CN115786395A - Gene editing system for constructing Huntington's chorea model pig nuclear transplantation donor cell with HTT gene mutation and application thereof - Google Patents

Abstract

The invention discloses a gene editing system for constructing Huntington's disease model pig nuclear transplantation donor cells with HTT gene mutation and application thereof. The invention provides a method for preparing recombinant porcine cells, which comprises the following steps: replacing a target region in the chromosome DNA of the pig cell with a DNA molecule named as DNA molecule A to obtain a recombinant pig cell; the DNA molecule A is (I) or (II) as follows: (I) SEQ ID NO:16 from nucleotide 1734 to nucleotide 2176; (II) SEQ ID NO:16 from nucleotide 1071 to nucleotide 2176; the target region is SEQ ID NO:9, nucleotides 2001-2236. The cloned pig prepared by using the recombinant pig cell through a somatic cell nuclear transfer animal cloning technology can be used as a model pig of Huntington's disease. The invention has great application value for researching and developing the medicine for Huntington's chorea and revealing the pathogenesis of the disease.

Description

Gene editing system for constructing Huntington's chorea model pig nuclear transplantation donor cell with HTT gene mutation and application thereof

Technical Field

The invention belongs to the technical field of biology, particularly belongs to the technical field of gene editing, and more particularly relates to a gene editing system for constructing Huntington's chorea model pig nuclear transplantation donor cells with HTT gene mutation and application thereof.

Background

Huntington's Disease (HD), an autosomal dominant hereditary neurodegenerative disease, commonly occurs in middle-aged patients and manifests as chorea-like movements that gradually lose the ability to speak, move, think and swallow as the disease progresses, which lasts for about 10 to 20 years and eventually leads to death of the patient. The disease was discovered by george, a american medical specialist, in 1872 and was thus named. The main cause of the disease is that the Huntingtin (HTT) gene on the chromosome 4 of a patient is mutated, so that a glutamine tract (polyQ tract) is amplified in the Huntington protein encoded by the HTT gene, the Huntington protein is subjected to folding error, and the protein is gradually gathered together in cells to form a large molecular mass which is accumulated in the brain to influence the function of nerve cells. The penetrance of HD depends on the number of repeats of CAG in polyQ tract, and the length of polyQ tract is inversely related to the age of onset. The PolyQ tracts in normal humans are usually less than 35 CAGs in length, most HD patients carry PolyQ tracts encoded by 37 to 48 CAG repeats, while the HD genes in adolescent patients typically carry PolyQ tracts encoded by more than 55 CAG repeats.

The research on the occurrence and development mechanism of Huntington's disease and the research and development of corresponding drugs are carried out on the basis of animal models, and the currently common animal models are mouse models, however, mice are greatly different from humans in terms of body types, organ sizes, physiology, pathology and the like, and can not truly simulate the normal physiological and pathological states of humans. The pig as a large animal has similar body size and physiological function to human, is easy to breed and feed in large scale, has lower requirements on ethics, animal protection and the like, and is an ideal human disease model animal.

Gene editing is a biotechnology that has been greatly developed in recent years, and includes editing technologies from homologous recombination-based gene editing to nuclease-based ZFNs, TALENs, CRISPR/Cas9, and the like, wherein CRISPR/Cas9 technology is currently the most advanced gene editing technology. Currently, gene editing techniques are increasingly applied to the production of animal models.

Disclosure of Invention

The invention aims to provide a gene editing system for constructing Huntington's disease model pig nuclear transfer donor cells with HTT gene mutation and application thereof.

The invention provides a method for preparing recombinant pig cells, which comprises the following steps: replacing a target region in the chromosome DNA of the pig cell with a DNA molecule named as DNA molecule A to obtain a recombinant pig cell;

the DNA molecule A is (I) or (II) as follows:

(I) SEQ ID NO:16 from nucleotide 1734 to nucleotide 2176;

(II) SEQ ID NO:16 from nucleotide 1071 to nucleotide 2176;

the target region is SEQ ID NO:9, nucleotides 2001-2236.

