CN115807036A - Method for preparing BRCA2 gene mutation breast cancer model pig nuclear transplantation donor cell and special gene editing system thereof - Google Patents

Abstract

The invention discloses a method for preparing breast cancer model pig nuclear transplantation donor cells with BRCA2 gene mutation and a special gene editing system thereof. The invention provides a method for preparing recombinant porcine cells, which comprises the following steps: co-transfecting the BRCA2-gRNA1, the BRCA2-gRNA2 and the NCN protein to a pig cell to obtain a recombinant pig cell. The recombinant porcine cells are recombinant cells with BRCA2 gene mutation. The present invention provides a polypeptide comprising SEQ ID NO:16, BRCA2-gRNA1, SEQ ID NO:17, BRCA2-gRNA2 and NCN protein. The application of the kit is as follows: preparing a recombinant porcine cell; preparing a breast cancer model pig; preparing a breast cancer cell model or a breast cancer tissue model or a breast cancer organ model. The invention has great application value for the research and development of breast cancer drugs and the disclosure of pathogenesis of the breast cancer drugs.

Description

Method for preparing breast cancer model pig nuclear transplantation donor cell with BRCA2 gene mutation and special gene editing system thereof

Technical Field

The invention belongs to the technical field of biology, particularly belongs to the technical field of gene editing, and more particularly relates to a method for preparing BRCA2 gene mutation breast cancer model pig nuclear transplantation donor cells and a special gene editing system thereof.

Background

According to the latest cancer burden data released by the international agency for research on cancer (IARC) of the world health organization in 2020 worldwide, 60% of newly added cancer cases in 2020 come from the most common 10 tumors, of which female breast cancer accounts for 11.7% and surpasses lung cancer for the first time in number (11.4%), and become the most cancer diagnosed worldwide. Breast cancer in women is the cancer with the highest incidence for the first time, is the first killer threatening the health of women, and is one of the most urgent health problems today. BRCA2 is a familial breast/ovarian cancer susceptibility gene found after BRCA1, and encodes a product that is a tumor suppressor. The protective protein participates in repair of double-stranded DNA damage through homologous recombination and partial regulation of the activity of Rad51 protein factors, thereby preventing the growth and development of cancer cells. Research has shown that the mutated BRCA2 gene can cause the generation risk of breast cancer and ovarian cancer to be increased.

The research on the occurrence and development mechanism of breast cancer and the research and development of corresponding medicaments are carried out on the basis of animal models, the currently common animal model is a mouse model, however, the mouse is greatly different from a human body in aspects of body type, organ size, physiology, pathology and the like, and the normal physiological and pathological states of the human body cannot be truly simulated. The pig as a large animal has similar body size and physiological function to human, is easy to breed and feed in large scale, has lower requirements on ethics, animal protection and the like, and is an ideal human disease model animal.

Gene editing is a biotechnology that has been under significant development in recent years, and includes editing technologies from homologous recombination-based gene editing to nuclease-based ZFNs, TALENs, CRISPR/Cas9, and the like, with CRISPR/Cas9 technology being the most advanced gene editing technology at present. Currently, gene editing techniques are increasingly applied to the production of animal models.

Disclosure of Invention

The invention aims to provide a method for preparing BRCA2 gene mutant breast cancer model pig nuclear transplantation donor cells and a special gene editing system thereof.

The invention provides a method for preparing recombinant pig cells, which comprises the following steps: co-transfecting the BRCA2-gRNA1, the BRCA2-gRNA2 and the NCN protein to a pig cell to obtain a recombinant pig cell.

The co-transfection is specifically a shock transfection mode.

The parameter settings of the electroporation transfection can be specifically as follows: 1450V, 10ms, 3pulse.

The co-transfection may be specifically carried out using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransfer apparatus.

The invention also provides application of the BRCA2-gRNA1, the BRCA2-gRNA2 and NCN proteins in preparation of a kit.

The invention also provides application of the BRCA2-gRNA1, BRCA2-gRNA2 and PRONCN proteins in preparation of the kit.

The invention also provides application of the BRCA2-gRNA1, the BRCA2-gRNA2 and the heterogenous particles in preparation of the kit.

The invention also provides a kit which comprises BRCA2-gRNA1, BRCA2-gRNA2 and NCN protein.

The invention also provides a kit which comprises BRCA2-gRNA1, BRCA2-gRNA2 and PRONCN protein.

The invention also provides a kit which comprises BRCA2-gRNA1, BRCA2-gRNA2 and specific plasmids.

Any of the kits above further comprising porcine cells.

The use of any one of the above kits is (a) or (b) or (c): (a) preparing a recombinant porcine cell; (b) preparing breast cancer model pigs; (c) Preparing a breast cancer cell model or a breast cancer tissue model or a breast cancer organ model.

The ratio of BRCA2-gRNA1, BRCA2-gRNA2 and NCN protein is as follows: 0.8-1.2 μ g BRCA2-gRNA1:0.8-1.2 μ g BRCA2-gRNA2: 3-5. Mu.g NCN protein.

The ratios of BRCA2-gRNA1, BRCA2-gRNA2 and NCN protein are as follows in sequence: 1 μ g BRCA2-gRNA1:1 μ g BRCA2-gRNA2: mu.g NCN protein.

The proportions of the pig cells, the BRCA2-gRNA1, the BRCA2-gRNA2 and the NCN protein are as follows in sequence: 10 ten thousand porcine cells: 0.8-1.2 μ g BRCA2-gRNA1:0.8-1.2 μ g BRCA2-gRNA2: 3-5. Mu.g NCN protein.

The proportions of the pig cells, the BRCA2-gRNA1, the BRCA2-gRNA2 and the NCN protein are as follows in sequence: 10 ten thousand porcine cells: 1 μ g BRCA2-gRNA1:1 μ g BRCA2-gRNA2: mu.g NCN protein.

Any one of the BRCA2-gRNA1 is sgRNA, and a target sequence binding region thereof is as set forth in SEQ ID NO:16 from nucleotide 3 to nucleotide 22.

Specifically, the BRCA2-gRNA1 is shown as SEQ ID NO: shown at 16.

Specifically, the BRCA2-gRNA1 is shown as SEQ ID NO: shown at 10.

Any one of the BRCA2-gRNA2 is sgRNA, and a target sequence binding region thereof is as set forth in SEQ ID NO:17 at nucleotides 3 to 22.

Specifically, the BRCA2-gRNA2 is shown as SEQ ID NO: shown at 17.

Specifically, the BRCA2-gRNA2 is shown as SEQ ID NO: shown at 11.

Any of the NCN proteins described above is a Cas9 protein or a fusion protein with a Cas9 protein.

Specifically, the NCN protein is shown as SEQ ID NO:3, respectively.

Any one of the above porcine cells is a porcine fibroblast.

Any of the above porcine cells are porcine primary fibroblasts.

Any of the above porcine cells are porcine primary fibroblasts obtained from primary pigs.

The preparation method of the NCN protein comprises the following steps:

(1) Introducing the plasmid pKG-GE4 into escherichia coli BL21 (DE 3) to obtain a recombinant strain;

(2) Culturing the recombinant strain by adopting a liquid culture medium at 30 ℃, then adding IPTG (isopropyl-beta-thiogalactoside) and carrying out induced culture at 25 ℃, and then collecting thalli;

(3) Crushing the collected thalli, and collecting a crude protein solution;

(4) Purification of the crude protein solution with His by affinity chromatography ₆ A tagged fusion protein;

(5) By using a compound having His ₆ Tagged enterokinase cleavage with His ₆ Tag fusion protein, then removing His in the protein with Ni-NTA resin ₆ A tagged protein, resulting in a purified NCN protein;

plasmid pKG-GE4 has the sequence SEQ ID NO:1, nucleotide 5209-9852.

The preparation method of the NCN protein specifically comprises the following steps:

(1) The plasmid pKG-GE4 was introduced into E.coli BL21 (DE 3) to obtain a recombinant strain.

