CN115992166A - Application of CLE42 small peptide in promoting plant bud regeneration and serving as plant tissue culture proliferation promoter - Google Patents

Abstract

The invention discloses application of CLE42 small peptide in controlling plant bud regeneration and serving as a plant tissue culture proliferation regulator, and belongs to the technical field of plant biology. The invention discovers that the CLE42 small peptide has the application of controlling plant bud regeneration or being used as a plant tissue culture proliferation regulator, can lead CLE42 genes to be over-expressed through gene editing or transgenosis, improve the bud regeneration capability in plant tissue culture, or improve the bud regeneration capability in plant tissue culture through adding artificial synthetic CLE42 small peptide into a tissue culture medium.

Description

Application of CLE42 small peptide in promoting plant bud regeneration and serving as plant tissue culture proliferation promoter

Technical Field

The invention belongs to the technical field of plant biology, and particularly relates to a small peptide capable of regulating plant reprogramming, bud regeneration and promoting plant explant bud proliferation capacity and application of the small peptide serving as a plant tissue culture proliferation promoter.

Background

Tissue culture is one of the common plant biotechnology means for achieving vegetative propagation and large-scale propagation of plants. Specifically, under the condition of aseptic culture, the plant hormone type, content and proportion in the culture medium are regulated, and the plant hormone type and the cytokinin type are mainly included, so that proper explants are induced to form embryogenic callus, the embryogenic callus is further subjected to the processes of callus proliferation, differentiation and the like to obtain high-quality regeneration buds, the regeneration buds are subjected to rooting under the action of proper growth regulators, generally high-concentration cytokinins, and a large number of regeneration seedlings are finally obtained through the steps of seedling training and the like. The acquisition of high-quality regeneration buds is a key link affecting the success and failure of plant tissue culture.

The shoot regeneration process commonly used for tissue culture requires two stages: the first step forms embryogenic callus with multipotency under the induction of high-concentration auxin, and the second step starts bud regeneration under the induction of high-concentration cytokinin. The process of shoot regeneration is related to plant stem cell activity, but is different from shoot tip meristem development and root tip meristem development, and is related to factors such as plant species, genotype, explant type, culture conditions, and growth regulators, but the specific regulatory mechanism is not yet clear. For tissue culture production, research on novel plant regulators affecting bud regeneration has wide application value.

In addition, genotype is also an intrinsic factor affecting plant callus formation and shoot regeneration. The gene which controls the main effect of plant bud regeneration and has conserved functions is discovered, and the expression activity of the gene is controlled by genetic engineering, thus being a feasible biotechnology means for improving the plant bud regeneration capability.

Growth regulators are generally referred to as plant hormones. The CLAVATA3/EMBRYO SURROUNDING REGION-RELATED (CLE) small peptide, called CLE small peptide for short, which is a novel polypeptide plant hormone, is commonly present in higher plants. The known function of CLE small peptides is to maintain stem cell activity in plant meristematic regions, and CLV3 is clear from current studies. The arabidopsis CLE42 is a mature peptide segment which is encoded by the CLE42 gene (AT 2G 34925), is generated after translation and splicing, and has the amino acid sequence of 'HGVPSGPNPISN'. Previous studies have shown that CLE42 controls the activity of primitive forming layer cells, inhibits xylem differentiation, and regulates plant lateral bud development. In addition, they have physiological functions which are not yet publicly reported.

The acquisition of high-quality regeneration buds is a key link affecting the success and failure of plant tissue culture. Phytohormones act as growth regulators and play a vital role in the shoot regeneration process. Even if attempts are made to adjust factors such as the type, content and proportion of phytohormones in the culture medium, it is difficult for some plants to regenerate buds. For tissue culture production, the research on regulation and control mechanisms affecting bud regeneration finds out regulation and control genes and develops novel plant regulators, and has wide application value.

Disclosure of Invention

The invention aims to provide application of CLE42 small peptide in promoting plant bud regeneration and serving as a plant tissue culture proliferation promoter.