The replacement of the target region in the chromosomal DNA of the pig cells with the DNA molecule designated DNA molecule A is achieved in that: the sgRNA was synthesized _HTT-gU3 、sgRNA _HTT-gD1 Co-transfecting the pig cell with the donor plasmid and the NCN protein; the donor plasmid has the DNA molecule A therein; the sgRNA _HTT-gU3 Is sgRNA, and the target sequence binding region is shown as SEQ ID NO:19 at nucleotides 3 to 22; the sgRNA _HTT-gD1 Is sgRNA, and the target sequence binding region is shown as SEQ ID NO:20, nucleotides 3 to 22; the NCN protein is a Cas9 protein or a fusion protein with a Cas9 protein.

The co-transfection is specifically a shock transfection.

The parameter settings of the electroporation transfection can be specifically as follows: 1450V, 10ms, 3pulse.

The co-transfection may be specifically carried out using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransfer apparatus.

The invention provides a kit, which comprises sgRNA _HTT-gU3 、sgRNA _HTT-gD1 Donor plasmid and NCN protein.

The invention also provides a kit comprising the sgRNA _HTT-gU3 、sgRNA _HTT-gD1 Donor plasmid and PRONCN protein.

The invention also provides a kit comprising the sgRNA _HTT-gU3 、sgRNA _HTT-gD1 Donor plasmids and tool plasmids.

Any of the kits above further comprising porcine cells.

The invention provides sgRNAs _HTT-gU3 、sgRNA _HTT-gD1 Donor plasmid and NCN protein in the preparation of kits.

The invention also provides sgRNA _HTT-gU3 、sgRNA _HTT-gD1 Donor plasmid and PRONCN protein in the preparation of a kit.

The invention also provides sgRNA _HTT-gU3 、sgRNA _HTT-gD1 The use of a donor plasmid and a tool plasmid for the preparation of a kit.

The use of any one of the above kits is (a) or (b) or (c): (a) preparing a recombinant porcine cell; (b) preparing a model pig for huntington's disease; (c) Preparing a cell model of Huntington's chorea or a tissue model of Huntington's chorea or an organ model of Huntington's chorea.

sgRNA _HTT-gU3 、sgRNA _HTT-gD1 The mixture ratio of the donor plasmid and the NCN protein is as follows in sequence: 0.8-1.2 μ g sgRNA _HTT-gU3 ：0.8-1.2μg sgRNA _HTT-gD1 : 1.8-2.2. Mu.g donor plasmid: 3-5. Mu.g NCN protein.

sgRNA _HTT-gU3 、sgRNA _HTT-gD1 The mixture ratio of the donor plasmid and the NCN protein is as follows in sequence: 1 μ g sgRNA _HTT-gU3 ：1μg sgRNA _HTT-gD1 :2 μ g donor plasmid: mu.g NCN protein.

Pig cells, sgRNA _HTT-gU3 、sgRNA _HTT-gD1 The mixture ratio of the donor plasmid and the NCN protein is as follows in sequence: 20 ten thousand porcine cells: 0.8-1.2 μ g sgRNA _HTT-gU3 ：0.8-1.2μg sgRNA _HTT-gD1 : 1.8-2.2. Mu.g donor plasmid: 3-5. Mu.g NCN protein.

Pig cells, sgRNA _HTT-gU3 、sgRNA _HTT-gD1 The mixture ratio of the donor plasmid and the NCN protein is as follows in sequence: 20 ten thousand porcine cells: 1 μ g sgRNA _HTT-gU3 ：1μg sgRNA _HTT-gD1 :2 μ g donor plasmid: mu.g NCN protein.

Any of the sgRNAs _HTT-gU3 Is sgRNA, and the binding region of the target sequence is shown as SEQ ID NO:19 at nucleotides 3 to 22.

Specifically, the sgRNA _HTT-gU3 As shown in SEQ ID NO:19, respectively.

Specifically, the sgRNA _HTT-gU3 As shown in SEQ ID NO: shown at 12.

Any of the sgRNAs _HTT-gD1 Is sgRNA, and the target sequence binding region is shown as SEQ ID NO:2Nucleotides 3 to 22 of 0.

Specifically, the sgRNA _HTT-gD1 As shown in SEQ ID NO: shown at 20.

