CN115976018A - Kit for constructing ABCA12 gene mutant plaque ichthyosis model pig nuclear transplantation donor cells and application thereof - Google Patents

Abstract

The invention discloses a kit for constructing a porcine nuclear transfer donor cell of an ABCA12 gene mutant harlequin ichthyosis model and application thereof. The present invention provides a polypeptide comprising SEQ ID NO:16, ABCA12-gRNA1, SEQ ID NO:17, ABCA12-gRNA4 and NCN protein. The invention also provides a method for preparing the recombinant porcine cells, which comprises the following steps: co-transfecting the ABCA12-gRNA1, the ABCA12-gRNA4 and the NCN protein to the pig cell to obtain a recombinant pig cell. The recombinant pig cell is a recombinant pig cell with mutant ABCA12 genes. The application of the kit is as follows: preparing a recombinant porcine cell; preparing spot-color ichthyosis model pigs; preparing a spot color ichthyosis cell model or a spot color ichthyosis tissue model or a spot color ichthyosis organ model. The invention has great application value for researching and developing the spot-color ichthyosis medicament and disclosing the pathogenesis of the spot-color ichthyosis.

Description

Kit for constructing ABCA12 gene mutant plaque ichthyosis model pig nuclear transplantation donor cells and application thereof

Technical Field

The invention belongs to the technical field of biology, particularly belongs to the technical field of gene editing, and more particularly relates to a kit for constructing ABCA12 gene mutant plaque ichthyosis model pig nuclear transplantation donor cells and application thereof.

Background

Ichthyosis (HI), also known as clown ichthyosis, is an autosomal recessive inherited skin disease that is one of the most severe forms of congenital ichthyosis and is characterized by abnormal thickening of the skin cuticle of the fetal body surface. Patients with this disease have red, large rhomboidal scales visible on the skin with severe cranial and facial deformities. The keratinized, scaly skin greatly restricts the mobility of the infant. Chaps occur in the place where the skin is wrinkled normally, so that imbalance in the regulation of moisture and body temperature is easily caused, and infection by bacteria or other pollutants is easily caused, which is fatal.

Ichthyosis is mainly caused by mutations in the ABCA12 gene. The epidermis of the skin is subdivided into 5 layers, the stratum corneum, the outermost layer, which is formed by the accumulation of dead keratinocytes. There are lipid-rich lamina particles in living keratinocytes, ABCA12 is a protein on the lamina particle membrane responsible for the transport of lipids into the particles. The lipids in the particles eventually fill the interstitial spaces via an intracellular release. Thus, there is also a lipid layer in the stratum corneum which fills in dead corneocytes, and desquamation of the skin is associated with a water repellent effect. The deficiency or abnormality of ABCA12 protein in the lamellar particles in the keratinocytes of patients with ichthyosis vulgaris results in the loss of lipids in the stratum corneum and the failure of desquamation of the skin, resulting in the accumulation of a large amount of keratin and the abnormality of skin permeability.

The research on the occurrence and development mechanism of ichthyosis maculata and the research and development of corresponding medicaments are carried out on the basis of animal models, the current common animal model is a mouse model, however, the mouse is greatly different from a human body in aspects of body type, organ size, physiology, pathology and the like, and the normal physiological and pathological states of the human body cannot be truly simulated. The pig as a large animal has the similar body size and physiological function to human, is easy to breed and feed in large scale, has lower requirements on ethics, animal protection and the like, and is an ideal human disease model animal.

Gene editing is a biotechnology that has been greatly developed in recent years, and includes editing technologies from homologous recombination-based gene editing to nuclease-based ZFNs, TALENs, CRISPR/Cas9, and the like, wherein CRISPR/Cas9 technology is currently the most advanced gene editing technology. Currently, gene editing techniques are increasingly applied to the production of animal models.

Disclosure of Invention

The invention aims to provide a kit for constructing ABCA12 gene mutant plaque ichthyosis model pig nuclear transplantation donor cells and application thereof.

The invention provides a kit, which comprises ABCA12-gRNA1, ABCA12-gRNA4 and NCN protein.

The invention also provides a kit, which comprises ABCA12-gRNA1, ABCA12-gRNA4 and PRONCN protein.

The invention also provides a kit, which comprises ABCA12-gRNA1, ABCA12-gRNA4 and specific plasmids.

Any of the kits above further comprising porcine cells.

The invention provides applications of ABCA12-gRNA1, ABCA12-gRNA4 and NCN protein in preparation of a kit.

The invention also provides application of the ABCA12-gRNA1, the ABCA12-gRNA4 and the PRONCN protein in preparation of the kit.

The invention also provides application of the ABCA12-gRNA1, the ABCA12-gRNA4 and the idiosyncratic particles in preparation of the kit.

The application of any one of the kits is as follows (a), (b) or (c): (a) preparing a recombinant porcine cell; (b) preparing a spot color ichthyosis model pig; (c) Preparing a spot color ichthyosis cell model or a spot color ichthyosis tissue model or a spot color ichthyosis organ model.

The invention provides a method for preparing recombinant pig cells, which comprises the following steps: co-transfecting the ABCA12-gRNA1, the ABCA12-gRNA4 and the NCN protein to the pig cell to obtain a recombinant pig cell.

The co-transfection is specifically a shock transfection.

The parameter settings of the electroporation transfection can be specifically as follows: 1450V, 10ms, 3pulse.

The co-transfection may be specifically carried out using a mammalian nuclear transfection kit (Neon kit, thermofoisher) and a Neon TM transfection system electrotransfer apparatus.

The proportion of the ABCA12-gRNA1, the ABCA12-gRNA4 and the NCN protein is as follows in sequence: 0.8-1.2 μ g ABCA12-gRNA1:0.8-1.2 μ g ABCA12-gRNA4: 3-5. Mu.g NCN protein.

The proportion of the ABCA12-gRNA1, the ABCA12-gRNA4 and the NCN protein is as follows in sequence: 1 μ g ABCA12-gRNA1:1 μ g ABCA12-gRNA4: mu.g NCN protein.

The proportions of the pig cells, the ABCA12-gRNA1, the ABCA12-gRNA4 and the NCN protein are as follows in sequence: 10 ten thousand porcine cells: 0.8-1.2 μ g ABCA12-gRNA1:0.8-1.2 μ g ABCA12-gRNA4: 3-5. Mu.g NCN protein.

The proportions of the pig cells, the ABCA12-gRNA1, the ABCA12-gRNA4 and the NCN protein are as follows in sequence: 10 ten thousand porcine cells: 1 μ g ABCA12-gRNA1:1 μ g ABCA12-gRNA4: mu.g NCN protein.

Any one of the above ABCA12-gRNA1 is sgRNA, and a target sequence binding region thereof is as set forth in SEQ ID NO:16 from nucleotide 3 to nucleotide 22.

Specifically, the ABCA12-gRNA1 is shown as SEQ ID NO: shown at 16.

Specifically, the ABCA12-gRNA1 is shown as SEQ ID NO: shown at 10.

Any one of the ABCA12-gRNA4 is sgRNA, and a target sequence binding region thereof is as set forth in SEQ ID NO:17 at nucleotides 3 to 22.

Specifically, the ABCA12-gRNA4 is shown in SEQ ID NO: shown at 17.

Specifically, the ABCA12-gRNA4 is shown in SEQ ID NO: shown at 13.

Any of the NCN proteins described above is a Cas9 protein or a fusion protein with a Cas9 protein.

Specifically, the NCN protein is shown as SEQ ID NO:3, respectively.

Any one of the above porcine cells is a porcine fibroblast.

Any of the above porcine cells are porcine primary fibroblasts.

Any of the above porcine cells are porcine primary fibroblasts obtained from a primary pig.