Compared with the wild type, the invention discovers that the regeneration number of the plant buds of the CLE42 overexpression is obviously increased, which indicates that the CLE42 is a positive control factor for controlling the regeneration of the Arabidopsis buds.

Compared with a control (without the externally applied small peptide), the invention discovers that the externally applied artificial CLE42 small peptide can obviously promote the formation of the number of regeneration buds of the arabidopsis hypocotyl explant on a bud induction medium (SIM), and shows that the novel function of the conserved small peptide hormone for promoting the regeneration of plant buds has a general meaning in higher plants.

Based on the above findings, the present invention provides the use of CLE42 small peptides in promoting plant bud regeneration. The promotion of plant bud regeneration is to improve the bud regeneration capability of the plant in tissue culture.

In some embodiments, the CLE42 encoding gene may be overexpressed by gene editing knock-in or transgenesis, for the purpose of enhancing gene expression activity, enhancing shoot regeneration in tissue culture in plants.

In some embodiments, the shoot regeneration capacity of plants in tissue culture can be enhanced by adding CLE42 small peptides to the tissue culture medium.

The invention also provides application of the CLE412 small peptide as a plant tissue culture proliferation regulator, and specifically relates to improvement of the bud regeneration capability of plants in tissue culture by adding the CLE42 small peptide into a tissue culture medium.

The invention also provides a method for promoting the regeneration of buds of plants in tissue culture, which is to use a tissue culture medium containing CLE42 small peptide for tissue culture.

In some embodiments, the plant is a plant comprising a gene encoding a CLE42 small peptide or a homologous protein thereof.

In some embodiments, the plant is arabidopsis thaliana.

In some embodiments, the amino acid sequence of the CLE42 small peptide described above is: HGVPSGPNPISN (SEQ ID NO. 1).

In some embodiments, the nucleotide sequences of the genes encoding the CLE42 small peptides described above are each as follows:

CLE42 gene: ATGAGATCTCCTCACATCACCATTTCACTTGTTTTCTTGTTCTTTCTTTT TCTAATCATCCAAACCCATCAAAGAACCATTGATCAAACTCACCAGATTGGCTCCAATGT TCAACATGTCAGTGACATGGCGGTGACTTCGCCTGAAGGGAAAAGAAGAGAGAGGTTT AGAGTTCGGCGGCCGATGACGACATGGCTGAAGGGAAAGATGATCGGTGCCAATGAAC ATGGAGTCCCAAGTGGTCCAAATCCCATCTCCAATAGGTAG (SEQ ID NO. 2).

The invention has the advantages that:

(1) The present invention discovers a novel function of CLE42 in promoting plant bud regeneration.

(2) Current plant gene editing techniques are becoming mature and more plant genomes are sequenced, making it feasible to knock out, knock in or overexpress genes in different plants. Knocking in or over expressing CLE42 small peptide will significantly increase the ability of buds to regenerate during plant tissue culture, which application is particularly important for plants where buds are difficult to regenerate from callus.

(3) The advantages of the artificial synthesis of CLE42 small peptide are: easy to obtain, easy to store, easy to prepare and low in cost. The artificial synthetic small peptide is used as a promoting growth regulator and added into a tissue culture medium, so that a proper amount of high-quality regeneration buds are obtained.

Drawings

FIG. 1 shows the gene expression level detection of CLE42 overexpressing material. And detecting the target gene expression level of the over-expressed transgenic material by using real-time fluorescence quantitative PCR (RT-qPCR), wherein the WT and 35S: CLE42 are the over-expressed transgenic materials of the wild type Arabidopsis thaliana and the CLE42 respectively.

FIG. 2 is a plot of the number statistics of regeneration shoots for CLE42 overexpressing material and wild-type. Col-0 is wild type Arabidopsis thaliana, and is a control. 35S CLE42 is a transgenic material that overexpresses CLE 42. (A) phenotype map. (B) statistical graphs. Asterisks represent significant differences. The statistical method comprises the following steps: dunnett multiple comparison test, one-way anova (< 0.0001) P.

