLVEVATARYGRRTGPAARVPPPYATVMQMQAVMGAAGTAVCVLGMAIKGDFQAVAREAAAFGLGAANYYLVLAWDAVSWQLLNLGIMGLITCASSLLAGIMIAVLLPLSQVLAVIFLHEKFDGTKGIALVLSLWGFASYLYGEKAQKKKEAQKMREREQEVALAQKTADVESAAP).

In the invention, the rice grain width property of the rice can be obviously reduced by analyzing and counting the grain length and the grain width of rice grains over-expressing the OsPUP1 gene through the OsPUP1 gene. Meanwhile, the thousand kernel weight of rice grains over-expressing the OsPUP1 gene is subjected to statistical analysis, and the OsPUP1 gene can obviously reduce the thousand kernel weight of rice.

In the present invention, the OsPUP1 gene or the encoded protein OsPUP1 preferably affects the heat resistance of rice through a negative regulatory effect. The heat resistance is realized by treating rice at a high temperature of 45 ℃. The nucleotide sequence of the OsPUP1 gene is shown in SEQ ID NO. 1. The amino acid sequence of the coded protein OsPUP1 is shown in SEQ ID NO. 2. The coding sequence of the OsPUP1 gene is shown as SEQ ID NO. 3.

In the present invention, the OsPUP1 gene or the encoded protein OsPUP1 preferably affects the salt tolerance of rice through a negative regulatory effect. The salt tolerance is realized by treating rice with a solution containing 200mM NaCl. The nucleotide sequence of the OsPUP1 gene is shown in SEQ ID NO. 1. The amino acid sequence of the coded protein OsPUP1 is shown in SEQ ID NO. 2. The coding sequence of the OsPUP1 gene is shown as SEQ ID NO. 3.

In the invention, in order to clarify the expression condition of OsPUP1 in each tissue of rice, real-time fluorescence quantitative PCR is carried out on OsPUP1 gene, the expression level of OsPUP1 gene in each tissue of rice at the transcription level is detected, and the result shows that the OsPUP1 gene is expressed in each tissue of rice, the expression level is highest in roots, and the expression level in ears is increased along with the development of ears. Further GUS staining analysis shows that OsPUP1 is mainly expressed and functions in vascular tissues of rice. OsPUP1 was shown to be localized on the endoplasmic reticulum by subcellular localization analysis.

The following examples are provided to describe the genes and their encoded proteins that regulate rice grain weight and resistance simultaneously, but they should not be construed as limiting the scope of the present invention.

Example 1

Construction and functional verification of OsPUP1 overexpression rice plant

Construction of recombinant plant expression vector pCAMBIA2301-Actin/OsPUP1

The gene sequence, coding sequence and amino acid sequence of OsPUP1(LOC _ Os03g08880.1) were obtained from Rice database Rice Genome analysis Project (http:// Rice. plant biology. msu. edu /). Extracting total RNA of japonica rice middle flower 11, carrying out reverse transcription to obtain cDNA, and carrying out PCR amplification on a coding sequence of OsPUP1 by using the cDNA as a template and adopting the following primer sequence, wherein the reaction system is 50 mu L: mu.L of KOD FX (TOYOBO), 25. mu.L of 2 XPCRbuffer for KOD FX, 10. mu.L of 2mM dNTPs, 2.5. mu.L of 10 pM/. mu.L primer F, 2.5. mu.L of 10 pM/. mu.L primer R, 2. mu.L of cDNA template, 7. mu.L of ddH₂O; reaction procedure: pre-denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 15sec, annealing at 58 ℃ for 20sec, and extension at 68 ℃ for 120sec, and amplification was carried out for 35 cycles. The recognition sites of restriction enzymes XbaI and PstI in pCAMBIA2301-Actin are respectively introduced at two ends of the primer used for amplification (underlined)Shown), the primer sequences are as follows:

F：5'-CCGGGGATCCTCTAGAATGGCCACCATTACTGCT-3'(SEQ ID No.4)；

R：5'-AAAGCAGGGCATGCCTGCAGCTAAGGCGCCGCTGACTC-3'(SEQ ID No.5)。

the PCR product was ligated with pCAMBIA2301-Actin linear vector digested with XbaI and PstI using a homologous recombinase. The recombinant vector obtained after replacing a small fragment between the enzyme cutting sites XbaI and PstI of the pCAMBIA2300-Actin vector by the coding sequence of OsPUP1 is named as pCAMBIA2300-Actin/OsPUP 1.