(2) Inoculating the recombinant bacteria obtained in the step (1) to a liquid LB culture medium containing ampicillin, and carrying out shake culture;

(3) Inoculating the bacterial liquid obtained in the step (2) to a liquid LB culture medium, and carrying out shaking culture at 30 ℃ and 230rpm until the bacterial liquid is OD _600nm The value =1.0, then IPTG was added to make the concentration in the system 0.5mM, followed by shaking culture at 230rpm at 25 ℃ for 12 hours, and then the cells were collected by centrifugation;

(4) Taking the thalli obtained in the step (3), and washing the thalli with a PBS (phosphate buffer solution);

(5) Adding the crude extraction buffer solution into the thalli obtained in the step (4), suspending the thalli, then crushing the thalli, then centrifugally collecting supernate, filtering by adopting a filter membrane with the aperture of 0.22 mu m, and collecting filtrate;

(6) Purifying the filtrate obtained in step (5) by affinity chromatography to obtain a purified product having His ₆ A fusion protein of the tag (the fusion protein shown in SEQ ID NO: 2);

(7) Taking the post-column solution collected in the step (6), concentrating by using an ultrafiltration tube, and then diluting with 25mM Tris-HCl (pH8.0);

(8) Will have His ₆ Adding the labeled recombinant bovine enterokinase into the solution obtained in the step (7), and performing enzyme digestion;

(9) Mixing the solution obtained in the step (8) with Ni-NTA resin, incubating, centrifuging and collecting supernatant;

(10) And (4) concentrating the supernatant obtained in the step (9) by using an ultrafiltration tube, and then adding the concentrated supernatant into an enzyme stock solution to obtain the NCN protein solution.

Purifying the filtrate obtained in step (5) by affinity chromatography to obtain a purified product having His ₆ The specific method of the labeled fusion protein is as follows:

firstly, balancing a Ni-NTA agarose column by using a balance solution with 5 column volumes (the flow rate is 1 ml/min); then, 50ml of the filtrate obtained in the step (5) is loaded (the flow rate is 0.5-1 ml/min); the column was then washed with 5 column volumes of equilibration solution (flow rate 1 ml/min); the column was then washed with 5 column volumes of buffer (flow rate 1 ml/min) to remove contaminating proteins; then eluting with 10 column volumes of eluent at a flow rate of 0.5-1ml/min, and collecting the solution (90-100 ml) after passing through the column.

Any one of the PRONCN proteins sequentially comprises the following elements from upstream to downstream: signal peptide, molecular chaperone protein, protein tag, protease cleavage site, nuclear localization signal, cas9 protein, nuclear localization signal.

The signal peptide has the function of promoting protein secretion expression. The signal peptide may be selected from the group consisting of the escherichia coli alkaline phosphatase (phoA) signal peptide, the staphylococcus aureus protein a signal peptide, the escherichia coli outer membrane protein (ompa) signal peptide or the signal peptide of any other prokaryotic gene, preferably the alkaline phosphatase signal peptide (phoA signal peptide). The alkaline phosphatase signal peptide is used for guiding the secretion and expression of the target protein into the bacterial periplasm cavity so as to be separated from the bacterial intracellular protein, and the target protein secreted into the bacterial periplasm cavity is soluble expression and can be cleaved by the signal peptidase in the bacterial periplasm cavity.

The chaperone protein functions to increase the solubility of the protein. The chaperone may be any protein that helps to form disulfide bonds, preferably a thioredoxin (TrxA protein). The thioredoxin can be used as a molecular chaperone to help a co-expressed target protein (such as a Cas9 protein) to form a disulfide bond, so that the stability and the folding correctness of the protein are improved, and the solubility and the activity of the target protein are increased.

The protein tag functions for protein purification. The Tag can be His Tag (His-Tag, his) ₆ Protein tag), GST tag, flag tag, HA tag, c-Myc tag, or any other protein tag, more preferably His tag. The His tag can be combined with a Ni column, and the target protein can be purified by one-step Ni column affinity chromatography, so that the purification process of the target protein can be greatly simplified.

The protease cleavage site functions to cleave non-functional segments after purification to release the native form of the Cas9 protein. The protease may be selected from Enterokinase (Enterokinase), factor Xa (Factor Xa), thrombin (thrombobin), TEV protease (TEV protease), HRV 3C protease (HRV 3C protease), WELQut protease or any other endoprotease, further preferably Enterokinase. EK is an enterokinase enzyme cutting site, and is convenient for cutting the fused TrxA-His section by using enterokinase to obtain the Cas9 protein in a natural form. After the fusion protein is digested by using the commercial enterokinase with the His label, the TrxA-His section and the enterokinase with the His label can be removed through one-time affinity chromatography to obtain the Cas9 protein in a natural form, so that the damage and loss of target protein caused by multiple times of purification and dialysis are avoided.

The nuclear localization signal may be any nuclear localization signal, preferably an SV40 nuclear localization signal and/or a nucleocapsin nuclear localization signal. NLS is a nuclear localization signal, and NLS sites are respectively designed at the N end and the C end of Cas9, so that Cas9 can more effectively enter a cell nucleus for gene editing.

The Cas9 protein may be saCas9 or spCas9, preferably a spCas9 protein.

The PRONCN protein is specifically shown as SEQ ID NO:2, respectively.

Any one of the above specific plasmids sequentially comprises the following elements from upstream to downstream: promoter, operator, ribosome binding site, PRONCN protein coding gene and terminator.

The promoter may specifically be a T7 promoter. The T7 promoter is a prokaryotic expression strong promoter and can efficiently drive the expression of exogenous genes.

The operon may specifically be a Lac operon. The Lac operon is a regulatory element for lactose induced expression, and after bacteria grow to a certain amount, IPTG is used for inducing the expression of the target protein at low temperature, so that the influence of the premature expression of the target protein on the growth of host bacteria can be avoided, and the solubility of the expressed target protein is also obviously improved by the induced expression at low temperature.

The ribosome binding site is a ribosome binding site for protein translation, and is essential for protein translation.

The terminator may specifically be a T7 terminator. The T7 terminator can effectively terminate gene transcription at the end of the target gene, and prevent other downstream sequences except the target gene from being transcribed and translated.

For the codon of the spCas9 protein, the codon is optimized, so that the codon preference of the escherichia coli high-efficiency expression strain E.coli BL21 (DE 3) selected by the application is completely adapted, and the expression level of the Cas9 protein is improved.

The T7 promoter is shown as SEQ ID NO:1 from nucleotide 5121 to nucleotide 5139.

The Lac operon is shown as SEQ ID NO:1 from nucleotide 5140 to nucleotide 5164.

The ribosome binding site is shown as SEQ ID NO:1 from nucleotide 5178 to 5201.

The coding sequence of the alkaline phosphatase signal peptide is shown as SEQ ID NO:1, nucleotides 5209-5271.

The coding sequence of the TrxA protein is shown as SEQ ID NO:1, nucleotides 5272-5598.

The coding sequence of His-Tag is shown as SEQ ID NO:1, nucleotides 5620-5637.

The coding sequence of the enterokinase enzyme cutting site is shown as SEQ ID NO:1 from nucleotide 5638 to nucleotide 5652.

The coding sequence of the nuclear localization signal is shown as SEQ ID NO:1 from nucleotide 5656 to nucleotide 5670.

The coding sequence of the spCas9 protein is shown in SEQ ID NO:1, nucleotides 5701-9801.

The coding sequence of the nuclear localization signal is shown as SEQ ID NO:1 from nucleotide 9802 to nucleotide 9849.

The T7 terminator is shown as SEQ ID NO:1, nucleotides 9902-9949.

Specifically, the specific plasmid is plasmid pKG-GE4.

Plasmid pKG-GE4 has the sequence shown in SEQ ID NO:1, nucleotides 5121-9949.