Specifically, the sgRNA _HTT-gD1 As shown in SEQ ID NO: shown at 13.

Any of the NCN proteins described above is a Cas9 protein or a fusion protein with a Cas9 protein.

Specifically, the NCN protein is shown as SEQ ID NO:3, respectively.

In particular, the donor plasmid carries a DNA molecule designated DNA molecule B.

The DNA molecule B is shown as SEQ ID NO:16 from nucleotide 1 to nucleotide 2671.

Specifically, the donor plasmid is shown as SEQ ID NO: shown at 16.

Any one of the above porcine cells is a porcine fibroblast.

Any of the above porcine cells are porcine primary fibroblasts.

Any of the above porcine cells are porcine primary fibroblasts obtained from primary pigs.

The preparation method of the NCN protein comprises the following steps:

(1) Introducing the plasmid pKG-GE4 into escherichia coli BL21 (DE 3) to obtain a recombinant strain;

(2) Culturing the recombinant strain by adopting a liquid culture medium at 30 ℃, then adding IPTG (isopropyl-beta-thiogalactoside) and carrying out induced culture at 25 ℃, and then collecting thalli;

(3) Crushing the collected thalli, and collecting a crude protein solution;

(4) Purification of His-bearing protein from the crude protein solution using affinity chromatography ₆ A fusion protein of the tag;

(5) By using a compound having His ₆ Tagged enterokinase cleavage with His ₆ The tagged fusion protein was then removed with His using Ni-NTA resin ₆ A tagged protein, resulting in a purified NCN protein;

plasmid pKG-GE4 has the sequence shown in SEQ ID NO:1, 5209 to 9852 th nucleotide.

The preparation method of the NCN protein specifically comprises the following steps:

(1) The plasmid pKG-GE4 was introduced into E.coli BL21 (DE 3) to obtain a recombinant strain.

(2) Inoculating the recombinant bacteria obtained in the step (1) to a liquid LB culture medium containing ampicillin, and carrying out shake culture;

(3) Inoculating the bacterial liquid obtained in the step (2) to a liquid LB culture medium, and carrying out shaking culture at 30 ℃ and 230rpm until the bacterial liquid is OD _600nm The value =1.0, then IPTG was added to make the concentration in the system 0.5mM, followed by shaking culture at 230rpm at 25 ℃ for 12 hours, and then the cells were collected by centrifugation;

(4) Taking the thalli obtained in the step (3), and washing the thalli with a PBS (phosphate buffer solution);

(5) Adding the crude extraction buffer solution into the thalli obtained in the step (4), suspending the thalli, then crushing the thalli, then centrifugally collecting supernate, filtering by adopting a filter membrane with the aperture of 0.22 mu m, and collecting filtrate;

(6) Purifying the filtrate obtained in step (5) by affinity chromatography to obtain a purified product having His ₆ A fusion protein of the tag (the fusion protein shown in SEQ ID NO: 2);

(7) Taking the post-column solution collected in the step (6), concentrating by using an ultrafiltration tube, and then diluting with 25mM Tris-HCl (pH8.0);

(8) Will have His ₆ Adding the labeled recombinant bovine enterokinase into the solution obtained in the step (7), and performing enzyme digestion;

(9) Mixing the solution obtained in the step (8) with Ni-NTA resin, incubating, centrifuging and collecting supernatant;

(10) And (4) concentrating the supernatant obtained in the step (9) by using an ultrafiltration tube, and then adding the concentrated supernatant into an enzyme stock solution to obtain the NCN protein solution.

Purifying the filtrate obtained in step (5) by affinity chromatography to obtain a purified product having His ₆ The specific method of the labeled fusion protein is as follows:

firstly, balancing a Ni-NTA agarose column by using a balance solution with 5 column volumes (the flow rate is 1 ml/min); then, 50ml of the filtrate obtained in the step (5) is loaded (the flow rate is 0.5-1 ml/min); the column was then washed with 5 column volumes of equilibration solution (flow rate 1 ml/min); the column was then washed with 5 column volumes of buffer (flow rate 1 ml/min) to remove contaminating proteins; then eluting with 10 column volumes of eluent at a flow rate of 0.5-1ml/min, and collecting the solution (90-100 ml) after passing through the column.