The preparation method of the NCN protein comprises the following steps:

(1) Introducing the plasmid pKG-GE4 into escherichia coli BL21 (DE 3) to obtain a recombinant strain;

(2) Culturing the recombinant strain by adopting a liquid culture medium at 30 ℃, then adding IPTG (isopropyl-beta-thiogalactoside) and carrying out induced culture at 25 ℃, and then collecting thalli;

(3) Crushing the collected thalli, and collecting a crude protein solution;

(4) Purification of the crude protein solution with His by affinity chromatography ₆ A fusion protein of the tag;

(5) By using a compound having His ₆ Tagged enterokinase cleavage with His ₆ The tagged fusion protein was then removed with His using Ni-NTA resin ₆ A tagged protein, resulting in a purified NCN protein;

plasmid pKG-GE4 has the sequence shown in SEQ ID NO:1, nucleotide 5209-9852.

The preparation method of the NCN protein specifically comprises the following steps:

(1) The plasmid pKG-GE4 was introduced into E.coli BL21 (DE 3) to obtain a recombinant strain.

(2) Inoculating the recombinant bacteria obtained in the step (1) to a liquid LB culture medium containing ampicillin, and performing shake culture;

(3) Inoculating the bacterial liquid obtained in the step (2) to a liquid LB culture medium, and performing shaking culture at 30 ℃ and 230rpm until OD is reached _600nm The value =1.0, then IPTG was added to make the concentration in the system 0.5mM, followed by shaking culture at 230rpm at 25 ℃ for 12 hours, and then the cells were collected by centrifugation;

(4) Taking the thalli obtained in the step (3), and washing the thalli with a PBS (phosphate buffer solution);

(5) Adding the crude extraction buffer solution into the thalli obtained in the step (4), suspending the thalli, then crushing the thalli, then centrifugally collecting supernate, filtering by adopting a filter membrane with the aperture of 0.22 mu m, and collecting filtrate;

(6) Purifying the filtrate obtained in step (5) by affinity chromatography to obtain a purified product having His ₆ A fusion protein of the tag (a fusion protein shown in SEQ ID NO: 2);

(7) Taking the post-column solution collected in the step (6), concentrating by using an ultrafiltration tube, and then diluting with 25mM Tris-HCl (pH8.0);

(8) Will have His ₆ Adding the labeled recombinant bovine enterokinase into the solution obtained in the step (7), and performing enzyme digestion;

(9) Mixing the solution obtained in the step (8) with Ni-NTA resin, incubating, centrifuging and collecting supernatant;

(10) And (4) concentrating the supernatant obtained in the step (9) by using an ultrafiltration tube, and then adding the concentrated supernatant into an enzyme stock solution to obtain the NCN protein solution.

Purifying the filtrate obtained in step (5) by affinity chromatography to obtain a purified product having His ₆ The specific method of the labeled fusion protein is as follows:

firstly, balancing a Ni-NTA agarose column by using a balance solution with 5 column volumes (the flow rate is 1 ml/min); then, 50ml of the filtrate obtained in the step (5) is loaded (the flow rate is 0.5-1 ml/min); the column was then washed with 5 column volumes of equilibration solution (flow rate 1 ml/min); the column was then washed with 5 column volumes of buffer (flow rate 1 ml/min) to remove contaminating proteins; then eluting with 10 column volumes of eluent at a flow rate of 0.5-1ml/min, and collecting the solution (90-100 ml) after passing through the column.

The PRONCN protein sequentially comprises the following elements from upstream to downstream: signal peptide, molecular chaperone protein, protein tag, protease cleavage site, nuclear localization signal, cas9 protein, nuclear localization signal.

The signal peptide has the function of promoting protein secretion expression. The signal peptide may be selected from the group consisting of the escherichia coli alkaline phosphatase (phoA) signal peptide, the staphylococcus aureus protein a signal peptide, the escherichia coli outer membrane protein (ompa) signal peptide or the signal peptide of any other prokaryotic gene, preferably the alkaline phosphatase signal peptide (phoA signal peptide). The alkaline phosphatase signal peptide is used for guiding the secretion and expression of the target protein into the bacterial periplasm cavity so as to be separated from the bacterial intracellular protein, and the target protein secreted into the bacterial periplasm cavity is soluble expression and can be cleaved by the signal peptidase in the bacterial periplasm cavity.

The chaperone protein functions to increase the solubility of the protein. The chaperone may be any protein that helps to form disulfide bonds, preferably a thioredoxin (TrxA protein). The thioredoxin can be used as a molecular chaperone to help a co-expressed target protein (such as a Cas9 protein) to form a disulfide bond, so that the stability and the folding correctness of the protein are improved, and the solubility and the activity of the target protein are increased.

The protein tag functions for protein purification. The Tag can be His Tag (His-Tag, his) ₆ Protein tag), GST tag, flag tag, HA tag, c-Myc tag, or any other protein tag, more preferably His tag. The His tag can be combined with a Ni column, and the target protein can be purified by one-step Ni column affinity chromatography, so that the purification process of the target protein can be greatly simplified.

The protease cleavage site functions to cleave non-functional segments after purification to release the native form of the Cas9 protein. The protease may be selected from Enterokinase (Enterokinase), factor Xa (Factor Xa), thrombin (thrombobin), TEV protease (TEV protease), HRV 3C protease (HRV 3C protease), WELQut protease or any other endoprotease, further preferably Enterokinase. EK is an enterokinase enzyme cutting site, so that fused TrxA-His segment can be conveniently cut by enterokinase to obtain the Cas9 protein in a natural form. After the commodity enterokinase enzyme digestion fusion protein with the His label is used, the TrxA-His section and the enterokinase with the His label can be removed through once affinity chromatography to obtain the Cas9 protein in a natural form, and the damage and the loss of the target protein caused by repeated purification and dialysis are avoided.

The nuclear localization signal may be any nuclear localization signal, preferably an SV40 nuclear localization signal and/or a nucleocapsin nuclear localization signal. NLS is a nuclear localization signal, and NLS sites are respectively designed at the N end and the C end of Cas9, so that Cas9 can more effectively enter a cell nucleus for gene editing.

The Cas9 protein may be saCas9 or spCas9, preferably is a spCas9 protein.

The PRONCN protein is specifically shown as SEQ ID NO:2, respectively.

Any one of the above specific plasmids sequentially comprises the following elements from upstream to downstream: promoter, operator, ribosome binding site, PRONCN protein coding gene and terminator.

The promoter may specifically be a T7 promoter. The T7 promoter is a prokaryotic expression strong promoter and can efficiently drive the expression of exogenous genes.

The operon may specifically be a Lac operon. The Lac operon is a regulatory element for lactose induced expression, and after bacteria grow to a certain amount, IPTG is used for inducing the expression of the target protein at low temperature, so that the influence of the premature expression of the target protein on the growth of host bacteria can be avoided, and the solubility of the expressed target protein is also obviously improved by the induced expression at low temperature.

The ribosome binding site is a ribosome binding site for protein translation, and is essential for protein translation.

The terminator may specifically be a T7 terminator. The T7 terminator can effectively terminate gene transcription at the end of the target gene, and prevent other downstream sequences except the target gene from being transcribed and translated.

For the codon of the spCas9 protein, the codon is optimized, so that the codon preference of the escherichia coli high-efficiency expression strain E.coli BL21 (DE 3) selected by the application is completely adapted, and the expression level of the Cas9 protein is improved.

The T7 promoter is shown as SEQ ID NO:1 from nucleotide 5121 to nucleotide 5139.

The Lac operon is shown as SEQ ID NO:1 from nucleotide 5140 to nucleotide 5164.

The ribosome binding site is shown as SEQ ID NO:1, nucleotides 5178 to 5201.

The coding sequence of the alkaline phosphatase signal peptide is shown as SEQ ID NO:1, nucleotides 5209-5271.

The coding sequence of the TrxA protein is shown as SEQ ID NO:1, nucleotides 5272-5598.

The coding sequence of His-Tag is shown as SEQ ID NO:1, nucleotides 5620-5637.

The coding sequence of the enterokinase enzyme cutting site is shown as SEQ ID NO:1 from nucleotide 5638 to nucleotide 5652.

The coding sequence of the nuclear localization signal is shown as SEQ ID NO:1 from nucleotide 5656 to nucleotide 5670.

The coding sequence of the spCas9 protein is shown in SEQ ID NO:1, nucleotides 5701-9801.

