CN116003545A

CN116003545A - Application of CLE41/44 small peptide in promoting plant bud regeneration and serving as plant tissue culture proliferation promoter

Info

Publication number: CN116003545A
Application number: CN202210317766.7A
Authority: CN
Inventors: 王国栋; 张勇洪; 李琛; 郑兰兰; 王京; 王雪宁
Original assignee: Shaanxi Normal University; Hubei University of Medicine
Current assignee: Shaanxi Normal University; Hubei University of Medicine
Priority date: 2022-03-29
Filing date: 2022-03-29
Publication date: 2023-04-25

Abstract

The invention discloses application of CLE41/44 small peptide in promoting plant bud regeneration and serving as a plant tissue culture proliferation promoter, belonging to the technical field of plant biology. The invention discovers that the CLE41/44 small peptide or the approximate peptide thereof has the application of promoting plant bud regeneration or serving as a plant tissue culture proliferation promoter, and can enable one or more of CLE41/44 small peptide or the approximate peptide thereof to be over-expressed by gene editing or transgene, improve the bud regeneration capability in plant tissue culture, or improve the bud regeneration capability in plant tissue culture by adding one or more of artificially synthesized CLE41/44 small peptide and KIN small peptide into a tissue culture medium.

Description

Application of CLE41/44 small peptide in promoting plant bud regeneration and serving as plant tissue culture proliferation promoter

Technical Field

The invention belongs to the technical field of plant biology, and particularly relates to a small peptide capable of regulating plant reprogramming, bud regeneration and promoting plant explant bud proliferation capacity and application of the small peptide serving as a plant tissue culture proliferation promoter.

Background

Tissue culture is one of the common plant biotechnology means for achieving vegetative propagation and large-scale propagation of plants. Specifically, under the condition of aseptic culture, the plant hormone type, content and proportion in the culture medium are regulated, and the plant hormone type and the cytokinin type are mainly included, so that proper explants are induced to form embryogenic callus, the embryogenic callus is further subjected to the processes of callus proliferation, differentiation and the like to obtain high-quality regeneration buds, the regeneration buds are subjected to rooting under the action of proper growth regulators, generally high-concentration cytokinins, and a large number of regeneration seedlings are finally obtained through the steps of seedling training and the like. The acquisition of high-quality regeneration buds is a key link affecting the success and failure of plant tissue culture.

The shoot regeneration process commonly used for tissue culture requires two stages: the first step forms embryogenic callus with multipotency under the induction of high-concentration auxin, and the second step starts bud regeneration under the induction of high-concentration cytokinin. The process of shoot regeneration is related to plant stem cell activity, but is different from shoot tip meristem development and root tip meristem development, and is related to factors such as plant species, genotype, explant type, culture conditions, and growth regulators, but the specific regulatory mechanism is not yet clear. For tissue culture production, research on novel plant regulators affecting bud regeneration has wide application value.

In addition, genotype is also an intrinsic factor affecting plant callus formation and shoot regeneration. The gene which controls the main effect of plant bud regeneration and has conserved functions is discovered, and the expression activity of the gene is controlled by genetic engineering, thus being a feasible biotechnology means for improving the plant bud regeneration capability.

Growth regulators are generally referred to as plant hormones. The CLAVATA3/EMBRYO SURROUNDING REGION-RELATED (CLE) small peptide, called CLE small peptide for short, which is a novel polypeptide plant hormone, is commonly present in higher plants. The known function of CLE small peptides is to maintain stem cell activity in plant meristematic regions, and CLV3 is clear from current studies. Arabidopsis thaliana CLE41 and CLE44 (abbreviated as CLE 41/44), also known as TRACHEARY ELEMENT DIFFERENTIATION INHIBITORY FACTOR (TDIF), are encoded by two homologous genes CLE41 (AT 3G 24770) and CLE44 (AT 4G 13195), respectively. The amino acid sequence of the mature peptide of CLE41/44 produced after translation and splicing is identical, namely HEVPSGPNPISN. Previous studies have shown that CLE41/44 controls the activity of primitive forming layer cells, affecting xylem differentiation. The artificially synthesized approximate peptide fragment "RKVPSGPDPIHN" is named KIN. KIN can perform the above-described functions of the TDIF/CLE small peptide. In addition, they have physiological functions which are not yet publicly reported.