Any one of the PRONCN proteins sequentially comprises the following elements from upstream to downstream: signal peptide, molecular chaperone protein, protein tag, protease cleavage site, nuclear localization signal, cas9 protein, nuclear localization signal.

The signal peptide has the function of promoting protein secretion expression. The signal peptide may be selected from the group consisting of the escherichia coli alkaline phosphatase (phoA) signal peptide, the staphylococcus aureus protein a signal peptide, the escherichia coli outer membrane protein (ompa) signal peptide or the signal peptide of any other prokaryotic gene, preferably the alkaline phosphatase signal peptide (phoA signal peptide). The signal peptide of alkaline phosphatase is used to guide the secretory expression of the target protein into the bacterial periplasm cavity so as to be separated from the protein in the bacterial cell, and the target protein secreted into the bacterial periplasm cavity is soluble expression and can be cleaved by the signal peptidase in the bacterial periplasm cavity.

The chaperone protein functions to increase the solubility of the protein. The chaperone may be any protein that assists in the formation of disulfide bonds, preferably a thioredoxin (TrxA protein). The thioredoxin can be used as a molecular chaperone to help a co-expressed target protein (such as a Cas9 protein) to form a disulfide bond, so that the stability and the folding correctness of the protein are improved, and the solubility and the activity of the target protein are increased.

The protein tag functions for protein purification. The Tag can be His Tag (His-Tag, his) ₆ Protein tag), GST tag, flag tag, HA tag, c-Myc tag, or any other protein tag, more preferably His tag. The His tag can be combined with a Ni column, and the target protein can be purified by one-step Ni column affinity chromatography, so that the purification process of the target protein can be greatly simplified.

The protease cleavage site functions to cleave non-functional segments after purification to release the native form of the Cas9 protein. The protease may be selected from Enterokinase (Enterokinase), factor Xa (Factor Xa), thrombin (thrombobin), TEV protease (TEV protease), HRV 3C protease (HRV 3C protease), WELQut protease or any other endoprotease, further preferably Enterokinase. EK is an enterokinase enzyme cutting site, so that fused TrxA-His segment can be conveniently cut by enterokinase to obtain the Cas9 protein in a natural form. After the commodity enterokinase enzyme digestion fusion protein with the His label is used, the TrxA-His section and the enterokinase with the His label can be removed through once affinity chromatography to obtain the Cas9 protein in a natural form, and the damage and the loss of the target protein caused by repeated purification and dialysis are avoided.

The nuclear localization signal may be any nuclear localization signal, preferably an SV40 nuclear localization signal and/or a nucleocapsin nuclear localization signal. NLS is a nuclear localization signal, and NLS sites are respectively designed at the N end and the C end of Cas9, so that Cas9 can more effectively enter a cell nucleus for gene editing.

The Cas9 protein may be saCas9 or spCas9, preferably a spCas9 protein.

The PRONCN protein is specifically shown as SEQ ID NO:2, respectively.

Any one of the above tool plasmids comprises the following elements in sequence from upstream to downstream: promoter, operator, ribosome binding site, PRONCN protein coding gene and terminator.

The promoter may specifically be a T7 promoter. The T7 promoter is a prokaryotic expression strong promoter and can efficiently drive the expression of exogenous genes.

The operon may specifically be a Lac operon. The Lac operon is a regulatory element for lactose-induced expression, and IPTG can be used for inducing the expression of the target protein at low temperature after bacteria grow to a certain amount, so that the influence of the premature expression of the target protein on the growth of host bacteria can be avoided, and the solubility of the expressed target protein can be obviously improved by inducing expression at low temperature.

The ribosome binding site is a ribosome binding site for protein translation, and is essential for protein translation.

The terminator may specifically be a T7 terminator. The T7 terminator can effectively terminate gene transcription at the end of the target gene, and prevents other downstream sequences except the target gene from being transcribed and translated.

For the codon of the spCas9 protein, the codon is optimized, so that the codon preference of the escherichia coli high-efficiency expression strain E.coli BL21 (DE 3) selected by the application is completely adapted, and the expression level of the Cas9 protein is improved.