Specifically, any one of the plasmids pKG-GE4 is shown as SEQ ID NO:1 is shown.

The invention also protects the recombinant porcine cell prepared by any one of the methods.

The recombinant cell is a recombinant pig cell with BRCA2 gene mutation.

The recombinant porcine cells can be specifically single cell clones with the genotypes of the genes in the table 1 being heterozygote types, biallelic gene identical mutant types or biallelic gene different mutant types.

The invention also protects the application of the recombinant porcine cells in preparing breast cancer model pigs.

The recombinant pig cells are used as nuclear transfer donor cells to clone somatic cells, so that cloned pigs, namely breast cancer model pigs, can be obtained. The invention also protects the pig tissue of the model pig prepared by the recombinant pig cell, namely a breast cancer tissue model. The invention also protects a pig organ of a model pig prepared by the recombinant pig cell, namely a breast cancer organ model. The invention also protects the pig cell of the model pig prepared by the recombinant pig cell, namely a breast cancer cell model.

The invention also protects the recombinant pig cell, the breast cancer tissue model, the breast cancer organ model, the breast cancer cell model or the application of the breast cancer model pig, which is (d 1) or (d 2) or (d 3) or (d 4) as follows:

(d1) Screening a drug for treating breast cancer;

(d2) Evaluating the drug effect of the breast cancer drug;

(d3) Evaluating the curative effect of gene therapy and/or cell therapy of breast cancer;

(d4) The pathogenesis of breast cancer is studied.

Any of the pigs described above may in particular be Bama miniature pigs.

Any of the pigs may specifically be newborn Bama miniature pigs.

Any one of the pigs may be a Yuanjiang fragrant pig.

Any one of the pigs may be a newborn Zingjiang Xiang pig.

Any of the above breast cancers is caused by a mutation in the BRCA2 gene.

Pig BRCA2 gene information: breast cancer number 2 susceptibility gene; is located on chromosome 11; gene ID is 100624979, sus scrofa.

The amino acid sequence of the protein coded by the pig BRCA2 gene is shown as XP _020920843.1 (13-MAY-2017) in NCBI.

The protein encoded by the porcine BRCA2 gene has the amino acid sequence of SEQ ID NO:8, or a fragment thereof.

The porcine BRCA2 gene has the sequence shown in SEQ ID NO:9, or a fragment of DNA as set forth in seq id no.

Any of the above mutations is a deletion and/or insertion and/or substitution of one or more nucleotides.

Any of the above mutations is a deletion of one or more nucleotides.

Any of the above mutations is an insertion of one or more nucleotides.

Any of the above mutations is a deletion and insertion of one or more nucleotides.

Compared with the prior art, the invention at least has the following beneficial effects:

(1) The subject of the invention (pig) has better applicability than other animals (rat, primate).

Rodents such as rats and mice have great differences from humans in body types, organ sizes, physiology, pathology and the like, and cannot truly simulate normal physiological and pathological states of humans. Studies have shown that over 95% of drugs validated to be effective in large mice are not effective in human clinical trials. In large animals, primates are animals that have a close relationship with humans, but are small in size, late in sexual maturity (mating starts at age 6-7), and are single-birth animals, and the population propagation speed is extremely slow, and the raising cost is high. In addition, primate cloning efficiency is low, difficulty is high, and cost is high.

However, pigs are animals that have been closely related to humans except primates, and have body shapes, body weights, organ sizes, and the like similar to those of humans, and are very similar to those of humans in terms of anatomy, physiology, immunology, nutritional metabolism, disease pathogenesis, and the like. Meanwhile, the pigs have early sexual maturity (4-6 months), high reproductive capacity and multiple piglets, and can form a large group within 2-3 years. In addition, the cloning technology of the pig is very mature, and the cloning and breeding cost is much lower than that of the primate. Pigs are therefore very suitable animals as models for human diseases.

(2) The vector constructed by the invention uses a strong promoter T7-lac which can express target protein with high efficiency to express the target protein, and uses a signal peptide of bacterial periplasmic protein alkaline phosphatase (phoA) to guide the secretion and expression of the target protein to a bacterial periplasm cavity, so that the target protein is separated from the bacterial intracellular protein and is expressed in a soluble way. Meanwhile, the thioredoxin TrxA and the Cas9 protein are fused and expressed, the TrxA can help the coexpressed target protein to form a disulfide bond, the stability and the folding correctness of the protein are improved, and the solubility and the activity of the target protein are increased. In order to facilitate the purification of the target protein, the His tag is designed, and the target protein can be purified through one-step Ni column affinity chromatography, so that the purification process of the target protein is greatly simplified. Meanwhile, an enterokinase enzyme cutting site is designed behind the His tag, so that the fused TrxA-His polypeptide fragment can be conveniently cut off, and the Cas9 protein in a natural form can be obtained. After the fusion protein is digested by using the enterokinase with the His tag, the TrxA-His polypeptide fragment and the enterokinase with the His tag can be removed through one-time affinity chromatography to obtain the Cas9 protein in a natural form, so that the damage and loss of the target protein caused by multiple times of purification dialysis are avoided. Meanwhile, an NLS site is respectively designed at the N end and the C end of the Cas9, so that the Cas9 can more effectively enter a cell nucleus for gene editing. In addition, the E.coli BL21 (DE 3) strain is selected as a target protein expression strain, and the strain can efficiently express and clone the exogenous gene of an expression vector (such as pET-32 a) containing a bacteriophage T7 promoter. Meanwhile, as for the codon of the Cas9 protein, the invention carries out codon optimization, so that the codon is completely adapted to the codon preference of an expression strain, thereby improving the expression level of the target protein. In addition, after the bacteria grow to a certain amount, IPTG is used for inducing the expression of the target protein at low temperature, so that the influence of the premature expression of the target protein on the growth of host bacteria can be avoided, and the solubility of the expressed target protein is also obviously improved by inducing the expression at low temperature. Through the optimization design and experimental implementation, the activity of the obtained Cas9 protein is remarkably improved compared with that of a commercial Cas9 protein.

(3) The gene editing is carried out by combining the Cas9 high-efficiency protein constructed and expressed with the gRNA transcribed in vitro, the optimal dosage ratio of the Cas9 and the gRNA is optimized, and the ratio of the finally obtained gene editing single-cell clone is as high as 94.1 percent and is far higher than the conventional gene editing efficiency (10-30 percent).

(4) The cloned pig with the knocked-out target gene can be directly obtained by cloning somatic cell nuclear transfer animals by using the obtained single cell cloned strain with the knocked-out target gene, and the gene variation can be stably inherited.

The method for embryo transplantation after injecting gene editing materials into fertilized eggs in the mouse model production is not suitable for the production of large animal (such as pig) models with longer gestation period because the probability of directly obtaining gene mutation offspring is lower, and the offspring hybridization breeding is needed. Therefore, the method adopts the primary cell in-vitro editing with great technical difficulty and high challenge, the method for cutting the Cas9 protein and the double gRNA and screening the positive editing single cell clone, and the corresponding disease model pig is directly obtained by the somatic cell nuclear transfer animal cloning technology in the later stage, so that the model pig manufacturing period can be greatly shortened, and the labor, the material resources and the financial resources are saved.

According to the invention, the BRCA2 gene is knocked out by combining a CRISPR/Cas9 technology with double gRNA editing, the genetic characteristics of breast cancer are simulated, single cell clone with the BRCA2 gene knocked out is obtained, and a foundation is laid for breeding breast cancer model pigs by somatic cell nuclear transfer animal cloning technology in the later stage. The invention is helpful for researching and revealing the pathogenesis of the breast cancer caused by BRCA2 gene dysfunction, can also be used for research such as drug screening, drug effect evaluation, gene therapy, cell therapy and the like, can provide effective experimental data for further clinical application, and further provides powerful experimental means for successfully treating the human breast cancer. The invention has great application value for the research and development of breast cancer drugs and the disclosure of pathogenesis of the breast cancer drugs.