The acquisition of high-quality regeneration buds is a key link affecting the success and failure of plant tissue culture. Phytohormones act as growth regulators and play a vital role in the shoot regeneration process. Even if attempts are made to adjust factors such as the type, content and proportion of phytohormones in the culture medium, it is difficult for some plants to regenerate buds. For tissue culture production, the research on regulation and control mechanisms affecting bud regeneration finds out regulation and control genes and develops novel plant regulators, and has wide application value.

Disclosure of Invention

The invention aims to provide application of CLE41/44 small peptide in promoting plant bud regeneration and serving as a plant tissue culture proliferation promoter.

Compared with the wild type, the invention discovers that the number of regeneration buds formed by the hypocotyl explant of the CLE41/44 over-expressed plant buds on a bud induction medium (SIM) is obviously increased, which indicates that the CLE41/44 is a positive control factor for controlling the regeneration of the Arabidopsis buds.

Compared with a control (without the externally applied small peptide), the invention discovers that the externally applied artificial CLE41/44 small peptide and the KIN small peptide obviously promote the regeneration of arabidopsis buds, and shows that the novel function of the conserved small peptide hormone for promoting the regeneration of plant buds has general significance in higher plants.

Based on the above findings, the present invention provides the use of CLE41/44 small peptide or its approximated peptide for promoting plant bud regeneration. The approximate peptide of the CLE41/44 small peptide is KIN small peptide. The promotion of plant bud regeneration is to improve the bud regeneration capability of the plant in tissue culture.

In some embodiments, one or more of the CLE41/44 small peptide or its approximated peptide encoding genes may be overexpressed by gene editing, knock-in, or transgene to enhance gene expression activity and increase shoot regeneration in tissue culture in plants.

In some embodiments, the shoot regeneration capacity of plants in tissue culture may be enhanced by adding CLE41/44 small peptides and/or KIN small peptides to the tissue culture medium.

The invention also provides application of the CLE41/44 small peptide and/or the KIN small peptide as a plant tissue culture proliferation promoter, and specifically relates to improvement of the bud regeneration capability of plants in tissue culture by adding the CLE41/44 small peptide and/or the KIN small peptide into a tissue culture medium.

The invention also provides a method for promoting plant bud regeneration in tissue culture, which is to use a tissue culture medium containing CLE41/44 small peptide and/or KIN small peptide for tissue culture.

In some embodiments, the plant is a plant comprising a gene encoding a CLE41/44 small peptide or a homologous protein thereof.

In some embodiments, the plant is arabidopsis thaliana.

In some embodiments, the amino acid sequence of the above CLE41/44 small peptide is: HEVPSGPNPISN (SEQ ID NO. 1).

In some embodiments, the amino acid sequence of the above-described small KIN peptide is: RKVPSGPDPIHN (SEQ ID NO. 2).

In some embodiments, the nucleotide sequences of the genes encoding CLE41/44 described above are each as follows:

CLE41 gene: ATGGCAACATCAAATGACCAAACCAATACTAAATCATCACATTCTCGTACTCTTCTCCTTCTCTTCATCTTCTTATCCCTCCTTCTCTTCAGTAGCCTTACAATCCCCATGACTCGTCATCAGTCCACATCTATGGTTGCTCCCTTCAAGAGGGTTCTCCTCGAATCTTCAGTTCCAGCTTCATCAACAATGGATCTACGTCCAAAGGCTAGCACACGACGCAGCCGCACTTCTAGAAGGAGAGAGTTTGGAAATGATGCTCATGAGGTTCCTAGTGGTCCAAACCCTATTTCCAACTAG (SEQ ID NO. 3);

CLE44 gene: ATGGCAACTACAATTGATCAAACCAGCATCAAGTCATTGCATTTCCATCAAGTCATCCGTTTGATCATCACAATCATCTTCTTAGCTTTCTTATTTCTCATTGGCCCTACAAGTTCCATGAATCATCACCTTCATGAATCCTCATCTAAGAACACTATGGCTCCTTCCAAGAGGTTCCTTCTACAACCTTCCACTCCATCTTCATCTACTATGAAAATGCGTCCAACAGCTCACCCTAGACGCAGTGGCACTTCTTCTTCTTCGGCGAGGAAGAGGAGGAGAGAGTTCAGAGCTGAAGCTCATGAGGTTCCAAGTGGTCCAAACCCTATCTCCAACTAG (SEQ ID NO. 4).