The coding sequence of the nuclear localization signal is shown as SEQ ID NO:1, nucleotides 9802 to 9849.

The T7 terminator is shown as SEQ ID NO: nucleotides 9902-9949 of 1.

Specifically, the specific plasmid is plasmid pKG-GE4.

Plasmid pKG-GE4 has the sequence SEQ ID NO:1, nucleotides 5121-9949.

Specifically, any one of the plasmids pKG-GE4 is shown as SEQ ID NO:1 is shown.

The invention also protects the recombinant porcine cell prepared by any one of the methods.

The recombinant pig cell is a recombinant pig cell with mutant ABCA12 genes.

The recombinant pig cell can be specifically single cell clone with the genotype of heterozygote, same mutant type of double alleles or different mutant types of double alleles in the table 1.

The invention also protects the application of the recombinant pig cells in preparing the variegated ichthyosis model pig. And (3) taking the recombinant pig cells as nuclear transplantation donor cells to clone somatic cells to obtain cloned pigs, namely the spotted ichthyosis model pigs.

The invention also protects the pig tissue of the model pig prepared by the recombinant pig cells, namely the speckled ichthyosis tissue model.

The invention also protects a pig organ of a model pig prepared by the recombinant pig cell, namely a variegated ichthyosis organ model.

The invention also protects the pig cells of the model pig prepared by the recombinant pig cells, namely the spotted ichthyosis cell model.

The invention also protects the application of the recombinant pig cells, the harlequin ichthyosis tissue model, the harlequin ichthyosis organ model, the harlequin ichthyosis cell model or the harlequin ichthyosis model pig, which is (d 1) or (d 2) or (d 3) or (d 4) as follows:

(d1) Screening the medicine for treating ichthyosis;

(d2) Evaluating the drug effect of the spot-color ichthyosis medicament;

(d3) Evaluating the curative effect of gene therapy and/or cell therapy of the ichthyosis maculatus;

(d4) The pathogenesis of the ichthyosis versicolor is studied.

Any one of the above pigs may be a fragrant pig from Yangjiang.

Any one of the pigs may be a newborn Zingjiang Xiang pig.

Any of the pigs may specifically be Bama miniature pigs.

Any of the pigs may specifically be newborn Bama miniature pigs.

Any of the foregoing harlequin ichthyosis is caused by a mutation in the ABCA12 gene.

Porcine ABCA12 gene information: encodes an ATP-binding cassette transporter a12; is located on chromosome 15; gene ID is 100512445, sus scrofa.

The protein coded by the porcine ABCA12 gene is shown as XP _020930634.1 (13-MAY-2017) in NCBI.

The protein coded by the porcine ABCA12 gene has the sequence shown in SEQ ID NO:8, or a fragment thereof.

The porcine ABCA12 gene has the sequence shown in SEQ ID NO:9, or a fragment of DNA as set forth in seq id no.

Any of the above mutations is a deletion and/or insertion and/or substitution of one or more nucleotides.

Any of the above mutations is a deletion of one or more nucleotides.

Any of the above mutations is an insertion of one or more nucleotides.

Any of the above mutations is a deletion and insertion of one or more nucleotides.

Compared with the prior art, the invention at least has the following beneficial effects:

(1) The subject of the invention (pig) has better applicability than other animals (rats, mice, primates).

Rodents such as rats and mice have great differences from humans in body types, organ sizes, physiology, pathology and the like, and cannot truly simulate normal physiological and pathological states of humans. Studies have shown that over 95% of drugs validated to be effective in large mice are not effective in human clinical trials. In large animals, primates are animals that have a close relationship with humans, but are small in size, late in sexual maturity (mating starts at age 6-7), and are single-birth animals, and the population propagation speed is extremely slow, and the raising cost is high. In addition, primate cloning efficiency is low, difficulty is high, and cost is high.

However, pigs, which are animals related to humans other than primates, do not have the above-mentioned disadvantages, and have body types, body weights, organ sizes, and the like similar to those of humans, and are very similar to those of humans in terms of anatomy, physiology, immunology, nutritional metabolism, disease pathogenesis, and the like. Meanwhile, the pigs have early sexual maturity (4-6 months), high reproductive capacity and multiple piglets, and can form a large group within 2-3 years. In addition, the cloning technology of the pig is very mature, and the cloning and breeding cost is much lower than that of the primate. Pigs are therefore very suitable animals as models for human disease.

(2) The vector constructed in the present invention expresses a target protein using a strong promoter T7-lac capable of efficiently expressing the target protein, and the target protein is separated from intracellular proteins by inducing secretory expression of the target protein into a periplasmic cavity of a bacterium with a signal peptide of a periplasmic protein alkaline phosphatase (phoA) of the bacterium, and the target protein secreted into the periplasmic cavity of the bacterium is expressed in a soluble form. Meanwhile, the thioredoxin TrxA and the Cas9 protein are fused and expressed, the TrxA can help the coexpressed target protein to form a disulfide bond, the stability and the folding correctness of the protein are improved, and the solubility and the activity of the target protein are increased. In order to facilitate the purification of the target protein, the His tag is designed, and the target protein can be purified through one-step Ni column affinity chromatography, so that the purification process of the target protein is greatly simplified. Meanwhile, an enterokinase enzyme cutting site is designed behind the His tag, so that the fused TrxA-His polypeptide fragment can be conveniently cut off, and the Cas9 protein in a natural form can be obtained. After the fusion protein is digested by using the enterokinase with the His tag, the TrxA-His polypeptide fragment and the enterokinase with the His tag can be removed through one-time affinity chromatography to obtain the Cas9 protein in a natural form, so that the damage and loss of the target protein caused by multiple times of purification dialysis are avoided. Meanwhile, an NLS site is respectively designed at the N end and the C end of the Cas9, so that the Cas9 can more effectively enter a cell nucleus for gene editing. In addition, the E.coli BL21 (DE 3) strain is selected as a target protein expression strain, and the strain can efficiently express and clone a foreign gene of an expression vector (such as pET-32 a) containing a bacteriophage T7 promoter. Meanwhile, as for the codon of the Cas9 protein, the invention carries out codon optimization, so that the codon is completely adapted to the codon preference of an expression strain, thereby improving the expression level of the target protein. In addition, after the bacteria grow to a certain amount, IPTG is used for inducing the expression of the target protein at low temperature, so that the influence of the premature expression of the target protein on the growth of host bacteria can be avoided, and the solubility of the expressed target protein is also obviously improved by inducing the expression at low temperature. Through the optimization design and experimental implementation, the activity of the obtained Cas9 protein is remarkably improved compared with that of a commercial Cas9 protein.

(3) The gene editing is carried out by combining the Cas9 high-efficiency protein constructed and expressed by the invention with the gRNA transcribed in vitro, and the optimal dosage ratio of the Cas9 and the gRNA is optimized, so that the ratio of the obtained gene editing single-cell clone is up to 91.2 percent and is far higher than the conventional gene editing efficiency (10-30 percent).

(4) The cloned pig with the knocked-out target gene can be directly obtained by cloning somatic cell nuclear transfer animals by using the obtained single cell cloned strain with the knocked-out target gene, and the gene variation can be stably inherited.

The method for embryo transplantation after injecting gene editing materials into fertilized eggs in the mouse model making is not suitable for making large animal (such as pig) models with longer gestation period because the probability of directly obtaining gene mutation offspring is lower, and the offspring hybridization breeding is needed. Therefore, the method adopts the primary cell in-vitro editing with great technical difficulty and high challenge, the method for cutting the Cas9 protein and the double gRNA and screening the positive editing single cell clone, and the corresponding disease model pig is directly obtained by the somatic cell nuclear transfer animal cloning technology in the later stage, so that the model pig manufacturing period can be greatly shortened, and the labor, the material resources and the financial resources are saved.