Drawings

FIG. 1 is an electrophoretogram of PCR amplification using different primer pairs using an extracted genome of ear tissue of a pig designated as BX1 as a template in example 1.

FIG. 2 is an electrophoretogram of PCR amplification in example 1 using primer pairs consisting of BRCA2-E9-JDF171 and BRCA2-E9-JDR771, respectively, using genomic DNA of 10 pigs as templates.

FIG. 3 is an alignment of the forward sequencing of single cell clone numbered 18 of example 2 with the wild type sequence.

FIG. 4 is a comparison of the forward sequencing of single cell clone numbered 5 in example 2 with the wild type sequence.

FIG. 5 is an alignment of the forward sequencing of single cell clone numbered 25 of example 2 with the wild type sequence.

FIG. 6 is an alignment of the forward sequencing of single cell clone numbered 23 in example 2 with the wild type sequence.

FIG. 7 is a schematic diagram of the structure of plasmid pET-32 a.

FIG. 8 is a schematic diagram of the structure of plasmid pKG-GE4.

FIG. 9 is an electrophoretogram of the optimized dosage ratio of gRNA and NCN protein in example 4.

Fig. 10 is an electrophoretogram comparing gene editing efficiency of NCN protein and a commercial Cas9 protein in example 4.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, and the examples are given only for illustrating the present invention and not for limiting the scope of the present invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified. The recombinant plasmids constructed in the examples were all sequence verified. The commercial Cas9-a protein is a commercially available Cas9 protein with good effect. The commercial Cas9-B protein is a commercial Cas9 protein with good effect. Complete culture broth (% by volume): 15% fetal bovine serum (Gibco) +83% DMEM medium (Gibco) +1% Penicilin-Streptomyces (Gibco) +1% HEPES (Solarbio). Cell culture conditions: 37 ℃ C., 5% CO ₂ 、5％O ₂ The constant temperature incubator.

The porcine primary fibroblasts used in example 1 and example 2 were prepared from neonatal Bama miniature pig ear tissue. The porcine primary fibroblasts used in example 4 were prepared from porcine ear tissue, which was freshly obtained from Jiangxiang pigs. The method for preparing the primary pig fibroblasts by using the ear tissues comprises the following steps: (1) taking 0.5g of pig ear tissue, removing hair and bone tissue, soaking in 75% alcohol for 30-40s, washing with PBS buffer containing 5% (volume ratio) Penicillin-Streptomycin (Gibco) for 5 times, and washing with PBS buffer for one time; (2) shearing the tissue with scissors, digesting with 5mL of 0.1% collagenase solution (Sigma) at 37 ℃ for 1h, centrifuging at 500g for 5min, and discarding the supernatant; (3) resuspending the precipitate with 1mL of complete culture solution, spreading into a 10cm diameter cell culture dish containing 10mL of complete culture solution and sealed with 0.2% gelatin (VWR), and culturing until the bottom of the dish is 60% full of cells; (4) after completion of step (3), the cells were digested with trypsin and collected, and then resuspended in complete medium. Used for carrying out subsequent electrotransfer experiments.

Example 1 screening of efficient gRNA target of BRCA2 Gene

Pig BRCA2 gene information: susceptibility gene No. 2 of breast cancer; is located on chromosome 11; gene ID is 100624979, sus scrofa. The amino acid sequence of the protein coded by the pig BRCA2 gene is shown as XP _020920843.1 (13-MAY-2017) in NCBI. The partial segment of the protein coded by the porcine BRCA2 gene is shown as SEQ ID NO: shown in fig. 8. In the pig genome DNA, the BRCA2 gene has 28 exons, and part of 9 th coding exon and downstream part of nucleotides thereof are shown as SEQ ID NO: shown at 9.

Plasmid pKG-GE3, a circular plasmid, as described in patent application 202010084343.6, SEQ ID NO:2, respectively. SEQ ID NO:2, the nucleotide 395 to 680 constitutes CMV enhancer, the nucleotide 682 to 890 constitutes EF1a promoter, the nucleotide 986 to 1006 encodes a Nuclear Localization Signal (NLS), the nucleotide 1016 to 1036 encodes a Nuclear Localization Signal (NLS), the nucleotide 1037 to 5161 encodes Cas9 protein, the nucleotide 5162 to 5209 encodes a Nuclear Localization Signal (NLS), the nucleotide 5219 to 5266 encodes a Nuclear Localization Signal (NLS), the nucleotide 5276 to 5332 encodes polypeptide P2A (the amino acid sequence of polypeptide P2A is "ATNFLKKQAKQACVEENGPGP", the cleavage site is between the first and second amino acid residues from the C-terminus), the nucleotide 5333 to 6046 encodes EGFP protein, the nucleotide 6056 to 6109 encodes polypeptide T2A (the amino acid sequence of polypeptide T2A is "EGRGSLLTGCLEVEENGPGP", the cleavage site is between the first and second amino acid residues from the C-terminus), the nucleotide 6110 to 736109 encodes an EF 2A (the amino acid sequence of polypeptide P2A) and the nucleotide 677647) the nucleotide 6731 to 677647, the nucleotide 677647 (the nucleotide 679) constitutes WPbRGSLLTRbL 679 protein, and the nucleotide 677647. SEQ ID NO:2, the 911-6706 th nucleotides form fusion gene to express fusion protein. Due to the presence of the self-cleaving polypeptide P2A and the self-cleaving polypeptide T2A, the fusion protein spontaneously forms the following three proteins: proteins with Cas9 protein, proteins with EGFP protein and proteins with Puro protein.

The pKG-U6gRNA vector, plasmid pKG-U6gRNA, is a circular plasmid, as described in patent application 202010084343.6 in SEQ ID NO:3, respectively. SEQ ID NO:3, the 2280-2539 th nucleotides form the hU6 promoter, and the 2558-2637 th nucleotides are used for transcription to form a gRNA framework. When the recombinant plasmid is used, a DNA molecule (a target sequence binding region for forming gRNA through transcription) with about 20bp is inserted into a plasmid pKG-U6gRNA to form a recombinant plasmid, and the recombinant plasmid is transcribed in a cell to obtain the gRNA.

1. Conservation analysis of BRCA2 gene default deletion region and adjacent genome sequence

10 newborn Bama miniature pigs, 6 female pigs (named as BC1, BC2, BC3, BC4, BC5 and BC6 respectively) and 4 male pigs (named as BX1, BX2, BX3 and BX4 respectively).

BRCA2-E9-JDF171：TGCCACATTCAGAGGAAGGTC；

BRCA2-E9-JDR603：AGTCTCGTTGTCTGGGAAAAGTT；

BRCA2-E9-JDF275：CTGTCAAATCCAGTTGTGACTTCT；

BRCA2-E9-JDR771：TTGTCATCGACCTTTGGCTGT。

The genome extracted from the ear tissue of a pig designated as BX1 was used as a template, PCR amplification was performed using different primer pairs, and then 1% agarose gel electrophoresis was performed. The electrophoretogram is shown in FIG. 1. In fig. 1: group 1: a primer pair consisting of BRCA2-E9-JDF171 and BRCA2-E9-JDR603 is adopted; group 2: a primer pair consisting of BRCA2-E9-JDF171 and BRCA2-E9-JDR771 is adopted; group 3: adopting a primer pair consisting of BRCA2-E9-JDF275 and BRCA2-E9-JDR 603; group 4: a primer pair consisting of BRCA2-E9-JDF275 and BRCA2-E9-JDR771 was used. The results show that the target fragment is preferably amplified by using a primer pair consisting of BRCA2-E9-JDF171 and BRCA2-E9-JDR 771.

10 swine genomic DNAs were used as templates, respectively, and PCR amplification was carried out using a primer pair consisting of BRCA2-E9-JDF171 and BRCA2-E9-JDR771, followed by 1% agarose gel electrophoresis. The electrophoretogram is shown in FIG. 2. And recovering PCR amplification products, sequencing, and comparing and analyzing the sequencing result with the BRCA2 gene sequence in the public database. A conserved region common to 10 pigs was selected for gRNA target design.