FIG. 3 is a graph showing the statistics of the number of regeneration shoots after exogenous application of a synthetic CLE42 small peptide. Asterisks represent significant differences. The statistical method comprises the following steps: dunnett multiple comparison test, one-way anova (< 0.05, <0.01, <0.0001, < P).

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but embodiments of the present invention are not limited thereto.

The technical means used in the following examples are conventional means well known to those skilled in the art unless otherwise indicated; the experimental methods used are all conventional and can be carried out according to the described recombinant techniques (see molecular cloning guidelines, 4 th edition, cold spring harbor laboratory Press, cold spring harbor, N.Y.); the materials, reagents, and the like used are all commercially available.

The culture medium and culture conditions used for tissue culture in the following examples are as follows, and the CIM medium formulation is: 4.4g MS base salt (vitamin; basal medium with vitamins), 0.5g/L methyl sulfonate (methylester sulfonate), 20g/L sucrose, 2.2mM 2,4-D,0.2mM kinetin and 8g/L agar, pH 5.7; the formula of the SIM culture medium is as follows: 4.4g MS basic salt (containing vitamins), 0.5g/L methyl sulfonate, 20g/L sucrose, 5mM kinetin, 0.9mM indole-3-acetic acid (indole-3-acetic acid) and 8g/L agar, pH 5.7; the incubation temperature was 22℃and the photoperiod was 16h light/8 h dark.

Example 1 the regeneration capacity of CLE42 overexpressing plant shoots was significantly enhanced compared to the wild type.

And (5) utilizing a 35S strong promoter to drive CLE42 to obtain the transgenic super-expression material. And carrying out regeneration bud phenotype investigation on the over-expression material.

The CLE42 overexpressing plant creation method involved in example 1 was as follows: genomic fragments containing the CLE42 5 '-and 3' -regulatory elements were amplified by PCR and cloned into pPLV26 vectors containing the 35S promoter by Gibson homologous recombination (De Rybel B, van den Berg W, lokerse AS, et al A versatile set of ligation-independent cloning vectors for functional studies in plants [ J ]. Plant physiology 2011,156 (3): 1292-1299.) and sequenced to confirm sequence fidelity to obtain 35S: CLE42 overexpressing vectors. After the vector is transformed into agrobacterium, the agrobacterium is transformed into arabidopsis by using an inflorescence dip-dyeing method, the expression quantity of the obtained transgenic family target gene is detected by RT-qPCR, and finally, the stable CLE42 over-expression transgenic family is obtained. The RT-qPCR detection result is shown in figure 1, and the expression level of CLE42 gene is obviously increased in CLE42 over-expression transgenic material.

The cloned primer sequences were:

CLE42-OE-F：5'-AGGACACGGGGCCCCCCCTCGAGATGAGATCTCCTCACATCACC-3' ，

CLE42-OE-R：5'-TGAACGATCGGGGATCGGATCCCTACCTATTGGAGATGGGATTTG -3'。

the RT-qPCR primer sequences were as follows:

qRTCLE42-F：ACTTCGCCTGAAGGGAAAAG，

qRTCLE42-R：ATTGGCACCGATCATCTTTC。

CLE42 overexpressing transgenic material was dark cultured for 7 days, taking 1cm hypocotyl as explant. After transferring the explants to CIM medium, culture was continued for 7 days until callus formation occurred. The calli were transferred to SIM medium and cultured for 21 days. The number of regeneration shoots per explant callus was observed, photographed and counted using a Nikon SMZ745T whole microscope. Regeneration bud is defined as a meristematic structure surrounded by 3 leaves. All experimental data were collected for 3 biological replicates. The results showed that CLE42 gene overexpression significantly promoted the formation of regeneration buds in the SIM medium in the arabidopsis hypocotyl explants (fig. 2).

Example 2 exogenous application of synthetic CLE42 small peptide promotes arabidopsis bud regeneration.