According to the invention, the ABCA12 gene is knocked out by combining a CRISPR/Cas9 technology with double gRNA editing, the genetic characteristics of the variegated ichthyosis are simulated, single-cell cloning of the ABCA12 gene knocking out is obtained, and a foundation is laid for later-stage cultivation of the variegated ichthyosis model pig by a somatic cell nuclear transfer animal cloning technology. The invention is helpful for researching and disclosing the pathogenesis of the ichthyosis caused by ABCA12 gene dysfunction, can be used for researching drug screening, drug effect evaluation, gene therapy, cell therapy and the like, can provide effective experimental data for further clinical application, and further provides a powerful experimental means for successfully treating the ichthyosis. The invention has great application value for researching and developing the spot-color ichthyosis medicament and disclosing the pathogenesis of the spot-color ichthyosis.

Drawings

FIG. 1 is a schematic diagram of the structure of plasmid pET-32 a.

FIG. 2 is a schematic diagram of the structure of plasmid pKG-GE4.

FIG. 3 is an electrophoretogram of the optimized dosage ratio of gRNA and NCN protein in example 2.

Fig. 4 is an electrophoretogram comparing gene editing efficiency of NCN protein and a commercial Cas9 protein in example 2.

FIG. 5 is an electrophoretogram of PCR amplification using different primer pairs using ear tissue-extracted genomes of swine named BX4 as templates in example 3.

FIG. 6 is an electrophoretogram of PCR amplification in example 3 using 10 pig genomic DNAs as templates and a primer pair consisting of ABCA12-E1-JDF200 and ABCA12-E1-JDR513, respectively.

FIG. 7 is an alignment of forward sequencing of single cell clone numbered 4 to the wild type sequence.

FIG. 8 is an alignment of reverse sequencing of single cell clone numbered 15 to the wild type sequence.

FIG. 9 is an alignment of reverse sequencing of single cell clone number 18 with the wild type sequence.

FIG. 10 is an alignment of forward sequencing of single cell clone numbered 3 to the wild type sequence.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, and the examples are given only for illustrating the present invention and not for limiting the scope of the present invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified. The recombinant plasmids constructed in the examples were all sequence verified. The commercial Cas9-a protein is a commercially available Cas9 protein with good effect. The commercial Cas9-B protein is a commercially available Cas9 protein with good effect. Complete culture broth (% by volume): 15% fetal bovine serum (Gibco) +83% DMEM medium (Gibco) +1% Penicilin-Streptomyces (Gibco) +1% HEPES (So)labio). Cell culture conditions: 37 ℃ C., 5% CO ₂ 、5％O ₂ The constant temperature incubator.

The porcine primary fibroblasts used in example 2 were prepared from porcine ear tissue of Jiangxiang pigs at birth. The porcine primary fibroblasts used in example 3 and example 4 were prepared from neonatal Bama miniature pig ear tissue. The method for preparing the primary pig fibroblast comprises the following steps: (1) taking 0.5g of pig ear tissue, removing hair and bone tissue, soaking in 75% alcohol for 30-40s, washing with PBS buffer containing 5% (volume ratio) Penicillin-Streptomycin (Gibco) for 5 times, and washing with PBS buffer for one time; (2) shearing the tissue with scissors, digesting with 5mL of 0.1% collagenase solution (Sigma) at 37 ℃ for 1h, centrifuging 500g for 5min, and removing the supernatant; (3) resuspending the precipitate with 1mL of complete culture solution, spreading into a 10cm diameter cell culture dish containing 10mL of complete culture solution and sealed with 0.2% gelatin (VWR), and culturing until the bottom of the dish is 60% full of cells; (4) after completion of step (3), the cells were digested with trypsin and collected, and then resuspended in complete medium. Used for carrying out subsequent electrotransfer experiments.

Example 1 preparation and purification of NCN protein

1. Construction of prokaryotic Cas9 high-efficiency expression vector

The structure of plasmid pET-32a is schematically shown in FIG. 1.

The plasmid pKG-GE4 is obtained by modifying a plasmid pET-32a serving as a starting plasmid. Plasmid pET32a-T7lac-phoA SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (plasmid pKG-GE4 for short), as shown in SEQ ID NO:1, is a circular plasmid, and the structural schematic diagram is shown in figure 2.

SEQ ID NO:1, the 5121-5139 th nucleotide constitutes T7 promoter, the 5140-5164 th nucleotide encodes Lac operator (Lac operator), the 5178-5201 th nucleotide constitutes Ribosome Binding Site (RBS), the 5209-5271 th nucleotide encodes alkaline phosphatase signal peptide (phoA signal peptide), the 5272-5598 th nucleotide encodes TrxA protein, and the 5620-5637 th nucleotide encodes His-Tag (also called His-Tag) ₆ Tag), nucleotides 5638-5652 encode an enterokinase cleavage site (EK cleavage site), and nucleotides 5656-5670 encode a nuclear localization signalNucleotides 5701-9801 encode a spCas9 protein, nucleotides 9802-9849 encode a nuclear localization signal, and nucleotides 9902-9949 constitute a T7 terminator. The nucleotides encoding the spCas9 protein have been codon optimized for the e.coli BL21 (DE 3) strain.

The main modifications of plasmid pKG-GE4 are as follows: (1) the encoding region of the TrxA protein is reserved, and the TrxA protein can help the expressed target protein to form a disulfide bond and increase the solubility and the activity of the target protein; adding a coding sequence of an alkaline phosphatase signal peptide before a coding region of the TrxA protein, wherein the alkaline phosphatase signal peptide can guide the expressed target protein to be secreted into the periplasmic cavity of the bacteria and can be cut by prokaryotic periplasmic signal peptidase; (2) adding a coding sequence of His-Tag behind the coding sequence of the TrxA protein, wherein the His-Tag can be used for enriching the expressed target protein; (3) adding the coding sequence of an enterokinase enzyme cutting site DDDDK (Asp-Asp-Asp-Asp-Lys) at the downstream of the coding sequence of the His-Tag, and removing the His-Tag and the upstream fused TrxA protein by the purified protein under the action of enterokinase; (4) the Cas9 gene which is suitable for being expressed by an escherichia coli BL21 (DE 3) strain after codon optimization is inserted, and meanwhile, the nuclear localization signal coding sequence is added at the upstream and the downstream of the gene, so that the nuclear localization capability of the Cas9 protein purified at the later stage is improved.

The fusion gene in the plasmid pKG-GE4 is shown as SEQ ID NO:1, nucleotides 5209 to 9852 of SEQ ID NO:2 (fusion protein TrxA-His-EK-NLS-spCas9-NLS, abbreviated as PRONCN protein). Due to the existence of the alkaline phosphatase signal peptide and the enterokinase enzyme cutting site, the fusion protein is cut by enterokinase enzyme to form SEQ ID NO:3, the protein shown in SEQ ID NO: the protein shown in 3 is named NCN protein.

2. Inducible expression

1. The plasmid pKG-GE4 was introduced into E.coli BL21 (DE 3) to obtain a recombinant strain.

2. The recombinant strain obtained in step 1 was inoculated into a liquid LB medium containing 100. Mu.g/ml ampicillin and cultured overnight at 37 ℃ with shaking at 200 rpm.

3. Inoculating the bacterial liquid obtained in the step 2 into a liquid LB culture medium, and performing inoculation at 30 ℃ and 230rpm shake culture to OD _600nm The value =1.0, isopropyl thiogalactoside (IPTG) was added to the system to give a concentration of 0.5mM, and the system was cultured at 25 ℃ for 12 hours with shaking at 230rpm, and then centrifuged at 4 ℃ for 15 minutes at 10000g, and the cells were collected.

4. The cells obtained in step 3 were washed with PBS buffer.

3. Purification of fusion protein TrxA-His-EK-NLS-spCas9-NLS

1. And (3) adding the crude extraction buffer solution into the thalli obtained in the step two, suspending the thalli, then crushing the thalli by a homogenizer (1000 par circulation is carried out for three times), then centrifuging for 30min at 4 ℃ at 15000g, collecting supernate, filtering the supernate by a filter membrane with the aperture of 0.22 mu m, and collecting filtrate. In this step, 10ml of crude extraction buffer solution is prepared for each g of wet-weight thallus. Crude extraction buffer: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 5mM Imidazole, 1mM PMSF, and the balance ddH ₂ O。

2. The fusion protein was purified by affinity chromatography.

Firstly, balancing a Ni-NTA agarose column by using a balance solution with 5 column volumes (the flow rate is 1 ml/min); then 50ml of the filtrate obtained in step 1 was loaded (flow rate 0.5-1 ml/min); the column was then washed with 5 column volumes of equilibration solution (flow rate 1 ml/min); the column was then washed with 5 column volumes of buffer (flow rate 1 ml/min) to remove contaminating proteins; then eluting with 10 column volumes of eluent at a flow rate of 0.5-1ml/min, and collecting the solution (90-100 ml) after passing through the column.