The invention has the advantages that:

(1) The present invention discovers a novel function of CLE41/44 in promoting plant bud regeneration.

(2) Current plant gene editing techniques are becoming mature and more plant genomes are sequenced, making it feasible to knock out, knock in or overexpress genes in different plants. Knocking in or over expressing CLE41/44 small peptide will significantly improve the ability of shoot regeneration during plant tissue culture, which application is particularly important for plants where it is difficult to regenerate shoots from calli.

(3) The artificial synthesis of CLE41/44 small peptide and KIN small peptide has the advantages that: easy to obtain, easy to store, easy to prepare and low in cost. The synthetic small peptide is used as a promoting growth regulator and added to a tissue culture medium, so that a proper amount of high-quality regeneration buds are obtained.

Drawings

FIG. 1 shows the gene expression level detection of CLE41 and CLE44 overexpressing materials. The target gene expression level of the over-expressed transgenic material was detected by real-time fluorescent quantitative PCR (RT-qPCR), and WT, 35S: CLE41 and 35S: CLE44 were over-expressed transgenic materials of wild type Arabidopsis thaliana, CLE41 and CLE44, respectively.

FIG. 2 is a graph showing the statistics of the number of regeneration shoots of CLE41 and CLE44 overexpressing materials and wild-type. Col-0 is wild type Arabidopsis thaliana, and is a control. 35S CLE41 and 35S CLE44 are over-expressed transgenic materials for CLE41 and CLE44, respectively. (A) phenotype map. (B) statistical graphs. Asterisks represent significant differences. The statistical method comprises the following steps: dunnett multiple comparison test, one-way anova (< 0.0001) P.

FIG. 3 is a graph showing statistics of the number of regenerated shoots of CLE41 overexpressing material and wild-type driven by different specific promoters. Col-0 is wild type Arabidopsis thaliana, and is a control. SUC2 CLE41 and IRX3 CLE41 are CLE41 overexpressing transgenic materials driven by the phloem-specific promoter SUC2 and xylem-specific promoter IRX3, respectively. (A) phenotype map. (B) statistical graphs. Asterisks represent significant differences. The statistical method comprises the following steps: dunnett multiple comparison test, one-way anova (< 0.0001) P.

FIG. 4 is a graph showing statistics of regeneration bud numbers after exogenous application of artificially synthesized CLE41/44 small peptide and KIN small peptide treatment. Asterisks represent significant differences. The statistical method comprises the following steps: dunnett multiple comparison test, one-way anova (< 0.05, <0.01, <0.0001, < P).

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but embodiments of the present invention are not limited thereto.

The technical means used in the following examples are conventional means well known to those skilled in the art unless otherwise indicated; the experimental methods used are all conventional and can be carried out according to the described recombinant techniques (see molecular cloning guidelines, 4 th edition, cold spring harbor laboratory Press, cold spring harbor, N.Y.); the materials, reagents, and the like used are all commercially available.

The culture medium and culture conditions used for tissue culture in the following examples are as follows, and the CIM medium formulation is: 4.4g MS base salt (vitamin; basal medium with vitamins), 0.5g/L methyl sulfonate (methylester sulfonate), 20g/L sucrose, 2.2mM 2,4-D,0.2mM kinetin and 8g/L agar, pH 5.7; the formula of the SIM culture medium is as follows: 4.4g MS basic salt (containing vitamins), 0.5g/L methyl sulfonate, 20g/L sucrose, 5 mM kinetin, 0.9mM indole-3-acetic acid (indole-3-acetic acid) and 8g/L agar, pH 5.7; the incubation temperature was 22℃and the photoperiod was 16h light/8 h dark.

Example 1 the regeneration capacity of the overexpressing plant shoots of CLE41 and CLE44 was significantly enhanced compared to the wild type.

The 35S strong promoter is used for driving CLE41 and CLE44 to obtain the transgenic super-expression material. And carrying out regeneration bud phenotype investigation on the over-expression material.