2. Screening target spots

And primarily screening a plurality of targets by screening NGG (avoiding possible mutation sites), and further screening 4 targets from the NGG through a preliminary experiment.

The 4 targets were as follows:

BRCA2-E9-gRNA1 target: attaacccgaatatttcca;

BRCA2-E9-gRNA2 target: tgtcagagaagagataatct;

BRCA2-E9-gRNA3 target: TTCTCAAAAAGCTGAGCTGTT;

BRCA2-E9-gRNA4 target: TGTTTCTTGATTCTTTTCCA.

3. Preparation of gRNA

The plasmid pKG-U6gRNA was digested with the restriction enzyme BbsI, and the vector backbone (approximately 3kb linear large fragment) was recovered.

BRCA2-E9-gRNA1-S and BRCA2-E9-gRNA1-A are synthesized respectively, and then mixed and annealed to obtain a double-stranded DNA molecule with a sticky end. A double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (BRCA 2-E9-gRNA 1). Plasmid pKG-U6gRNA (BRCA 2-E9-gRNA 1) expresses the nucleic acid sequence of SEQ ID NO:10 sgRNA _{BRCA2-E9-gRNA1} 。

sgRNA _{BRCA2-E9-gRNA1} (SEQ ID NO：10)：

AUUAACCCGAAAUAUUUCCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

BRCA2-E9-gRNA2-S and BRCA2-E9-gRNA2-A are synthesized respectively, and then mixed and annealed to obtain a double-stranded DNA molecule with a sticky end. The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (BRCA 2-E9-gRNA 2). Plasmid pKG-U6gRNA (BRCA 2-E9-gRNA 2) expresses the nucleic acid sequence of SEQ ID NO:11 sgRNA _{BRCA2-E9-gRNA2} 。

sgRNA _{BRCA2-E9-gRNA2} (SEQ ID NO：11)：

UGUCAGAGAAGAUAAAAUCUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

BRCA2-E9-gRNA3-S and BRCA2-E9-gRNA3-A are synthesized respectively, and then mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecule having the cohesive ends was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (BRCA 2-E9-gRNA 3). Plasmid pKG-U6gRNA (BRCA 2-E9-gRNA 3) expresses the nucleic acid sequence of SEQ ID NO:12 sgRNA _{BRCA2-E9-gRNA3} 。

sgRNA _{BRCA2-E9-gRNA3} (SEQ ID NO：12)：

UUCUCAAAAAGCUGAGCUGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

BRCA2-E9-gRNA4-S and BRCA2-E9-gRNA4-A are synthesized respectively, and then mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecule having the cohesive ends was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (BRCA 2-E9-gRNA 4). Plasmid pKG-U6gRNA (BRCA 2-E9-gRNA 4) expresses the nucleic acid sequence of SEQ ID NO:13 sgRNA _{BRCA2-E9-gRNA4} 。

sgRNA _{BRCA2-E9-gRNA4} (SEQ ID NO：13)：

UGUUUCUUGAUUCUUUUCCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

BRCA2-E9-gRNA1-S：caccgATTAACCCGAAATATTTCCA；

BRCA2-E9-gRNA1-A：aaacTGGAAATATTTCGGGTTAATc；

BRCA2-E9-gRNA2-S：caccgTGTCAGAGAAGATAAAATCT；

BRCA2-E9-gRNA2-A：aaacAGATTTTATCTTCTCTGACAc；

BRCA2-E9-gRNA3-S：caccgTTCTCAAAAAGCTGAGCTGT；

BRCA2-E9-gRNA3-A：aaacACAGCTCAGCTTTTTGAGAAc；

BRCA2-E9-gRNA4-S：caccgTGTTTCTTGATTCTTTTCCA；

BRCA2-E9-gRNA4-A：aaacTGGAAAAGAATCAAGAAACAc。

BRCA2-E9-gRNA1-S, BRCA2-E9-gRNA1-A, BRCA2-E9-gRNA2-S, BRCA2-E9-gRNA2-A, BRCA2-E9-gRNA3-S, BRCA2-E9-gRNA3-A, BRCA2-E9-gRNA4-S, BRCA2-E9-gRNA4-A are single-stranded DNA molecules.

4. Comparison of editing efficiency for different target combinations

1. Cotransfection

A first group: the plasmid pKG-U6gRNA (BRCA 2-E9-gRNA 1) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. Mu.g plasmid pKG-U6gRNA (BRCA 2-E9-gRNA 1): 1.08. Mu.g of plasmid pKG-GE3.

Second group: the plasmid pKG-U6gRNA (BRCA 2-E9-gRNA 2) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (BRCA 2-E9-gRNA 2): 1.08. Mu.g of plasmid pKG-GE3.

Third group: the plasmid pKG-U6gRNA (BRCA 2-E9-gRNA 3) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. Mu.g plasmid pKG-U6gRNA (BRCA 2-E9-gRNA 3): 1.08. Mu.g of plasmid pKG-GE3.

And a fourth group: the plasmid pKG-U6gRNA (BRCA 2-E9-gRNA 4) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92 μ g plasmid pKG-U6gRNA (BRCA 2-E9-gRNA 4): 1.08. Mu.g of plasmid pKG-GE3.

And a fifth group: carrying out electrotransformation operation on primary pig fibroblasts with the same electrotransformation parameters and without plasmids.

Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).

2. After step 1, the culture is carried out for 12 to 18 hours by using the complete culture solution, and then the culture is carried out by replacing the complete culture solution with a new one. The total time of incubation after electroporation was 48 hours.

3. After step 2 was completed, cells were digested and collected with trypsin, lysed, genomic DNA was extracted, PCR amplified using a primer pair consisting of BRCA2-E9-JDF171 and BRCA2-E9-JDR771, and then subjected to 1% agarose gel electrophoresis. And detecting the mutation condition of the target gene of the cell.

And cutting and recovering the target product, sending the target product to a sequencing company for sequencing, and analyzing a sequencing peak map by using a webpage version Synthego ICE tool to obtain the gene editing efficiency of different targets. The gene editing efficiency of the first group, the second group, the third group and the fourth group is 39%, 44%, 18% and 5% in sequence, and no gene editing occurs in the fifth group. The result shows that the editing efficiency of the BRCA2-E9-gRNA1 target and the BRCA2-E9-gRNA2 target is higher.

Example 2 preparation of BRCA2 knock-out Single cell clone of Bama miniature pig

Two high-efficiency gRNA targets (BRCA 2-E9-gRNA1 and BRCA2-E9-gRNA 2) screened in the example 1 are selected.

The NCN protein used in example 2 was provided from the NCN protein solution prepared in example 3.

1. Preparation of gRNA

1. Preparing BRCA2-T7-gRNA1 transcription template and BRCA2-T7-gRNA2 transcription template

The BRCA2-T7-gRNA1 transcription template is a double-stranded DNA molecule, and is shown as SEQ ID NO: as shown at 14.

The BRCA2-T7-gRNA2 transcription template is a double-stranded DNA molecule, and is shown as SEQ ID NO: shown at 15.

2. In vitro transcription to obtain gRNA

Taking BRCA2-T7-gRNA1 Transcription template, adopting Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) to make in vitro Transcription, then using MEGA clear ^TM The transfer Clean-Up Kit (Thermo, AM 1908) was recovered and purified to obtain BRCA2-gRNA1. The BRCA2-gRNA1 is single-stranded RNA, and is shown in SEQ ID NO: shown at 16.

Taking BRCA2-T7-gRNA2 Transcription template, adopting Transcription Aid T7 High Yield Transcription Kit (Fermentas, K0441) to make in vitro Transcription, then using MEGA clear ^TM The BRCA2-gRNA2 was obtained by recovering and purifying the Transcription Clean-Up Kit (Thermo, AM 1908). BRCA2-gRNA2 is a single-stranded RNA, as shown in SEQ ID NO: shown at 17.