Ni-NTA agarose column: kinseri, L00250/L00250-C, 10ml of packing.

Balance liquid: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 5mM Imidazole, and the balance ddH ₂ O。

Buffer solution: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 50mM Imidazole, and the balance ddH ₂ O。

Eluent: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 500mM Imidazole, and the balance ddH ₂ O。

4. Enzyme digestion of fusion protein TrxA-His-EK-NLS-spCas9-NLS and purification of NCN protein

1. 15ml of the post-column solution collected in step three was concentrated to 200. Mu.l using Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml) and then diluted to 1ml with 25mM Tris-HCl (pH 8.0). 6 ultrafiltration tubes were used to give a total of 6ml.

2. Providing commercial source with His ₆ Tagged recombinant bovine enterokinase (biol., C620031, recombinant bovine enterokinase light chain, his-bearing ₆ The tag, recombinan Bovine Enterokinase Light Chain, his), was added to the solution (about 6 ml) obtained in step 1, and cleaved at 25 ℃ for 16 hours. 2 units of enterokinase are added in the amount of each 50 mug protein.

3. The solution (about 6 ml) that completed step 2 was taken, mixed with 480. Mu.l of Ni-NTA resin (Kinseri, L00250/L00250-C), mixed well by rotation at room temperature for 15min, then centrifuged at 7000g for 3min, and the supernatant (4-5.5 ml) was collected.

4. And (3) taking the supernatant obtained in the step (3), concentrating the supernatant to 200 mu l by using an Amicon ultrafiltration tube (Sigma, UFC9100, the volume of which is 15 ml), adding the concentrated solution into an enzyme stock solution, and adjusting the protein concentration to be 5mg/ml to obtain the NCN protein solution. Enzyme stock solution (ph 7.4): containing 10mM Tris,300mM NaCl,0.1mM EDTA,1mM DTT,50% (by volume) glycerol, and the balance ddH ₂ O。

And (3) sequencing the protein in the NCN protein solution, wherein the 15N-terminal amino acid residues are shown as SEQ ID NO:3, positions 1 to 15, namely the NCN protein. The NCN protein used in the subsequent examples was provided by NCN protein solution.

Example 2 Performance of NCN proteins

The 2 gRNA targets targeting the TTN gene were selected as follows:

TTN-gRNA1 target: AGAGCACAGTCAGCCTGGCG;

TTN-gRNA2 target: CTTCCAGAATTGGATCTCCG.

Primers used to identify target fragments comprising grnas in the TTN gene were as follows:

TTN-F55：TACGGAATTGGGGAGCCAGCGGA；

TTN-R560：CAAAGTTAACTCTCTGTGTCT。

1. preparation of gRNA

1. Preparation of TTN-T7-gRNA1 transcription template and TTN-T7-gRNA2 transcription template

The TTN-T7-gRNA1 transcription template is a double-stranded DNA molecule, and is shown as SEQ ID NO:4, respectively.

The TTN-T7-gRNA2 transcription template is a double-stranded DNA molecule, and is shown as SEQ ID NO:5, respectively.

2. In vitro transcription to obtain gRNA

Taking TTN-T7-gRNA1 Transcription template, adopting Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) to carry out in vitro Transcription, and then using MEGA clear ^TM The Transcription Clean-Up Kit (Thermo, AM 1908) was recovered and purified to obtain TTN-gRNA1.TTN-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: and 6.

Taking TTN-T7-gRNA2 Transcription template, adopting Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) to carry out in vitro Transcription, and then using MEGA clear ^TM The Transcription Clean-Up Kit (Thermo, AM 1908) was recovered and purified to obtain TTN-gRNA2.TTN-gRNA2 is single-stranded RNA, shown in SEQ ID NO: shown at 7.

2. gRNA and NCN protein dosage proportion optimization

1. Co-transfected porcine primary fibroblasts

A first group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN proteins. Proportioning: about 10 million porcine primary fibroblasts: 0.5 μ g TTN-gRNA1:0.5 μ g TTN-gRNA2: mu.g NCN protein.

Second group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN proteins. Proportioning: about 10 ten thousand porcine primary fibroblasts: 0.75 μ g TTN-gRNA1:0.75 μ g TTN-gRNA2: mu.g NCN protein.

Third group: co-transfecting primary pig fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN protein. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2: mu.g NCN protein.

And a fourth group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN proteins. Proportioning: about 10 million porcine primary fibroblasts: 1.25 μ g TTN-gRNA1:1.25 μ g TTN-gRNA2: mu.g NCN protein.

And a fifth group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1 and TTN-gRNA2. Proportioning: about 10 ten thousand porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2.

Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).

2. After step 1, the culture is carried out for 12 to 18 hours by using the complete culture solution, and then the culture is carried out by replacing the complete culture solution with a new one. The total time of incubation after electroporation was 48 hours.

3. After completion of step 2, cells were digested and collected with trypsin, genomic DNA was extracted, PCR amplified using a primer pair consisting of TTN-F55 and TTN-R560, and then subjected to 1% agarose gel electrophoresis.

The electrophoretogram is shown in FIG. 3. The 505bp band is a wild-type band (WT), and the about 254bp band (the wild-type band is 505bp theoretically deleted by 251 bp) is a deletion mutant band (MT).

Gene deletion mutation efficiency = (MT grayscale/MT band bp number)/(WT grayscale/WT band bp number + MT grayscale/MT band bp number) × 100%. The deletion mutation efficiency of the first group of genes is 19.9 percent, the deletion mutation efficiency of the second group of genes is 39.9 percent, the deletion mutation efficiency of the third group of genes is 79.9 percent, and the deletion mutation efficiency of the fourth group of genes is 44.3 percent. The fifth group was not mutated.

The result shows that when the mass ratio of the two gRNAs to the NCN protein is 1:1:4, actual dosage is 1 mu g:1 μ g: the gene editing efficiency is highest at 4 mug. Thus, the optimal amount of two grnas and NCN protein was determined to be 1 μ g:1 μ g:4 μ g.

3. Comparison of Gene editing efficiency of NCN protein with that of the commercial Cas9 protein

1. Co-transfected primary porcine fibroblasts

Cas9-a group: co-transfecting TTN-gRNA1, TTN-gRNA2 and a commercial Cas9-A protein to a porcine primary fibroblast. Proportioning: about 10 ten thousand porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2:4 μ g Cas9-A protein.

pKG-GE4 group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN proteins. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2: mu.g NCN protein.

Cas9-B set: co-transfecting the TTN-gRNA1, the TTN-gRNA2 and a commercial Cas9-B protein into a pig primary fibroblast. Proportioning: about 10 ten thousand porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2:4 μ g Cas9-B protein.

Control group: co-transfecting the TTN-gRNA1 and the TTN-gRNA2 to the pig primary fibroblasts. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2.

Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).

2. After the completion of step 1, the culture is carried out for 12 to 18 hours by using the complete culture solution, and then the culture is carried out by replacing with a new complete culture solution. The total time of incubation after electroporation was 48 hours.

3. After completion of step 2, cells were digested with trypsin and collected, genomic DNA was extracted, PCR amplified using a primer pair consisting of TTN-F55 and TTN-R560, and then subjected to 1% agarose gel electrophoresis.

The electrophoretogram is shown in FIG. 4. The gene deletion mutation efficiency with the commercial Cas9-a protein was 28.5%, the gene deletion mutation efficiency with the NCN protein was 85.6%, and the gene deletion mutation efficiency with the commercial Cas9-B protein was 16.6%.