The method for creating the CLE41 and CLE44 overexpressing plants involved in example 1 was as follows: genomic fragments containing the 5 '-and 3' -regulatory elements of CLE41 and CLE44 were amplified by PCR and cloned into pPLV26 vectors containing the 35S promoter by Gibson homologous recombination (De Rybel B, van den Berg W, lokerse A S, et al A versatile set of ligation-independent cloning vectors for functional studies in plants [ J ]. Plant physiology, 2011, 156 (3): 1292-1299.), and sequence-confirmed fidelity was sequenced to obtain 35S: CLE41 and 35S: CLE44 overexpressing vectors. After the vector is transformed into agrobacterium, the agrobacterium is transformed into arabidopsis by using an inflorescence dip-dyeing method, the expression quantity of the obtained transgenic family target gene is detected by RT-qPCR, and finally stable CLE41 and CLE44 over-expression transgenic families are obtained. The RT-qPCR detection result is shown in figure 1, and the expression level of CLE41 or CLE44 genes is obviously increased in the over-expression transgenic family.

The cloned primer sequences were:

CLE41-OE-F：5'-AGGACACGGGGCCCCCCCTCGAGATGGCAACATCAAATGACCAAACCAATAC-3' ，

CLE41-OE-R：5'-TGAACGATCGGGGATCGGATCCCTAGTTGGAAATAGGGTTTGGACC-3' ；

CLE44-OE-F：5'-AGGACACGGGGCCCCCCCTCGAGATGGCAACTACAATTGATCAAACCAGC-3'，

CLE44-OE-R：5'-TGAACGATCGGGGATCGGATCCCTAGTTGGAGATAGGGTTTGGACC-3'。

the RT-qPCR primer sequences were as follows:

qRTCLE41-F： TCAAGAGGGTTCTCCTCGAA，

qRTCLE41-R： TGTGCTAGCCTTTGGACGTA；

qRTCLE44-F： TTTGGACCACTTGGAACCTC，

qRTCLE44-R： ACGCAGTGGCACTTCTTCTT。

all genetic material was dark cultured for 7 days, and 1cm hypocotyl was taken as explant. After transferring the explants to CIM medium, culture was continued for 7 days until callus formation occurred. The calli were transferred to SIM medium and cultured for 21 days. The number of regeneration shoots per explant callus was observed, photographed and counted using a Nikon SMZ745T whole microscope. Regeneration bud is defined as a meristematic structure surrounded by 3 leaves. All experimental data were collected for 3 biological replicates. The results showed that the overexpression of CLE41 and CLE44 genes significantly promoted the formation of regeneration buds of arabidopsis hypocotyl explants on SIM medium (fig. 2).

Example 2 compared to wild type, the shoot regeneration ability of phloem tissue-specific CLE41 overexpressing plants and xylem tissue-specific CLE41 overexpressing plants was significantly enhanced.

The regeneration bud phenotype investigation is carried out by utilizing a CLE41 overexpression transgenic material driven by a phloem tissue specific promoter SUC2 (SUC 2: CLE 41) and a CLE41 overexpression transgenic material driven by a xylem specific promoter IRX3 (IRX 3: CLE 41), whether the regeneration bud phenotype investigation can be carried out by researching whether the tissue specific driven CLE41 overexpression (ectopic expression) can effectively promote the bud regeneration capability to be obviously enhanced or not is carried out, and therefore, evidence is provided for carrying out genetic engineering by utilizing the CLE41/44 to promote the plant bud regeneration.

The construction of the overexpression vectors SUC2:CLE41 and IRX3:CLE41 referred to in example 2 is described in the literature: etchells J P, turner S R. The PXY-CLE41 receptor ligand pair defines a multifunctional pathway that controls The rate and orientation of vascular cell division [ J ]. Development, 2010, 137 (5): 767-774. An overexpressed transgenic line was obtained according to the method in example 1.

All materials were dark cultured for 7 days, and 1cm hypocotyl was taken as explant. After transferring the explants to CIM medium, culture was continued for 7 days until callus formation occurred. The calli were transferred to SIM medium and cultured for 21 days. The number of regeneration shoots per explant callus was observed, photographed and counted using a Nikon SMZ745T whole microscope. Regeneration bud is defined as a meristematic structure surrounded by 3 leaves. All experimental data were collected for 3 biological replicates. The results showed that tissue-specific overexpression of CLE41 gene significantly promoted the formation of regeneration buds of arabidopsis hypocotyl explants on SIM medium (fig. 3).

The results of examples 1 and 2 demonstrate that genetic engineering using CLE41/44 can promote plant bud regeneration.