II, obtaining of OsPUP1 overexpression rice plant

The recombinant plant expression vector pCAMBIA2300-Actin/OsPUP1 constructed in the first step is transferred into Agrobacterium AGL1, and then the callus of flower 11 in japonica rice variety is infected, and the specific transformation screening method is disclosed in the literature (Yili, Cao Duyun, Wang Li, which is Sr, Cheng Zhi, Tang 31066shun, Shun, Zhou Pu, Tian Wen fai, research on the frequency of agrobacterium transformed rice, Gen Xue, 2001,28(4): 352-358). Finally, the rice plant which is transferred into pCAMBIA2300-Actin/OsPUP1 is obtained. Further, by screening progeny individuals for G418 resistance, OsPUP1 overexpression inbred plants were identified.

Example 2

Grain analysis of OsPUP1 overexpression plants

OsPUP1 overexpression plants and wild type medium flowers 11 are planted under natural conditions in the field. Statistical analysis is carried out on the seed shape and grain weight of the seeds.

The results showed that OsPUP1 overexpression plants (OE) showed smaller grain width and reduced thousand kernel weight, and were positively correlated with the expression level of OsPUP1 gene, compared to wild-type rice (WT) (FIG. 1). This result indicates that OsPUP1 has significant negative regulatory effects on grain width and grain weight.

Example 3

Heat resistance analysis of OsPUP1 overexpression plant

The germinated plants with the overexpression of OsPUP1 and seeds of wild type Zhonghua 11 were sown on PCR plates and hydroponically cultured in Mucun B nutrient solution in a light incubator at 28 ℃ (12h light/12 h dark). After 10 days of growth, the cells were treated at 45 ℃ (12h light/12 h dark) for high temperature, and after 29h of treatment, the cells were removed to 28 ℃ (12h light/12 h dark) for growth recovery. And (5) after the growth is recovered for 7d, counting the survival rate of the seedlings.

The results show that the survival rate of seedlings of OsPUP1 over-expressed plants (OE) after high temperature treatment is significantly reduced compared with wild type (FIG. 2). The result shows that OsPUP1 can significantly negatively regulate the heat resistance of rice.

Example 4

Salt tolerance analysis of OsPUP1 overexpression plants

The germinated plants with the overexpression of OsPUP1 and seeds of wild type Zhonghua 11 were sown on PCR plates and hydroponically cultured in Mucun B nutrient solution in a light incubator at 28 ℃ (12h light/12 h dark). After 10 days of growth, they were treated with 200mM NaCl in Numura B nutrient solution, after 45h treatment, cultured for 7 days in normal Numura B nutrient solution, and then the survival rate of seedlings was counted.

The results show that the survival rate of seedlings of OsPUP1 over-expressed plants (OE) after salt treatment was significantly reduced compared to wild type (fig. 3). The result shows that OsPUP1 can significantly negatively regulate the salt tolerance of rice.

Example 5

Real-time fluorescent quantitative PCR analysis of OsPUP1 expression in rice tissues

The OsPUP1 gene in the embodiment is derived from rice (Oryza sativa L.), and total RNA is respectively extracted from roots, stems, leaves, leaf sheaths and ears of flowers 11 in japonica rice varieties and is subjected to reverse transcription to obtain cDNA. And then using cDNA as a template to perform real-time fluorescence quantitative PCR aiming at the OsPUP1 gene, wherein the reaction system is 20 mu L: 10 μ l TB

Premix Ex Taq^TMII (TAKARA), 1. mu.L of 10 pM/. mu.L primer F, 1. mu.L of 10 pM/. mu.L primer R, 1. mu.l cDNA template, 7. mu.l ddH₂O; PCR reaction procedure: pre-denaturation at 95 ℃ for 1min, denaturation at 95 ℃ for 5sec, annealing at 60 ℃ for 10sec, extension at 72 ℃ for 1min, amplification for 45 cycles, fluorescence collection during extension, and setting a read melting curve after reaction. The Comparative Ct method was used for data calculation. Ubiquitin2 was used as an in-PCRAnd (5) ginseng. Three biological replicates were performed for each gene amplification. Detecting the expression level of the OsPUP1 gene in each tissue of the rice at the transcription level. The experimental set-up was repeated 3 times and the results averaged.