The result shows that compared with the Cas9 protein which adopts a commodity, the NCN protein prepared by the invention can obviously improve the gene editing efficiency.

Example 3 screening of the high-efficiency gRNA target of ABCA12 Gene

Porcine ABCA12 gene information: encodes an ATP-binding cassette transporter a12; is located on chromosome 15; gene ID is 100512445, sus scrofa. The protein coded by the porcine ABCA12 gene is shown as XP _020930634.1 (13-MAY-2017) in NCBI. The partial segment of the protein coded by the pig ABCA12 gene is shown as SEQ ID NO: shown in fig. 8. In the pig genome DNA, the ABCA12 gene has 53 exons, the 1 st coding exon and 300bp of the coding exon and the upstream and downstream thereof are shown as SEQ ID NO: shown at 9.

Plasmid pKG-GE3, a circular plasmid, as described in patent application 202010084343.6 SEQ ID NO:2, respectively. SEQ ID NO:2, nucleotides 395 to 680 form a CMV enhancer, nucleotides 682 to 890 form an EF1a promoter, nucleotides 986 to 1006 encode a Nuclear Localization Signal (NLS), nucleotides 1016 to 1036 encode a Nuclear Localization Signal (NLS), nucleotides 1037 to 5161 encode a Cas9 protein, nucleotides 5162 to 5209 encode a Nuclear Localization Signal (NLS), nucleotides 5219 to 5266 encode a Nuclear Localization Signal (NLS), nucleotides 5276 to 5332 encode a polypeptide P2A (the amino acid sequence of the polypeptide P2A is "ATNFSLLKQAGDVEENPGP", the cleavage position is between the first and second amino acid residues from the C-terminal end), nucleotides 5333 to 6046 encode an EGFP protein, nucleotides 6056 to 6109 encode a polypeptide T2A (the amino acid sequence of the polypeptide T2A is "EGRGSLLTCGDVEENPGP", the cleavage position is between the first and second amino acid residues from the C-terminal end), nucleotides 6110 to 6703 encode a polypeptide T2A (the amino acid sequence of the polypeptide T2A is "EGRGSLLTCGDVEENPGP", the cleavage position is between the first and the second amino acid residue from the C-terminal end), nucleotides 6110 to 6703 constitute a WPbx 6747 element sequence, and the nucleotide sequence of GH 7647, or simply called GH 761 element. SEQ ID NO:2, the 911-6706 th nucleotides form fusion gene to express fusion protein. Due to the presence of the self-cleaving polypeptide P2A and the self-cleaving polypeptide T2A, the fusion protein spontaneously forms the following three proteins: proteins with Cas9 protein, proteins with EGFP protein and proteins with Puro protein.

The pKG-U6gRNA vector, plasmid pKG-U6gRNA, is a circular plasmid, as described in patent application 202010084343.6, SEQ ID NO:3, respectively. SEQ ID NO:3, the 2280 th to 2539 th nucleotides form the hU6 promoter, and the 2558 th to 2637 th nucleotides are used for transcription to form a gRNA framework. When the recombinant plasmid is used, a DNA molecule (a target sequence binding region for forming gRNA through transcription) with about 20bp is inserted into a plasmid pKG-U6gRNA to form a recombinant plasmid, and the recombinant plasmid is transcribed in a cell to obtain the gRNA.

1. Conservative analysis of ABCA12 gene preset deletion region and adjacent genome sequence

10 newborn Bama miniature pigs, 6 females (named BC1, BC2, BC3, BC4, BC5, BC6, respectively) and 4 males (named BX1, BX2, BX3, BX4, respectively).

ABCA12-E1-JDF200：CTTCTGACCTACCGACACGC；

ABCA12-E1-JDR530：GACTCGCCCCATTAGCTGTA；

ABCA12-E1-JDF221：GCACGTTGGACAGGGAATCA；

ABCA12-E1-JDR513：AGACTCGCCCCATTAGCTGT。

The porcine ear tissue named BX4 was used as a template for PCR amplification using different primer pairs and subjected to 1% agarose gel electrophoresis. The electrophoretogram is shown in FIG. 5. In fig. 5: group 1: adopting a primer pair consisting of ABCA12-E1-JDF200 and ABCA12-E1-JDR 513; group 2: adopting a primer pair consisting of ABCA12-E1-JDF200 and ABCA12-E1-JDR 530; group 3: adopting a primer pair consisting of ABCA12-E1-JDF221 and ABCA12-E1-JDR 513; group 4: a primer pair consisting of ABCA12-E1-JDF221 and ABCA12-E1-JDR530 is used. As a result, it is preferable to amplify the target fragment using a primer pair consisting of ABCA12-E1-JDF200 and ABCA12-E1-JDR 513.

10 pig genome DNA was used as a template, PCR amplification was carried out using a primer pair consisting of ABCA12-E1-JDF200 and ABCA12-E1-JDR513, followed by 1% agarose gel electrophoresis. The electrophoretogram is shown in FIG. 6. And recovering PCR amplification products, sequencing, and comparing and analyzing a sequencing result with an ABCA12 gene sequence in a public database. A common conserved region in 10 pigs is selected for designing a gRNA target.

2. Screening target spots

And primarily screening a plurality of targets by screening NGG (avoiding possible mutation sites), and further screening 4 targets from the NGG through a preliminary experiment.

The 4 targets are respectively as follows:

ABCA12-E1-gRNA1 target: AAAATTGGCTAGGTGTCAAG;

ABCA12-E1-gRNA2 target: CTTGTCTGGAAAAATTGGCT;

ABCA12-E1-gRNA3 target: GACCCGAAGCTGATGAAACT;

ABCA12-E1-gRNA4 target: CTAGCCAATTTTTCCAGACA.

3. Preparation of gRNA

The plasmid pKG-U6gRNA was digested with the restriction enzyme BbsI, and the vector backbone (approximately 3kb linear large fragment) was recovered.

ABCA12-E1-gRNA1-S and ABCA12-E1-gRNA1-A are synthesized respectively, and then mixed and annealed to obtain a double-stranded DNA molecule with a sticky end. A double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (ABCA 12-E1-gRNA 1). Plasmid pKG-U6gRNA (ABCA 12-E1-gRNA 1) expresses the plasmid SEQ ID NO:10 sgRNA _{ABCA12-E1-gRNA1} 。

sgRNA _{ABCA12-E1-gRNA1} (SEQ ID NO：10)：

AAAAUUGGCUAGGUGUCAAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

ABCA12-E1-gRNA2-S and ABCA12-E1-gRNA2-A are synthesized respectively, and then mixed and annealed to obtain a double-stranded DNA molecule with a sticky end. A double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (ABCA 12-E1-gRNA 2). Plasmid pKG-U6gRNA (ABCA 12-E1-gRNA 2) expresses SEQ ID NO:11 sgRNA _{ABCA12-E1-gRNA2} 。

sgRNA _{ABCA12-E1-gRNA2} (SEQ ID NO：11)：

CUUGUCUGGAAAAAUUGGCUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

ABCA12-E1-gRNA3-S and ABCA12-E1-gRNA3-A are respectively synthesized, and then mixed and annealed to obtain a double-stranded DNA molecule with a sticky end. A double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (ABCA 12-E1-gRNA 3). Plasmid pKG-U6gRNA (ABCA 12-E1-gRNA 3) expresses SEQ ID NO:12 sgRNA _{ABCA12-E1-gRNA3} 。

sgRNA _{ABCA12-E1-gRNA3} (SEQ ID NO：12)：

GACCCGAAGCUGAUGAAACUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

Respectively synthesizing ABCA12-E1-gRNA4-S and ABCA12-E1-gRNA4-A, then mixing and annealing,double-stranded DNA molecules with sticky ends are obtained. A double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (ABCA 12-E1-gRNA 4). Plasmid pKG-U6gRNA (ABCA 12-E1-gRNA 4) expresses the plasmid SEQ ID NO:13 sgRNA _{ABCA12-E1-gRNA4} 。

sgRNA _{ABCA12-E1-gRNA4} (SEQ ID NO：13)：

CUAGCCAAUUUUUCCAGACAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

ABCA12-E1-gRNA1-S：caccgAAAATTGGCTAGGTGTCAAG；

ABCA12-E1-gRNA1-A：aaacCTTGACACCTAGCCAATTTTc；

ABCA12-E1-gRNA2-S：caccgCTTGTCTGGAAAAATTGGCT；

ABCA12-E1-gRNA2-A：aaacAGCCAATTTTTCCAGACAAGc；

ABCA12-E1-gRNA3-S：caccgACCCGAAGCTGATGAAACT；

ABCA12-E1-gRNA3-A：aaacAGTTTCATCAGCTTCGGGTc；

ABCA12-E1-gRNA4-S：caccgCTAGCCAATTTTTCCAGACA；

ABCA12-E1-gRNA4-A：aaacTGTCTGGAAAAATTGGCTAGc。

ABCA12-E1-gRNA1-S, ABCA12-E1-gRNA1-A, ABCA-E1-gRNA 2-S, ABCA-E1-gRNA 2-A, ABCA-E1-gRNA 3-S, ABCA-E1-gRNA 3-A, ABCA-E1-gRNA 4-S, ABCA-E1-gRNA 4-A are all single-stranded DNA molecules.