BRCA2-gRNA1(SEQ ID NO：16)：

GGAUUAACCCGAAAUAUUUCCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

BRCA2-gRNA2(SEQ ID NO：17)：

GGUGUCAGAGAAGAUAAAAUCUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

2. Transfection of porcine primary fibroblasts

1. Co-transfecting primary pig fibroblasts with BRCA2-gRNA1, BRCA2-gRNA2 and NCN proteins. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g BRCA2-gRNA1:1 μ g BRCA2-gRNA2: mu.g NCN protein. Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).

2. After step 1, the culture is carried out for 16 to 18 hours by using the complete culture solution, and then the culture is carried out by replacing the complete culture solution with a new one. The total time of incubation after electroporation was 48 hours.

3. After completion of step 2, cells were trypsinized and collected, then washed with complete medium, then resuspended with complete medium, and then each individual monoclonal was picked up and transferred to a 96-well plate (1 cell per well with 100. Mu.l of complete medium per well) for 2 weeks (replacement of new complete medium every 2-3 days).

4. After completion of step 3, cells were trypsinized and harvested (approximately 2/3 of the resulting cells per well were plated into 6-well plates containing complete medium, and the remaining 1/3 were harvested in 1.5mL centrifuge tubes).

5. The 6-well plate of step 4 was taken, cultured until the cells grew to 80% confluency, trypsinized and collected, and the cells were cryopreserved using cell cryopreserving (90% complete medium +10% dmso by volume).

6. And (5) taking the centrifuge tube in the step (4), taking the cell, performing cell lysis, extracting genomic DNA, performing PCR amplification by using a primer pair consisting of BRCA2-E9-JDF171 and BRCA2-E9-JDR771, and performing electrophoresis. Porcine primary fibroblasts were used as wild type controls (WT).

7. After completion of step 6, the PCR amplification product was recovered and sequenced.

Sequencing of porcine primary fibroblasts resulted in only one genotype, wild type (also called homozygous wild type). If the sequencing result of a single cell clone has two types, one type is consistent with the sequencing result of the pig primary fibroblast, and the other type has mutation (mutation comprises deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of the pig primary fibroblast, the genotype of the single cell clone is heterozygote; if the sequencing result of a single-cell clone is two, the single-cell clone is mutated (the mutation comprises deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of the pig primary fibroblast, and the genotype of the single-cell clone is a biallelic different mutant type; if the sequencing result of a single-cell clone is one and mutation (mutation comprises deletion, insertion or substitution of one or more nucleotides) is generated compared with the sequencing result of the pig primary fibroblast, the genotype of the single-cell clone is a biallelic identical mutant; if the sequencing result of a single cell clone is one and is consistent with the sequencing result of a pig primary fibroblast, the genotype of the single cell clone is a wild type (also called a homozygous wild type).

The results are shown in Table 1. The genotypes of the single cell clones numbered 18, 26 were wild-type. The genotypes of the single cell clones numbered 2, 3, 5, 7, 10, 12, 14, 16, 19, 21, 22, 29, 30, 33 were heterozygous. The genotypes of the single cell clones numbered 1, 4, 6, 8, 9, 11, 13, 15, 17, 20, 24, 25, 27, 28, 31, 32, 34 are biallelic different mutants. The genotype of the single cell clone numbered 23 was a biallelic identical mutant. The rate of single cell clones resulting from BRCA2 gene editing was 94.1%.

Exemplary sequencing alignment results are shown in fig. 3-6. FIG. 3 shows the alignment of the forward sequencing of single-cell clone number 18 with the wild-type sequence, which was judged to be wild-type. FIG. 4 shows the result of alignment of forward sequencing of single-cell clone No. 5 with the wild-type sequence, and it was judged as heterozygous. FIG. 5 is a alignment of forward sequencing of single cell clone number 25 with the wild type sequence, as a biallelic different mutant. FIG. 6 is a sequence alignment of forward sequencing of single cell clone No. 23 with the wild type sequence, showing biallelic identity mutation.

TABLE 1 genotype determination of BRCA2 Gene editing Single-cell clones

The single cell clones of the above-mentioned heterozygote type, biallelic identical mutant type and biallelic different mutant type are all the target single cell clones. The cells are taken as nuclear transplantation donor cells to carry out somatic cell cloning, and cloned pigs, namely breast cancer model pigs, can be obtained.

Example 3 preparation and purification of NCN protein

1. Construction of prokaryotic Cas9 high-efficiency expression vector

The structure of plasmid pET-32a is schematically shown in FIG. 7.

The plasmid pKG-GE4 is obtained by modifying plasmid pET-32a serving as a starting plasmid. Plasmid pET32a-T7lac-phoA SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (plasmid pKG-GE4 for short) as shown in SEQ ID NO:1, is a circular plasmid, and the structural schematic diagram is shown in figure 8.

SEQ ID NO:1, the 5121-5139 th nucleotide constitutes T7 promoter, the 5140-5164 th nucleotide encodes Lac operator (Lac operator), the 5178-5201 th nucleotide constitutes Ribosome Binding Site (RBS), the 5209-5271 th nucleotide encodes alkaline phosphatase signal peptide (phoA signal peptide), the 5272-5598 th nucleotide encodes TrxA protein, and the 5620-5637 th nucleotide encodes His-Tag (also called His-Tag) ₆ Tag), 5634-5652 nucleotide encodes enterokinase cleavage site (EK cleavage site)The 5656-5670 nucleotides encode a nuclear localization signal, the 5701-9801 nucleotides encode an spCas9 protein, the 9802-9849 nucleotides encode a nuclear localization signal, and the 9902-9949 nucleotides constitute a T7 terminator. The nucleotides encoding the spCas9 protein have been codon optimized for the e.coli BL21 (DE 3) strain.

The main modifications of plasmid pKG-GE4 are as follows: (1) the encoding region of the TrxA protein is reserved, and the TrxA protein can help the expressed target protein to form a disulfide bond and increase the solubility and the activity of the target protein; adding a coding sequence of an alkaline phosphatase signal peptide before a coding region of the TrxA protein, wherein the alkaline phosphatase signal peptide can guide the expressed target protein to be secreted into the periplasmic cavity of the bacteria and can be cut by prokaryotic periplasmic signal peptidase; (2) adding a coding sequence of His-Tag behind the coding sequence of the TrxA protein, wherein the His-Tag can be used for enriching the expressed target protein; (3) adding a coding sequence of an enterokinase enzyme cutting site DDDDDDK (Asp-Asp-Asp-Asp-Lys) at the downstream of a coding sequence of the His-Tag, and removing the His-Tag and the upstream fused TrxA protein by the purified protein under the action of enterokinase; (4) the Cas9 gene which is suitable for the expression of an escherichia coli BL21 (DE 3) strain after codon optimization is inserted, and meanwhile, the nuclear localization signal coding sequence is added at the upstream and the downstream of the gene, so that the nuclear localization capability of the Cas9 protein purified at the later stage is improved.

The fusion gene in the plasmid pKG-GE4 is shown as SEQ ID NO:1, nucleotides 5209 to 9852 of SEQ ID NO:2 (fusion protein TrxA-His-EK-NLS-spCas9-NLS, abbreviated as PRONCN protein). Due to the existence of the alkaline phosphatase signal peptide and the enterokinase enzyme cutting site, the fusion protein is cut by enterokinase enzyme to form SEQ ID NO:3, the protein shown in SEQ ID NO: the protein shown in 3 is named NCN protein.

2. Inducible expression

1. The plasmid pKG-GE4 was introduced into E.coli BL21 (DE 3) to obtain a recombinant strain.

2. The recombinant strain obtained in step 1 was inoculated into a liquid LB medium containing 100. Mu.g/ml ampicillin and cultured overnight at 37 ℃ with shaking at 200 rpm.