The primer sequences for detecting the OsPUP1 gene are as follows:

qOsPUP1-F：5'-TCGCCGTCATCTTCCTCCA-3'(SEQ ID No.6)；

qOsPUP1-R：5'-CGTCTGCGGTCTTCTGTG-3'(SEQ ID No.7)。

ubiquitin2 is used as an internal reference gene, and the primer sequence is as follows:

Ubiquitin2-F：5'-GAGCCTCTGTTCGTCAAGTA-3'(SEQ ID No.8)；

Ubiquitin2-R：5'-ACTCGATGGTCCATTAAACC-3'(SEQ ID No.9)。

the relative expression level of OsPUP1 gene was calculated by taking the expression level of Ubiquitin2 as a reference.

qRT-PCR analysis shows that the OsPUP1 gene is expressed in each tissue of rice, the expression is highest in roots, and the expression level in ears is increased along with the development of ears (figure 4).

Example 6

GUS staining analysis of OsPUP1 expression in various rice tissues

Construction of recombinant plant expression vector pCAMBIA2391Z/pOsPUP1

Extracting genome DNA of japonica rice middle flower 11, and performing PCR amplification on a promoter sequence of 2091bp upstream of an initiator codon of OsPUP1 by using the genome DNA as a template and adopting the following primer sequence, wherein the reaction system is 50 mu L: mu.L of KOD FX (TOYOBO), 25. mu.L of 2 XPCRBuffer for KOD FX, 10. mu.L of 2mM dNTPs, 2.5. mu.L of 10 pM/. mu.L primer F, 2.5. mu.L of 10 pM/. mu.L primer R, 2. mu.L of cDNA template, 7. mu.L of ddH₂O; reaction procedure: pre-denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 15sec, annealing at 58 ℃ for 20sec, and extension at 68 ℃ for 120sec, and amplification was carried out for 35 cycles. The recognition sites of restriction enzymes PstI and BamHI in pCAMBIA2391Z (shown by underline) are respectively introduced at both ends of the primers used for amplification, and the sequences of the primers are as follows:

F：5'-TACGCCAAGCTTGGCTGCAGCTTCTAGGCTTCTAGCACT-3'(SEQ ID No.10)；

R：5'-GAATTCCCGGGGATCCGATCAAATGAAGCAGTGCT-3'(SEQ ID No.11)。

the PCR product was ligated with the pCAMBIA23 2391Z linear vector after digestion with PstI and BamHI using a homologous recombinase. The recombinant vector obtained after replacing a small fragment between enzyme cutting sites PstI and BamHI of the vector pCAMBIA2391Z by the promoter sequence of OsPUP1 after sequencing is named as pCAMBIA2391Z/pOsPUP 1.

Secondly, the staining analysis of beta-Glucuronidase (GUS) of each tissue of the transgenic rice plant

Transferring the recombinant plant expression vector pCAMBIA2391Z/pOsPUP1 constructed in the step one into agrobacterium AGL1, and infecting the callus of the japonica rice variety flower 11. Finally, a transgenic rice plant which is transferred into pCAMBIA2391Z/pOsPUP1 is obtained. After the positive plants were stained for roots, stems, leaves and glumes, signals were found to occur mainly in vascular tissues of each tissue (fig. 5), indicating that OsPUP1 is expressed and functions mainly in vascular tissues of rice.