4. Comparison of editing efficiency for different target combinations

1. Cotransfection

A first group: the plasmid pKG-U6gRNA (ABCA 12-E1-gRNA 1) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (ABCA 12-E1-gRNA 1): 1.08. Mu.g of plasmid pKG-GE3.

Second group: the plasmid pKG-U6gRNA (ABCA 12-E1-gRNA 2) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (ABCA 12-E1-gRNA 2): 1.08. Mu.g of plasmid pKG-GE3.

Third group: the plasmid pKG-U6gRNA (ABCA 12-E1-gRNA 3) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (ABCA 12-E1-gRNA 3): 1.08. Mu.g of plasmid pKG-GE3.

And a fourth group: the plasmid pKG-U6gRNA (ABCA 12-E1-gRNA 4) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. Mu.g of plasmid pKG-U6gRNA (ABCA 12-E1-gRNA 4): 1.08. Mu.g of plasmid pKG-GE3.

And a fifth group: carrying out electrotransformation operation on primary pig fibroblasts with the same electrotransformation parameters and without plasmids.

Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).

2. After step 1, the culture is carried out for 12 to 18 hours by using the complete culture solution, and then the culture is carried out by replacing the complete culture solution with a new one. The total time of incubation after electroporation was 48 hours.

3. After step 2 was completed, cells were digested and collected with trypsin, lysed, genomic DNA was extracted, PCR amplified using a primer pair consisting of ABCA12-E1-JDF200 and ABCA12-E1-JDR513, and then subjected to 1% agarose gel electrophoresis. And detecting the mutation condition of the target gene of the cell.

And cutting and recovering the target product, sending the target product to a sequencing company for sequencing, and analyzing a sequencing peak map by using a webpage version Synthego ICE tool to obtain the gene editing efficiency of different targets. The gene editing efficiency of the first group, the second group, the third group and the fourth group is 63%, 39%, 1% and 56% in sequence, and no gene editing occurs in the fifth group. The result shows that the editing efficiency of ABCA12-E1-gRNA1 and ABCA12-E1-gRNA4 is higher.

Example 4 preparation of ABCA12 Gene knockout Single cell clone of Bama miniature pig

Two high-efficiency gRNA targets (ABCA 12-E1-gRNA1 and ABCA12-E1-gRNA 4) screened in example 3 are selected.

1. Preparation of gRNA

1. Preparing ABCA12-T7-gRNA1 transcription template and ABCA12-T7-gRNA4 transcription template

The ABCA12-T7-gRNA1 transcription template is a double-stranded DNA molecule, and is shown as SEQ ID NO: as shown at 14.

The ABCA12-T7-gRNA4 transcription template is a double-stranded DNA molecule, and is shown as SEQ ID NO: shown at 15.

2. In vitro transcription to obtain gRNA

Taking ABCA12-T7-gRNA1 Transcription template, adopting a Transcription Aid T7 High Yield Transcription Kit (Fermentas, K0441) to perform in vitro Transcription, and then using MEGA clear ^TM ABCA12-gRNA1 was obtained by recovering and purifying the Transcription Clean-Up Kit (Thermo, AM 1908). ABCA12-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: shown at 16.

Taking ABCA12-T7-gRNA4 Transcription template, adopting a Transcription Aid T7 High Yield Transcription Kit (Fermentas, K0441) to perform in vitro Transcription, and then using MEGA clear ^TM ABCA12-gRNA4 was obtained by recovering and purifying the Transcription Clean-Up Kit (Thermo, AM 1908). ABCA12-gRNA4 is a single-stranded RNA, as shown in SEQ ID NO: shown at 17.

ABCA12-gRNA1(SEQ ID NO：16)：

GGAAAAUUGGCUAGGUGUCAAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

ABCA12-gRNA4(SEQ ID NO：17)：

GGCUAGCCAAUUUUUCCAGACAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

2. Transfection of porcine primary fibroblasts

1. Co-transfecting porcine primary fibroblasts with ABCA12-gRNA1, ABCA12-gRNA4 and NCN protein. Proportioning: about 10 ten thousand porcine primary fibroblasts: 1 μ g ABCA12-gRNA1:1 μ g ABCA12-gRNA4: mu.g NCN protein. Co-transfection was performed by electroporation using a mammalian Nuclear transfection kit (Neon kit, thermofisiher) with a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).

2. After step 1, the culture is carried out for 16 to 18 hours by using the complete culture solution, and then the culture is carried out by replacing the complete culture solution with a new one. The total time of incubation after electroporation was 48 hours.

3. After completion of step 2, cells were trypsinized and collected, then washed with complete medium, then resuspended with complete medium, and then each individual monoclonal was picked up and transferred to a 96-well plate (1 cell per well with 100. Mu.l of complete medium per well) for 2 weeks (replacement of new complete medium every 2-3 days).

4. After completion of step 3, cells were trypsinized and harvested (approximately 2/3 of the resulting cells per well were plated into 6-well plates containing complete medium, and the remaining 1/3 were harvested in 1.5mL centrifuge tubes).

5. The 6-well plate of step 4 was taken, cultured until the cells grew to 80% confluency, trypsinized and collected, and the cells were cryopreserved using cell cryopreserving (90% complete medium +10% dmso by volume).

6. And (4) taking the centrifuge tube in the step (4), taking the cells, performing cell lysis and extracting genomic DNA, performing PCR amplification by using a primer pair consisting of ABCA12-E1-JDF200 and ABCA12-E1-JDR513, and performing electrophoresis. Porcine primary fibroblasts were used as wild type controls (WT).

7. After completion of step 6, the PCR amplification product was recovered and sequenced.

The sequencing result of the pig primary fibroblast cell is only one, and the genotype of the pig primary fibroblast cell is a wild type (also called a homozygous wild type). If the sequencing result of a single-cell clone has two types, one type is consistent with the sequencing result of the pig primary fibroblast, and the other type has mutation (mutation comprises deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of the pig primary fibroblast, the genotype of the single-cell clone is heterozygote; if the sequencing result of a single-cell clone is two, the single-cell clone is mutated (the mutation comprises deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of the pig primary fibroblast, and the genotype of the single-cell clone is a biallelic different mutant type; if the sequencing result of a single-cell clone is one and mutation (mutation comprises deletion, insertion or substitution of one or more nucleotides) is generated compared with the sequencing result of the pig primary fibroblast, the genotype of the single-cell clone is a biallelic identical mutant; if the sequencing result of a single cell clone is one and is consistent with the sequencing result of a pig primary fibroblast, the genotype of the single cell clone is wild type (also called homozygous wild type).

The results are shown in Table 1. The genotypes of the single cell clones numbered 4, 17, 20 were wild-type. The genotypes of the single cell clones numbered 2, 6, 7, 8, 12, 13, 14, 15, 16, 21, 25, 26, 28, 30, 31, 34 are heterozygous. The genotypes of single cell clones numbered 1, 5, 9, 10, 11, 18, 19, 22, 24, 27, 29, 32, 33 are biallelic different mutants. The genotypes of the single cell clones numbered 3 and 23 were biallelic identical mutants. The rate of single cell clones resulting in the ABCA12 gene editing was 91.2%.