The T7 promoter is shown as SEQ ID NO:1 from nucleotide 5121 to nucleotide 5139.

The Lac operon is shown as SEQ ID NO:1 from nucleotide 5140 to nucleotide 5164.

The ribosome binding site is shown as SEQ ID NO:1 from nucleotide 5178 to 5201.

The coding sequence of the alkaline phosphatase signal peptide is shown as SEQ ID NO:1, nucleotides 5209-5271.

The coding sequence of the TrxA protein is shown as SEQ ID NO:1, nucleotides 5272-5598.

The coding sequence of His-Tag is shown as SEQ ID NO:1 from nucleotide 5620 to 5637.

The coding sequence of the enterokinase enzyme cutting site is shown as SEQ ID NO:1 from nucleotide 5638 to nucleotide 5652.

The coding sequence of the nuclear localization signal is shown as SEQ ID NO:1 from nucleotide 5656 to nucleotide 5670.

The coding sequence of the spCas9 protein is shown in SEQ ID NO:1, nucleotides 5701-9801.

The coding sequence of the nuclear localization signal is shown as SEQ ID NO:1 from nucleotide 9802 to nucleotide 9849.

The T7 terminator is shown as SEQ ID NO: nucleotides 9902-9949 of 1.

Specifically, the tool plasmid is plasmid pKG-GE4.

Plasmid pKG-GE4 has the sequence shown in SEQ ID NO:1, nucleotides 5121-9949.

Specifically, any one of the plasmids pKG-GE4 is shown as SEQ ID NO:1 is shown.

The invention also protects the recombinant porcine cell prepared by any one of the methods.

The recombinant cell can be specifically a homozygous recombinant porcine cell or a heterozygous recombinant porcine cell.

Compared with porcine cells, the genomic DNA of homozygous recombinant cells differs only in that: the region of interest in the genomic DNA is replaced by the foreign DNA fragment of interest and is homozygous (i.e., the same replacement occurs on both homologous chromosomes).

The genomic DNA of the heterozygous recombinant cells differs compared to the porcine cells only in that: the target region in the genomic DNA is replaced by the target foreign DNA fragment and is heterozygous (i.e., one chromosome of a pair of homologous chromosomes is replaced and the other chromosome is not replaced).

The target exogenous DNA fragment is shown as SEQ ID NO: nucleotide numbers 1071-2176 in 16.

The target region is shown as SEQ ID NO:9 from nucleotides 2001 to 2236.

The invention also protects the application of the recombinant porcine cell in preparing Huntington's disease model pigs.

The recombinant pig cell is used as a nuclear transfer donor cell to carry out somatic cell cloning, so that a cloned pig, namely the Huntington's chorea model pig can be obtained.

The invention also protects pig tissues of the model pig prepared by the recombinant pig cells, namely a Huntington's disease tissue model.

The invention also protects a pig organ of a model pig prepared by using the recombinant pig cell, namely a Huntington's disease organ model.

The invention also protects the pig cell of the model pig prepared by the recombinant pig cell, namely a Huntington's chorea cell model.

The invention also protects the application of the recombinant pig cell, the Huntington's disease tissue model, the Huntington's disease organ model, the Huntington's disease cell model or the Huntington's disease model pig, which is (d 1) or (d 2) or (d 3) or (d 4) as follows:

(d1) Screening for a drug for treating Huntington's disease;

(d2) Performing drug effect evaluation of the Huntington's disease drug;

(d3) Performing an evaluation of the efficacy of gene therapy and/or cell therapy for Huntington's disease;

(d4) The pathogenesis of Huntington's disease was studied.

Any one of the pigs may be a Yuanjiang fragrant pig.

Any one of the pigs may be a newborn Zingjiang Xiang pig.

Any of the pigs may specifically be Bama miniature pigs.

Any of the pigs may specifically be newborn Bama miniature pigs.

Compared with the prior art, the invention has at least the following beneficial effects:

(1) The subject of the invention (pig) has better applicability than other animals (rats, mice, primates).