Example 7

Subcellular localization analysis of OsPUP1

Extracting total RNA of japonica rice middle flower 11, carrying out reverse transcription to obtain cDNA, and carrying out PCR amplification on a coding sequence of OsPUP1 by using the cDNA as a template and adopting the following primer sequence, wherein the reaction system is 50 mu L: mu.L of KOD FX (TOYOBO), 25. mu.L of 2 XPCR buffer for KOD FX, 10. mu.L of 2mM dNTPs, 2.5. mu.L of 10 pM/. mu.L primer F, 2.5. mu.L of 10 pM/. mu.L primer R, 2. mu.L of cDNA template, 7. mu.L of ddH₂O; reaction procedure: pre-denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 15sec, annealing at 58 ℃ for 20sec, and extension at 68 ℃ for 120sec, and amplification was carried out for 35 cycles. Recognition sites of restriction enzymes BamHI and XbaI in pCAMBIA2300-35S-GFP (shown by underlining) are respectively introduced into two ends of a primer used for amplification, and the sequences of the primers are as follows:

F：5'-CAAGGAGCTCGGATCCATGGCCACCATTACTGCT-3'(SEQ ID No.12)；

R：5'-GCAGGTCGACTCTAGACTAAGGCGCCGCTGACTC-3'(SEQ ID No.13)。

the PCR product was ligated with the pCAMBIA2301-35S-GFP linear vector digested with BamHI and XbaI using a homologous recombinase. The recombinant vector obtained after replacing small fragments between enzyme cutting sites BamHI and XbaI of the pCAMBIA2301-35S-GFP vector shown by sequencing with the coding sequence of OsPUP1 is named as pCAMBIA2300-35S-GFP/OsPUP 1. Then the rice protoplast is transferred into the rice protoplast, and the protoplast is observed by a laser confocal microscope after being cultured. The results showed that when the recombinant plasmid pCAMBIA2300-35S-GFP/OsPUP1 was co-transformed with the ER-RFP plasmid, the fluorescence energy of GFP-OsPUP1 co-localized with that of ER-RFP, which confirmed that OsPUP1 was localized on the endoplasmic reticulum (FIG. 6).

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Hunan agriculture university

<120> gene for simultaneously regulating and controlling rice grain weight and resistance and application of encoding protein thereof