3. Subjecting the product obtained in step 2Inoculating the bacterial liquid into liquid LB culture medium, shaking and culturing at 30 deg.C and 230rpm to OD _600nm The value =1.0, isopropyl thiogalactoside (IPTG) was added to make the concentration in the system 0.5mM, and the mixture was subjected to shaking culture at 230rpm at 25 ℃ for 12 hours, then centrifuged at 10000 ℃ for 15 minutes at 4 ℃ to collect the cells.

4. The cells obtained in step 3 were washed with PBS buffer.

3. Purification of fusion protein TrxA-His-EK-NLS-spCas9-NLS

1. And (3) adding the crude extraction buffer solution into the thalli obtained in the step two, suspending the thalli, then crushing the thalli by a homogenizer (1000 par circulation is carried out for three times), then centrifuging for 30min at 4 ℃ at 15000g, collecting supernate, filtering the supernate by a filter membrane with the aperture of 0.22 mu m, and collecting filtrate. In this step, 10ml of crude extraction buffer solution is prepared for each g of wet-weight thallus. Crude extraction buffer: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 5mM Imidazole, 1mM PMSF, and the balance ddH ₂ O。

2. The fusion protein was purified by affinity chromatography.

Firstly, balancing a Ni-NTA agarose column by using a balance solution with 5 column volumes (the flow rate is 1 ml/min); then 50ml of the filtrate obtained in step 1 was loaded (flow rate 0.5-1 ml/min); the column was then washed with 5 column volumes of equilibration solution (flow rate 1 ml/min); the column was then washed with 5 column volumes of buffer (flow rate 1 ml/min) to remove contaminating proteins; then eluting with 10 column volumes of eluent at flow rate of 0.5-1ml/min, and collecting the solution (90-100 ml) after passing through the column.

Ni-NTA agarose column: ausrey, L00250/L00250-C, 10ml of filler.

Balance liquid: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 5mM Imidazole, and the balance ddH ₂ O。

Buffer solution: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 50mM Imidazole, and the balance ddH ₂ O。

Eluent: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 500mM Imidazole, and the balance ddH ₂ O。

4. Enzyme digestion of fusion protein TrxA-His-EK-NLS-spCas9-NLS and purification of NCN protein

1. 15ml of the post-column solution collected in step three was concentrated to 200. Mu.l using Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml) and then diluted to 1ml with 25mM Tris-HCl (pH 8.0). 6 ultrafiltration tubes were used to give a total of 6ml.

2. Providing commercial source with His ₆ Tagged recombinant bovine enterokinase (biol., C620031, recombinant bovine enterokinase light chain, his-bearing ₆ The tag, recombinan Bovine Enterokinase Light Chain, his), was added to the solution (about 6 ml) obtained in step 1, and cleaved at 25 ℃ for 16 hours. 2 units of enterokinase are added in the amount of each 50 mug protein.

3. The solution (about 6 ml) that completed step 2 was taken and mixed with 480. Mu.l of Ni-NTA resin (Kinseri, L00250/L00250-C), mixed by rotation at room temperature for 15min, and then 7000g was centrifuged for 3min, and the supernatant (4-5.5 ml) was collected.

4. And (4) taking the supernatant obtained in the step (3), concentrating the supernatant to 200 mu l by using an Amicon ultrafiltration tube (Sigma, UFC9100, the volume of which is 15 ml), and then adding the concentrated supernatant into an enzyme stock solution to adjust the protein concentration to be 5mg/ml, so as to obtain the NCN protein solution. Enzyme stock solution (ph 7.4): containing 10mM Tris,300mM NaCl,0.1mM EDTA,1mM DTT,50% (by volume) glycerol, and the balance ddH ₂ O。

And (3) sequencing the protein in the NCN protein solution, wherein the 15N-terminal amino acid residues are shown as SEQ ID NO:3, positions 1 to 15, i.e., the NCN protein.

Example 4 Performance of NCN protein

The NCN protein used in example 4 was provided from the NCN protein solution prepared in example 3.

The 2 gRNA targets targeting the TTN gene were selected as follows:

TTN-gRNA1 target: AGAGCACAGCTCAGCCTGGCG;

TTN-gRNA2 target: CTTCCAGAATTGGATCTCCG.

Primers used to identify target fragments comprising grnas in the TTN gene were as follows:

TTN-F55：TACGGAATTGGGGAGCCAGCGGA；

TTN-R560：CAAAGTTAACTCTCTGTGTCT。

1. preparation of gRNA

1. Preparation of TTN-T7-gRNA1 transcription template and TTN-T7-gRNA2 transcription template

The TTN-T7-gRNA1 transcription template is a double-stranded DNA molecule, and is shown as SEQ ID NO:4, respectively.

The TTN-T7-gRNA2 transcription template is a double-stranded DNA molecule, and is shown as SEQ ID NO:5, respectively.

2. In vitro transcription to obtain gRNA

Taking TTN-T7-gRNA1 Transcription template, adopting Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) to carry out in vitro Transcription, and then using MEGA clear ^TM The Transcription Clean-Up Kit (Thermo, AM 1908) was recovered and purified to obtain TTN-gRNA1.TTN-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: and 6.

Taking TTN-T7-gRNA2 Transcription template, adopting a Transcription Aid T7 High Yield Transcription Kit (Fermentas, K0441) to carry out in vitro Transcription, and then using MEGA clear ^TM The Transcription Clean-Up Kit (Thermo, AM 1908) was recovered and purified to obtain TTN-gRNA2.TTN-gRNA2 is single-stranded RNA, shown in SEQ ID NO: shown at 7.

2. gRNA and NCN protein dosage ratio optimization

1. Co-transfected primary porcine fibroblasts

A first group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN proteins. Proportioning: about 10 ten thousand porcine primary fibroblasts: 0.5 μ g TTN-gRNA1:0.5 μ g TTN-gRNA2: mu.g NCN protein.

Second group: co-transfecting primary pig fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN protein. Proportioning: about 10 million porcine primary fibroblasts: 0.75 μ g TTN-gRNA1:0.75 μ g TTN-gRNA2: mu.g NCN protein.

Third group: co-transfecting primary pig fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN protein. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2: mu.g NCN protein.

And a fourth group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN proteins. Proportioning: about 10 million porcine primary fibroblasts: 1.25 μ g TTN-gRNA1:1.25 μ g TTN-gRNA2: mu.g NCN protein.

A fifth group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1 and TTN-gRNA2. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2.

Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).

2. After the completion of step 1, the culture is carried out for 12 to 18 hours by using the complete culture solution, and then the culture is carried out by replacing with a new complete culture solution. The total time of incubation after electroporation was 48 hours.

3. After completion of step 2, cells were digested and collected with trypsin, genomic DNA was extracted, PCR amplified using a primer pair consisting of TTN-F55 and TTN-R560, and then subjected to 1% agarose gel electrophoresis.

The electrophoretogram is shown in FIG. 9. The 505bp band is wild type band (WT), and the about 254bp band (251 bp band is theoretically deleted from 505bp band of wild type) is deletion mutant band (MT).

Gene deletion mutation efficiency = (MT gray/MT band bp number)/(WT gray/WT band bp number + MT gray/MT band bp number) × 100%. The deletion mutation efficiency of the first group of genes is 19.9 percent, the deletion mutation efficiency of the second group of genes is 39.9 percent, the deletion mutation efficiency of the third group of genes is 79.9 percent, and the deletion mutation efficiency of the fourth group of genes is 44.3 percent. Group five was not mutated.

The result shows that when the mass ratio of the two gRNAs to the NCN protein is 1:1:4, the actual dosage is 1 mu g:1 μ g: the gene editing efficiency is highest at 4 mug. Thus, the optimal amount of two grnas and NCN proteins was determined to be 1 μ g:1 μ g:4 μ g.