The amino acid sequence of the mature peptide fragment of arabidopsis CLE42 is HGVPSGPNPISN, and can be obtained through artificial synthesis. The genetic evidence described above indicates that the cumulative levels of CLE42 in arabidopsis thaliana (plants) are positively correlated with shoot regeneration capacity. Thus, in theory, the application of artificial synthetic small peptides inside and outside the SIM medium will promote the regeneration capacity of wild type Arabidopsis sprouts.

Based on this, wild type Arabidopsis seedlings were dark-cultured for 7 days, and 1cm hypocotyl was taken as an explant. After transferring the explants to CIM medium, culture was continued for 7 days until callus formation occurred. The calli were transferred to SIM medium containing 10 μm CLE42 and cultured for 21 further days. The number of regeneration shoots per explant callus was observed, photographed and counted using a Nikon SMZ745T whole microscope. Regeneration bud is defined as a meristematic structure surrounded by 3 leaves. All experimental data were collected for 3 biological replicates. The results indicate that exogenous application of the synthetic CLE42 small peptide significantly promoted arabidopsis shoot regeneration (fig. 3). Thus, the shoot regeneration capacity of plants in tissue culture can be enhanced by adding synthetic CLE42 small peptides to the tissue culture medium.

Taken together, these in vivo genetic evidence, i.e., the results of regeneration shoot phenotyping of the overexpressing material and the external application of CLE42 small peptide, suggest that CLE42 small peptide is a regulator of promotion of shoot regeneration. Their amino acid sequences are evolutionarily conserved in higher plants. From the aspect of plant phylogenetic analysis, the invention provides an implementation method for improving the efficiency of regeneration buds of different plant tissue culture by genetic manipulation and external application of artificial synthetic CLE42 small peptide.

The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.

Sequence listing

<110> university of Shaanxi

Hubei Medical College

<120> use of CLE42 small peptide for promoting plant bud regeneration and as plant tissue culture proliferation promoter

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 12

<212> PRT

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 1

His Gly Val Pro Ser Gly Pro Asn Pro Ile Ser Asn

1 5 10

<210> 2

<211> 267

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 2

atgagatctc ctcacatcac catttcactt gttttcttgt tctttctttt tctaatcatc 60

caaacccatc aaagaaccat tgatcaaact caccagattg gctccaatgt tcaacatgtc 120

agtgacatgg cggtgacttc gcctgaaggg aaaagaagag agaggtttag agttcggcgg 180

ccgatgacga catggctgaa gggaaagatg atcggtgcca atgaacatgg agtcccaagt 240

ggtccaaatc ccatctccaa taggtag 267

Claims (9)

1. Use of cle42 small peptide for promoting plant bud regeneration, characterized in that: the amino acid sequence of the CLE42 small peptide is as follows: HGVPSGPNPISN.
2. 2. The use according to claim 1, characterized in that: by enhancing the expression activity of CLE42 coding genes, the bud regeneration capability of plants in tissue culture is improved.
3. 3. The use according to claim 1, characterized in that: the bud regeneration capacity of plants in tissue culture is improved by adding artificially synthesized CLE42 small peptide into the tissue culture medium.
4. The use of cle42 small peptide as a plant tissue culture proliferation modulator characterized by: the amino acid sequence of the CLE small peptide is as follows: HGVPSGPNPISN.
5. 5. The use according to claim 4, characterized in that: the shoot regeneration capacity of plants in tissue culture was enhanced by adding CLE42 small peptide to the tissue culture medium.
6. 6. A method for promoting shoot regeneration in tissue culture in a plant, characterized by: tissue culture was performed using tissue culture medium of CLE42 small peptide.
7. 7. The use according to any one of claims 1-5 or the method according to claim 6, characterized in that: the plant is a plant containing CLE42 small peptide or homologous protein coding genes thereof.
8. 8. The use according to any one of claims 1-5 or the method according to claim 6, characterized in that: the plant is Arabidopsis thaliana.
9. 9. The use according to any one of claims 1-5 or the method according to claim 6, characterized in that: the nucleotide sequence of the encoding gene of the CLE42 small peptide is shown as SEQ ID NO. 2.

Images