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1507

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

acccaagcag attaagctaa ttaactacca tcaacacacc ctaatccaaa ggtgccaagc 60

ttgcaggaaa cagtaagcta gctagcagtc tagcactgct tcatttgatc atggccacca 120

ttactgctgc tagtcccaga cccagtgctg ctcctgcagc catggaagag accagcaagg 180

cgatgcctac tagcgagtgg cctgccgcca gcggcggcaa tgcgtcgccg ccggcgaggt 240

cccggccgtc gctgctggtc atattcagcg cgtgcctcgt cctcctcggc gccggcgggc 300

cgctcctcct ccgcgtctac ttcgtgcacg gcgggacccg gctgtggctg tccgccacgc 360

tccagatctc cggctggccg ctgctgctgc cgccgctgtg cgtgtcgctc taccgcggcc 420

gcaggcacgg gatcggcaac ctcctcctcc cgcggcgcct cgtcggcgcc gccgccgtgc 480

tcggcgggct gtacgccgtg tcgtgcttcg tgtacgcgct ggggtcgcag gcgctgccgc 540

tgtccacgtc gtcgctgctg ctggcgacgc agctggcctt caccgccgtg ttcgcgttcc 600

tcttcgtggg cctccggttc acgccgttct cggccaacgc cgtcgtgctg ctcaccatcg 660

gcccggcggt gctgggcgtc gggccgtcgt cggggaagcc ggcgggggag tcctccaggg 720

cgtactggac ggggttctgc gaggccatcg gcgcggcggc gctagccggg ctggtgatcc 780

cgctcgtcga ggtcgccacg gcgaggtacg ggcgccgcac ggggcccgcg gcgagggtgc 840

cgcctcccta cgcgacggtg atgcagatgc aggcggtgat gggcgcggcg ggcacggcgg 900

tgtgcgtgct cggcatggcg atcaagggcg acttccaggc ggtggcgcgg gaagcggcgg 960

cgttcgggct cggcgcggcc aactactacc tcgtcctcgc ctgggacgcc gtgtcgtggc 1020

agctgctcaa cctgggcatc atggggctca tcacctgcgc gtcgtcgctg ctcgccggca 1080

tcatgatcgc cgtgctcctg ccgctctcgc aggtcctcgc cgtcatcttc ctccacgaga 1140

agttcgacgg gacgaagggc atcgcgctcg tgctctcgct ctggggattc gcctcctacc 1200

tctacggcga gaaggcgcag aagaagaagg aggcgcagaa gatgcgcgag cgcgagcagg 1260

aggtggcgct ggcacagaag accgcagacg tggagtcagc ggcgccttag tttacaatgg 1320

gattgtacgt gtctacttgg gtgggtcgta tacatattta cgggtgtagt gaacatgttt 1380

ctcagtgtag ttttacagta cagtggcatg cataaatttt gtacgagatt gtttcaaatt 1440

ctgtatgaca ttgtttcatt atatggtact agcacgcaga aaaagcaagt gctatagttg 1500

tatcaac 1507

<210> 2

<211> 399

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Ala Thr Ile Thr Ala Ala Ser Pro Arg Pro Ser Ala Ala Pro Ala

1 5 10 15

Ala Met Glu Glu Thr Ser Lys Ala Met Pro Thr Ser Glu Trp Pro Ala

20 25 30

Ala Ser Gly Gly Asn Ala Ser Pro Pro Ala Arg Ser Arg Pro Ser Leu

35 40 45

Leu Val Ile Phe Ser Ala Cys Leu Val Leu Leu Gly Ala Gly Gly Pro

50 55 60

Leu Leu Leu Arg Val Tyr Phe Val His Gly Gly Thr Arg Leu Trp Leu

65 70 75 80

Ser Ala Thr Leu Gln Ile Ser Gly Trp Pro Leu Leu Leu Pro Pro Leu

85 90 95

Cys Val Ser Leu Tyr Arg Gly Arg Arg His Gly Ile Gly Asn Leu Leu

100 105 110

Leu Pro Arg Arg Leu Val Gly Ala Ala Ala Val Leu Gly Gly Leu Tyr

115 120 125

Ala Val Ser Cys Phe Val Tyr Ala Leu Gly Ser Gln Ala Leu Pro Leu

130 135 140

Ser Thr Ser Ser Leu Leu Leu Ala Thr Gln Leu Ala Phe Thr Ala Val

145 150 155 160

Phe Ala Phe Leu Phe Val Gly Leu Arg Phe Thr Pro Phe Ser Ala Asn

165 170 175

Ala Val Val Leu Leu Thr Ile Gly Pro Ala Val Leu Gly Val Gly Pro

180 185 190

Ser Ser Gly Lys Pro Ala Gly Glu Ser Ser Arg Ala Tyr Trp Thr Gly

195 200 205

Phe Cys Glu Ala Ile Gly Ala Ala Ala Leu Ala Gly Leu Val Ile Pro

210 215 220

Leu Val Glu Val Ala Thr Ala Arg Tyr Gly Arg Arg Thr Gly Pro Ala

225 230 235 240

Ala Arg Val Pro Pro Pro Tyr Ala Thr Val Met Gln Met Gln Ala Val

245 250 255

Met Gly Ala Ala Gly Thr Ala Val Cys Val Leu Gly Met Ala Ile Lys

260 265 270

Gly Asp Phe Gln Ala Val Ala Arg Glu Ala Ala Ala Phe Gly Leu Gly

275 280 285

Ala Ala Asn Tyr Tyr Leu Val Leu Ala Trp Asp Ala Val Ser Trp Gln

290 295 300

Leu Leu Asn Leu Gly Ile Met Gly Leu Ile Thr Cys Ala Ser Ser Leu

305 310 315 320

Leu Ala Gly Ile Met Ile Ala Val Leu Leu Pro Leu Ser Gln Val Leu

325 330 335

Ala Val Ile Phe Leu His Glu Lys Phe Asp Gly Thr Lys Gly Ile Ala

340 345 350

Leu Val Leu Ser Leu Trp Gly Phe Ala Ser Tyr Leu Tyr Gly Glu Lys

355 360 365

Ala Gln Lys Lys Lys Glu Ala Gln Lys Met Arg Glu Arg Glu Gln Glu

370 375 380

Val Ala Leu Ala Gln Lys Thr Ala Asp Val Glu Ser Ala Ala Pro

385 390 395

<210> 3

<211> 1200

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atggccacca ttactgctgc tagtcccaga cccagtgctg ctcctgcagc catggaagag 60