Rodents such as rats and mice have great differences from humans in body types, organ sizes, physiology, pathology and the like, and cannot truly simulate normal physiological and pathological states of humans. Studies have shown that over 95% of drugs validated to be effective in large mice are not effective in human clinical trials. In large animals, primates are animals that have a close relationship with humans, but are small in size, late in sexual maturity (mating starts at age 6-7), and are single-birth animals, and the population propagation speed is extremely slow, and the raising cost is high. In addition, the cloning efficiency of the primate is low, the difficulty is high and the cost is high.

However, pigs, which are animals related to humans other than primates, do not have the above-mentioned disadvantages, and have body types, body weights, organ sizes, and the like similar to those of humans, and are very similar to those of humans in terms of anatomy, physiology, immunology, nutritional metabolism, disease pathogenesis, and the like. Meanwhile, the pigs have early sexual maturity (4-6 months), high reproductive capacity and multiple piglets, and can form a large group within 2-3 years. In addition, the cloning technology of the pig is very mature, and the cloning and breeding cost is much lower than that of the primate. Pigs are therefore very suitable animals as models for human diseases.

(2) The vector constructed by the invention uses a strong promoter T7-lac which can express target protein with high efficiency to express the target protein, and uses a signal peptide of bacterial periplasmic protein alkaline phosphatase (phoA) to guide the secretion and expression of the target protein to a bacterial periplasm cavity, so that the target protein is separated from the bacterial intracellular protein and is expressed in a soluble way. Meanwhile, the thioredoxin TrxA and the Cas9 protein are fused and expressed, the TrxA can help the coexpressed target protein to form a disulfide bond, the stability and the folding correctness of the protein are improved, and the solubility and the activity of the target protein are increased. In order to facilitate the purification of the target protein, the His tag is designed, and the target protein can be purified through one-step Ni column affinity chromatography, so that the purification process of the target protein is greatly simplified. Meanwhile, an enterokinase enzyme cutting site is designed behind the His tag, so that the fused TrxA-His polypeptide fragment can be conveniently cut off, and the Cas9 protein in a natural form can be obtained. After the fusion protein is digested by using the enterokinase with the His tag, the TrxA-His polypeptide fragment and the enterokinase with the His tag can be removed through one-time affinity chromatography to obtain the Cas9 protein in a natural form, so that the damage and loss of the target protein caused by multiple times of purification dialysis are avoided. Meanwhile, an NLS site is respectively designed at the N end and the C end of the Cas9, so that the Cas9 can more effectively enter a cell nucleus for gene editing. In addition, the E.coli BL21 (DE 3) strain is selected as a target protein expression strain, and the strain can efficiently express and clone a foreign gene of an expression vector (such as pET-32 a) containing a bacteriophage T7 promoter. Meanwhile, as for the codon of the Cas9 protein, the codon optimization is carried out, so that the codon preference of the expression strain is completely adapted, and the expression level of the target protein is improved. In addition, after the bacteria grow to a certain amount, IPTG is used for inducing the expression of the target protein at low temperature, so that the influence of the premature expression of the target protein on the growth of host bacteria can be avoided, and the solubility of the expressed target protein is also obviously improved by inducing the expression at low temperature. Through the optimization design and experimental implementation, the activity of the obtained Cas9 protein is remarkably improved compared with that of a commercial Cas9 protein.

(3) The obtained recombinant cell can be used for somatic cell nuclear transfer animal cloning to directly obtain a cloned pig with target recombination, and the gene variation can be stably inherited.

The invention adopts CRISPR/Cas9 system and homologous recombination technology to prepare recombinant pig cells with target foreign DNA segments replacing target regions in genome DNA. The cloned pig prepared by somatic cell nuclear transfer animal cloning technology can be used as a Huntington's disease model pig. The invention is helpful for researching and revealing the pathogenesis of Huntington chorea caused by HTT gene dysfunction, can also be used for researching drug screening, drug effect evaluation, gene therapy, cell therapy and the like, can provide effective experimental data for further clinical application, and further provides a powerful experimental means for successfully treating human Huntington chorea. The invention has great application value for researching and developing the Huntington's disease medicine and disclosing the pathogenesis of the disease.