Exemplary sequencing alignment results are shown in fig. 7-10. FIG. 7 shows the alignment of the forward sequencing of single cell clone numbered 4 with the wild type sequence, and this is judged as wild type. FIG. 8 shows the result of alignment of the wild-type sequence with the reverse sequencing of the single-cell clone numbered 15, which was judged to be heterozygous. FIG. 9 is a comparison of reverse sequencing of single cell clone number 18 with the wild type sequence, as biallelic different mutants. FIG. 10 is a sequence alignment of forward sequencing of single cell clone number 3 with the wild type sequence, showing biallelic identity mutation.

TABLE 1 results of genotyping of ABCA12 Gene editing Single-cell clones

/>

The single cell clones of the heterozygote type, the biallelic gene identical mutant type and the biallelic gene different mutant type are all target single cell clones. The cells are taken as nuclear transplantation donor cells to carry out somatic cell cloning, so that cloned pigs, namely the spotted ichthyosis model pigs, can be obtained.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Claims (13)

1.A kit comprising ABCA12-gRNA1, ABCA12-gRNA4, and NCN protein;

the ABCA12-gRNA1 is sgRNA, and a target sequence binding region of the sgRNA is shown in SEQ ID NO:16, nucleotides 3-22; the ABCA12-gRNA4 is sgRNA, and a target sequence binding region of the sgRNA is shown in SEQ ID NO:17 at nucleotides 3-22; the NCN protein is a Cas9 protein or a fusion protein with a Cas9 protein;

the application of the kit is as follows (a), (b) or (c): (a) preparing a recombinant porcine cell; (b) preparing a spot color ichthyosis model pig; (c) Preparing a spot-color ichthyosis cell model or a spot-color ichthyosis tissue model or a spot-color ichthyosis organ model.

2. A kit comprising ABCA12-gRNA1, ABCA12-gRNA4, and PRONCN protein;

ABCA12-gRNA1 is ABCA12-gRNA1 as set forth in claim 1;

ABCA12-gRNA4 is ABCA12-gRNA4 as set forth in claim 1;

the PRONCN protein sequentially comprises the following elements from upstream to downstream: signal peptide, molecular chaperone protein, protein tag, protease enzyme cutting site, nuclear localization signal, cas9 protein and nuclear localization signal;

the application of the kit is as follows (a), (b) or (c): (a) preparing a recombinant porcine cell; (b) preparing a spot color ichthyosis model pig; (c) Preparing a spot color ichthyosis cell model or a spot color ichthyosis tissue model or a spot color ichthyosis organ model.

3. A kit, comprising ABCA12-gRNA1, ABCA12-gRNA4 and a specific plasmid;

ABCA12-gRNA1 is ABCA12-gRNA1 as set forth in claim 1;

ABCA12-gRNA4 is ABCA12-gRNA4 as set forth in claim 1;

the specific plasmid comprises the following elements from upstream to downstream in sequence: a promoter, an operator, a ribosome binding site, a PRONCN protein coding gene and a terminator; the PRONCN protein sequentially comprises the following elements from upstream to downstream: signal peptide, molecular chaperone protein, protein tag, protease enzyme cutting site, nuclear localization signal, cas9 protein and nuclear localization signal;

the application of the kit is as follows (a), (b) or (c): (a) preparing a recombinant porcine cell; (b) preparing a spot color ichthyosis model pig; (c) Preparing a spot-color ichthyosis cell model or a spot-color ichthyosis tissue model or a spot-color ichthyosis organ model.

Application of ABCAC 12-gRNA1, ABCA12-gRNA4 and NCN protein in preparation of a kit;

ABCA12-gRNA1 is ABCA12-gRNA1 as set forth in claim 1; ABCA12-gRNA4 is ABCA12-gRNA4 as set forth in claim 1; the NCN protein is the NCN protein described in claim 1;

the application of the kit is as follows (a), (b) or (c): (a) preparing a recombinant porcine cell; (b) preparing a spot color ichthyosis model pig; (c) Preparing a spot color ichthyosis cell model or a spot color ichthyosis tissue model or a spot color ichthyosis organ model.

Application of ABCAC 12-gRNA1, ABCA12-gRNA4 and PRONCN protein in preparation of a kit;

the ABCA12-gRNA1 is the ABCA12-gRNA1 described in claim 1; ABCA12-gRNA4 is ABCA12-gRNA4 as set forth in claim 1; the PRONCN protein is the PRONCN protein of claim 2;

the application of the kit is as follows (a), (b) or (c): (a) preparing a recombinant porcine cell; (b) preparing a spot color ichthyosis model pig; (c) Preparing a spot-color ichthyosis cell model or a spot-color ichthyosis tissue model or a spot-color ichthyosis organ model.

Application of ABCAC12-gRNA 1, ABCA12-gRNA4 and idiosyncratic particles in preparation of a kit;

ABCA12-gRNA1 is ABCA12-gRNA1 as set forth in claim 1; ABCA12-gRNA4 is ABCA12-gRNA4 as set forth in claim 1; the specific plasmid is the specific plasmid described in claim 3;

the application of the kit is as follows (a), (b) or (c): (a) preparing a recombinant porcine cell; (b) preparing a spot color ichthyosis model pig; (c) Preparing a spot color ichthyosis cell model or a spot color ichthyosis tissue model or a spot color ichthyosis organ model.

7. A method of making a recombinant porcine cell comprising the steps of: co-transfecting the ABCA12-gRNA1, the ABCA12-gRNA4 and the NCN protein to a pig cell to obtain a recombinant pig cell; ABCA12-gRNA1 is ABCA12-gRNA1 as set forth in claim 1; ABCA12-gRNA4 is ABCA12-gRNA4 as set forth in claim 1; the NCN protein is the NCN protein according to claim 1.

8. The kit according to claim 1 or the use according to claim 4 or the method according to claim 7, characterized in that: the NCN protein is shown as SEQ ID NO:3, respectively.

9. A kit or use or method as claimed in claim 8 wherein:

the preparation method of the NCN protein comprises the following steps:

(1) Introducing the plasmid pKG-GE4 into escherichia coli BL21 (DE 3) to obtain a recombinant strain;

(2) Culturing the recombinant strain by adopting a liquid culture medium at 30 ℃, then adding IPTG (isopropyl-beta-D-thiogalactoside) and carrying out induced culture at 25 ℃, and then collecting the strain;

(3) Crushing the collected thalli, and collecting a crude protein solution;

(4) Purification of His-bearing protein from the crude protein solution using affinity chromatography ₆ A fusion protein of the tag;

(5) By means of a compound having His ₆ Tagged enterokinase cleavage with His ₆ Tag fusion protein, then removing His in the protein with Ni-NTA resin ₆ A tagged protein, resulting in a purified NCN protein;

plasmid pKG-GE4 has the sequence shown in SEQ ID NO:1, nucleotide 5209-9852.

10. Recombinant porcine cells produced by the method of claim 7 or 8 or 9.

11. Use of the recombinant porcine cells of claim 10 for the preparation of a harlequin model pig.

12. Porcine tissue, porcine organ or porcine cells of a variegated ichthyosis model pig prepared by using the recombinant porcine cells of claim 10.

13. The use of the recombinant porcine cell of claim 10, the porcine tissue of claim 12, the porcine organ of claim 12, the porcine cell of claim 12, or the plaque-colored ichthyosis model porcine produced using the recombinant porcine cell of claim 10, wherein the recombinant porcine cell is selected from the group consisting of (d 1) or (d 2) or (d 3) or (d 4):

(d1) Screening the medicine for treating ichthyosis;

(d2) Evaluating the drug effect of the spot-color ichthyosis medicament;

(d3) Evaluating the curative effect of gene therapy and/or cell therapy of the ichthyosis maculatus;

(d4) The pathogenesis of the harlequin ichthyosis is researched.

Images