3. Comparison of Gene editing efficiency of NCN protein with commercial Cas9 protein

1. Co-transfected porcine primary fibroblasts

Cas9-a group: co-transfecting the TTN-gRNA1, the TTN-gRNA2 and a commercial Cas9-A protein into a pig primary fibroblast. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2:4 μ g Cas9-A protein.

pKG-GE4 group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN proteins. Proportioning: about 10 ten thousand porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2: mu.g NCN protein.

Cas9-B group: co-transfecting the TTN-gRNA1, the TTN-gRNA2 and a commercial Cas9-B protein into a pig primary fibroblast. Proportioning: about 10 ten thousand porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2:4 μ g Cas9-B protein.

Control group: co-transfecting the TTN-gRNA1 and the TTN-gRNA2 to the pig primary fibroblasts. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2.

Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).

2. After step 1, the culture is carried out for 12 to 18 hours by using the complete culture solution, and then the culture is carried out by replacing the complete culture solution with a new one. The total time of incubation after electroporation was 48 hours.

3. After completion of step 2, cells were digested and collected with trypsin, genomic DNA was extracted, PCR amplified using a primer pair consisting of TTN-F55 and TTN-R560, and then subjected to 1% agarose gel electrophoresis.

The electrophoretogram is shown in FIG. 10. The gene deletion mutation efficiency with the commercial Cas9-a protein was 28.5%, the gene deletion mutation efficiency with the NCN protein was 85.6%, and the gene deletion mutation efficiency with the commercial Cas9-B protein was 16.6%.

The result shows that compared with the Cas9 protein which adopts a commodity, the NCN protein prepared by the invention can obviously improve the gene editing efficiency.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced within a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Claims (13)

1. A method of making a recombinant porcine cell comprising the steps of: co-transfecting the BRCA2-gRNA1, the BRCA2-gRNA2 and the NCN protein to a pig cell to obtain a recombinant pig cell;

the BRCA2-gRNA1 is sgRNA, and a target sequence binding region is shown in SEQ ID NO:16, nucleotides 3 to 22; the BRCA2-gRNA2 is sgRNA, and a target sequence binding region is shown in SEQ ID NO:17 at nucleotides 3-22; the NCN protein is a Cas9 protein or a fusion protein with a Cas9 protein.

The application of BRCA2-gRNA1, BRCA2-gRNA2 and NCN protein in the preparation of a kit;

the BRCA2-gRNA1 is the BRCA2-gRNA1 of claim 1; BRCA2-gRNA2 is BRCA2-gRNA2 as set forth in claim 1; the NCN protein is the NCN protein described in claim 1;

the application of the kit is as follows (a), (b) or (c): (a) preparing a recombinant porcine cell; (b) preparing a breast cancer model pig; (c) Preparing a breast cancer cell model or a breast cancer tissue model or a breast cancer organ model.

The application of BRCA2-gRNA1, BRCA2-gRNA2 and PRONCN protein in the preparation of a kit;

the BRCA2-gRNA1 is the BRCA2-gRNA1 of claim 1; BRCA2-gRNA2 is BRCA2-gRNA2 as set forth in claim 1; the PRONCN protein sequentially comprises the following elements from upstream to downstream: signal peptide, molecular chaperone protein, protein tag, protease enzyme cutting site, nuclear localization signal, cas9 protein and nuclear localization signal;

the application of the kit is as follows (a), (b) or (c): (a) preparing a recombinant porcine cell; (b) preparing a breast cancer model pig; (c) Preparing a breast cancer cell model or a breast cancer tissue model or a breast cancer organ model.

The application of BRCA2-gRNA1, BRCA2-gRNA2 and the idiosyncratic particles in the preparation of the kit;

BRCA2-gRNA1 is the BRCA2-gRNA1 of claim 1; the BRCA2-gRNA2 is the BRCA2-gRNA2 of claim 1; the specific plasmid comprises the following elements from upstream to downstream in sequence: a promoter, an operator, a ribosome binding site, a PRONCN protein coding gene and a terminator; the PRONCN protein sequentially comprises the following elements from upstream to downstream: signal peptide, molecular chaperone protein, protein tag, protease enzyme cutting site, nuclear localization signal, cas9 protein and nuclear localization signal;

the application of the kit is as follows (a), (b) or (c): (a) preparing a recombinant porcine cell; (b) preparing breast cancer model pigs; (c) Preparing a breast cancer cell model or a breast cancer tissue model or a breast cancer organ model.

5. A kit comprising BRCA2-gRNA1, BRCA2-gRNA2, and NCN protein;

BRCA2-gRNA1 is the BRCA2-gRNA1 of claim 1; BRCA2-gRNA2 is BRCA2-gRNA2 as set forth in claim 1; the NCN protein is the NCN protein described in claim 1;

the application of the kit is as follows (a), (b) or (c): (a) preparing a recombinant porcine cell; (b) preparing a breast cancer model pig; (c) Preparing a breast cancer cell model or a breast cancer tissue model or a breast cancer organ model.

6. A kit comprising BRCA2-gRNA1, BRCA2-gRNA2, and PRONCN protein;

BRCA2-gRNA1 is the BRCA2-gRNA1 of claim 1; BRCA2-gRNA2 is BRCA2-gRNA2 as set forth in claim 1; the PRONCN protein is the PRONCN protein of claim 3;

the application of the kit is as follows (a), (b) or (c): (a) preparing a recombinant porcine cell; (b) preparing breast cancer model pigs; (c) Preparing a breast cancer cell model or a breast cancer tissue model or a breast cancer organ model.

7. A kit, comprising BRCA2-gRNA1, BRCA2-gRNA2 and a specific plasmid;

the BRCA2-gRNA1 is the BRCA2-gRNA1 of claim 1; BRCA2-gRNA2 is BRCA2-gRNA2 as set forth in claim 1; the specific plasmid is the specific plasmid described in claim 4;

the application of the kit is as follows (a), (b) or (c): (a) preparing a recombinant porcine cell; (b) preparing a breast cancer model pig; (c) Preparing a breast cancer cell model or a breast cancer tissue model or a breast cancer organ model.

8. The method of claim 1 or the use of claim 2 or the kit of claim 5, wherein: the NCN protein is shown as SEQ ID NO:3, respectively.

9. A method or use or kit as claimed in claim 8, wherein:

the preparation method of the NCN protein comprises the following steps:

(1) Introducing the plasmid pKG-GE4 into escherichia coli BL21 (DE 3) to obtain a recombinant strain;

(2) Culturing the recombinant strain by adopting a liquid culture medium at 30 ℃, adding IPTG (isopropyl-beta-thiogalactoside) and carrying out induced culture at 25 ℃, and then collecting thalli;

(3) Crushing the collected thalli, and collecting a crude protein solution;

(4) Purification of the crude protein solution with His by affinity chromatography ₆ A tagged fusion protein;

(5) By using a compound having His ₆ Tagged enterokinase cleavage with His ₆ The tagged fusion protein was then removed with His using Ni-NTA resin ₆ A tagged protein, resulting in a purified NCN protein;

plasmid pKG-GE4 has the sequence SEQ ID NO:1, nucleotide 5209-9852.

10. A recombinant porcine cell produced by the method of claim 1 or 8 or 9.

11. Use of the recombinant porcine cell of claim 10 for the preparation of breast cancer model pigs.

12. Pig tissues, pig organs or pig cells of a breast cancer model pig prepared using the recombinant pig cells of claim 10.

13. The recombinant porcine cell of claim 10, the porcine tissue of claim 12, the porcine organ of claim 12, the porcine cell of claim 12, or the breast cancer model porcine prepared by using the recombinant porcine cell of claim 10, wherein the recombinant porcine cell is (d 1) or (d 2) or (d 3) or (d 4):

(d1) Screening a drug for treating breast cancer;

(d2) Evaluating the drug effect of the breast cancer drug;

(d3) Evaluating the curative effect of gene therapy and/or cell therapy of breast cancer;

(d4) The pathogenesis of breast cancer was studied.

Images