accagcaagg cgatgcctac tagcgagtgg cctgccgcca gcggcggcaa tgcgtcgccg 120

ccggcgaggt cccggccgtc gctgctggtc atattcagcg cgtgcctcgt cctcctcggc 180

gccggcgggc cgctcctcct ccgcgtctac ttcgtgcacg gcgggacccg gctgtggctg 240

tccgccacgc tccagatctc cggctggccg ctgctgctgc cgccgctgtg cgtgtcgctc 300

taccgcggcc gcaggcacgg gatcggcaac ctcctcctcc cgcggcgcct cgtcggcgcc 360

gccgccgtgc tcggcgggct gtacgccgtg tcgtgcttcg tgtacgcgct ggggtcgcag 420

gcgctgccgc tgtccacgtc gtcgctgctg ctggcgacgc agctggcctt caccgccgtg 480

ttcgcgttcc tcttcgtggg cctccggttc acgccgttct cggccaacgc cgtcgtgctg 540

ctcaccatcg gcccggcggt gctgggcgtc gggccgtcgt cggggaagcc ggcgggggag 600

tcctccaggg cgtactggac ggggttctgc gaggccatcg gcgcggcggc gctagccggg 660

ctggtgatcc cgctcgtcga ggtcgccacg gcgaggtacg ggcgccgcac ggggcccgcg 720

gcgagggtgc cgcctcccta cgcgacggtg atgcagatgc aggcggtgat gggcgcggcg 780

ggcacggcgg tgtgcgtgct cggcatggcg atcaagggcg acttccaggc ggtggcgcgg 840

gaagcggcgg cgttcgggct cggcgcggcc aactactacc tcgtcctcgc ctgggacgcc 900

gtgtcgtggc agctgctcaa cctgggcatc atggggctca tcacctgcgc gtcgtcgctg 960

ctcgccggca tcatgatcgc cgtgctcctg ccgctctcgc aggtcctcgc cgtcatcttc 1020

ctccacgaga agttcgacgg gacgaagggc atcgcgctcg tgctctcgct ctggggattc 1080

gcctcctacc tctacggcga gaaggcgcag aagaagaagg aggcgcagaa gatgcgcgag 1140

cgcgagcagg aggtggcgct ggcacagaag accgcagacg tggagtcagc ggcgccttag 1200

<210> 4

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ccggggatcc tctagaatgg ccaccattac tgct 34

<210> 5

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aaagcagggc atgcctgcag ctaaggcgcc gctgactc 38

<210> 6

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tcgccgtcat cttcctcca 19

<210> 7

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cgtctgcggt cttctgtg 18

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gagcctctgt tcgtcaagta 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

actcgatggt ccattaaacc 20

<210> 10

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tacgccaagc ttggctgcag cttctaggct tctagcact 39

<210> 11

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gaattcccgg ggatccgatc aaatgaagca gtgct 35

<210> 12

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

caaggagctc ggatccatgg ccaccattac tgct 34

<210> 13

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gcaggtcgac tctagactaa ggcgccgctg actc 34

Claims

The application of OsPUP1 gene or coded protein OsPUP1 in regulation and control of rice grain type and/or grain weight, wherein the nucleotide sequence of the OsPUP1 gene is shown as SEQ ID NO. 1;

the amino acid sequence of the coding protein OsPUP1 is shown in SEQ ID NO. 2;

the rice grain type is the grain width of rice.
The application of OsPUP1 gene or coded protein OsPUP1 in regulation and control of rice heat resistance, wherein the nucleotide sequence of the OsPUP1 gene is shown as SEQ ID No. 1;

the amino acid sequence of the coded protein OsPUP1 is shown in SEQ ID NO. 2.
The application of OsPUP1 gene or coded protein OsPUP1 in regulating and controlling the salt tolerance of rice, wherein the nucleotide sequence of the OsPUP1 gene is shown as SEQ ID NO. 1;

the amino acid sequence of the coded protein OsPUP1 is shown in SEQ ID NO. 2.