Example 3 exogenous application of an artificially synthesized CLE41/44 small peptide, KIN small peptide also promoted regeneration of arabidopsis sprouts.

The amino acid sequence of the mature peptide fragment of Arabidopsis CLE41/44 is identical, namely 'HEVPSGPNPISN', and can be obtained by artificial synthesis. The sequence of the artificially synthesized approximate peptide fragment KIN is "RKVPSGPDPIHN". Previous studies have shown that KIN can function to regulate the cambium cell fate of small TDIF/CLE peptides. The genetic evidence described above shows that the cumulative levels of CLE41/44 in Arabidopsis thaliana (plants) are positively correlated with shoot regeneration capacity. Thus, in theory, the application of artificial synthetic small peptides inside and outside the SIM medium will promote the regeneration capacity of wild type Arabidopsis sprouts.

Based on this, wild type Arabidopsis seedlings were dark-cultured for 7 days, and 1cm hypocotyl was taken as an explant. After transferring the explants to CIM medium, culture was continued for 7 days until callus formation occurred. The calli were transferred to SIM medium containing different concentrations of synthetic small peptides (10 μm) and cultured for a further 21 days. The number of regeneration shoots per explant callus was observed, photographed and counted using a Nikon SMZ745T whole microscope. Regeneration bud is defined as a meristematic structure surrounded by 3 leaves. All experimental data were collected for 3 biological replicates. The results showed that exogenous application of the artificially synthesized CLE41/44 small peptide, KIN small peptide significantly promoted arabidopsis shoot regeneration (fig. 4). Thus, the shoot regeneration capacity of plants in tissue culture can be enhanced by adding synthetic CLE41/44 small peptides and KIN small peptides to the tissue culture medium.

Taken together, these in vivo genetic evidence, i.e., the results of regeneration shoot phenotyping of the overexpressing material and the external application of the CLE41/44 small peptide, suggest that CLE41/44 small peptide is a regulator of shoot regeneration. Their amino acid sequences are evolutionarily conserved in higher plants. From the aspect of plant phylogenetic analysis, the invention provides an implementation method for improving the efficiency of regeneration buds of different plant tissue culture by genetic manipulation and external application of artificial synthetic CLE41/44 small peptide.

The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.

Claims

Use of cle41/44 small peptide or a similar peptide thereof for promoting plant bud regeneration, characterized in that: the amino acid sequence of the CLE41/44 small peptide is as follows: HEVPSGPNPISN; the approximate peptide of the CLE41/44 small peptide is KIN small peptide, and the amino acid sequence is as follows: RKVPSGPDPIHN.
2. The use according to claim 1, characterized in that: by enhancing the expression activity of one or more of CLE41/44 small peptide or its similar peptide coding genes, the bud regeneration capacity of plants in tissue culture is improved.
3. The use according to claim 1, characterized in that: the shoot regeneration capacity of plants in tissue culture is enhanced by adding CLE41/44 small peptide/or KIN small peptide to the tissue culture medium.
Use of cle41/44 small peptide or its approximated peptide small peptide as a plant tissue culture proliferation regulator, characterized in that: the amino acid sequence of the CLE41/44 small peptide is as follows: HEVPSGPNPISN; the approximate peptide of the CLE41/44 small peptide is KIN small peptide, and the amino acid sequence is as follows: RKVPSGPDPIHN.
5. The use according to claim 4, characterized in that: the shoot regeneration capacity of plants in tissue culture is enhanced by adding CLE41/44 small peptide/or KIN small peptide to the tissue culture medium.
6. A method for promoting shoot regeneration in tissue culture in a plant, characterized by: for tissue culture using tissue culture medium containing CLE41/44 small peptide and/or KIN small peptide.
7. The use according to any one of claims 1-5 or the method according to claim 6, characterized in that: the plant is a plant containing CLE41/44 small peptide or homologous protein coding genes thereof.
8. The use according to any one of claims 1-5 or the method according to claim 6, characterized in that: the plant is Arabidopsis thaliana.
9. The use according to any one of claims 1-5 or the method according to claim 6, characterized in that: the nucleotide sequences of the encoding genes of the CLE41/44 small peptide are respectively as follows:

CLE41 gene: the nucleotide sequence is shown as SEQ ID NO. 3;

CLE44 gene: the nucleotide sequence is shown as SEQ ID NO. 4.