Drawings

FIG. 1 is a schematic diagram of the structure of plasmid pET-32 a.

FIG. 2 is a schematic diagram of the structure of plasmid pKG-GE4.

FIG. 3 is an electrophoretogram of the optimized dosage ratio of gRNA and NCN protein in example 2.

Fig. 4 is an electrophoretogram comparing gene editing efficiency of NCN protein and a commercial Cas9 protein in example 2.

FIG. 5 is an electrophoretogram of PCR amplification in example 3 using primer pairs consisting of HTT-E1-JDF1925 and HTT-E1-JDR2875, respectively, with genomic DNA from 10 pigs as a template.

FIG. 6 shows the structure of plasmid PB-purOR-hHTTex1 (81Q).

FIG. 7 is an electrophoretogram for identifying whether the recombination of the 5' end of the target foreign DNA fragment of the recombinant cell was successful in example 4.

FIG. 8 is an electrophoretogram for identifying whether the recombination of the 3' end of the target foreign DNA fragment of the recombinant cell was successful in example 4.

FIG. 9 is an electrophoretogram for identifying whether a recombinant cell target foreign DNA fragment is homozygous or heterozygous integrated in example 4.

FIG. 10 is a sequencing peak of the upstream primer for sequencing the PCR product of the target foreign DNA for single cell clone numbered 1.

FIG. 11 is a sequencing peak of the downstream primer for single cell clone number 1 sequencing the target exogenous DNA PCR product.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified. The recombinant plasmids constructed in the examples were all sequence verified. The commercial Cas9-A protein is a commercial Cas9 protein with good effect. The commercial Cas9-B protein is a commercial Cas9 protein with good effect. Complete culture broth (% by volume): 15% fetal bovine serum (Gibco) +83% DMEM medium (Gibco) +1% Penicilin-Streptomyces (Gibco) +1% HEPES (Solarbio). Cell culture conditions: 37 ℃ C., 5% CO ₂ 、5％O ₂ The constant temperature incubator.

The porcine primary fibroblasts used in example 2 were all prepared from porcine ear tissue, which was freshly obtained from Jiangxiang pigs. The porcine primary fibroblasts used in example 3 and example 4 were prepared from neonatal Bama miniature pig ear tissue. The method for preparing the primary pig fibroblasts by using the pig ear tissues comprises the following steps: (1) taking 0.5g of pig ear tissue, removing hair and bone tissue, soaking in 75% alcohol for 30-40s, washing with PBS buffer containing 5% (volume ratio) Penicillin-Streptomycin (Gibco) for 5 times, and washing with PBS buffer for one time; (2) shearing the tissue with scissors, digesting with 5mL of 0.1% collagenase solution (Sigma) at 37 ℃ for 1h, centrifuging 500g for 5min, and removing the supernatant; (3) resuspending the precipitate with 1mL of complete culture solution, spreading into a 10cm diameter cell culture dish containing 10mL of complete culture solution and sealed with 0.2% gelatin (VWR), and culturing until the bottom of the dish is 60% full of cells; (4) after completion of step (3), the cells were digested with trypsin and collected, and then resuspended in complete medium. Used for carrying out subsequent electrotransfer experiments.

Example 1 preparation and purification of NCN protein

1. Construction of prokaryotic Cas9 high-efficiency expression vector

The structure of plasmid pET-32a is schematically shown in FIG. 1.

The plasmid pKG-GE4 is obtained by modifying plasmid pET-32a serving as a starting plasmid. Plasmid pET32a-T7lac-phoA SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (plasmid pKG-GE4 for short), as shown in SEQ ID NO:1, is a circular plasmid, and the structural schematic diagram is shown in figure 2.

SEQ ID NO:1, the 5121-5139 th nucleotide constitutes T7 promoter, the 5140-5164 th nucleotide encodes Lac operator (Lac operator), the 5178-5201 th nucleotide constitutes Ribosome Binding Site (RBS), the 5209-5271 th nucleotide encodes alkaline phosphatase signal peptide (phoA signal peptide), the 5272-5598 th nucleotide encodes TrxA protein, and the 5620-5637 th nucleotide encodes His-Tag (also called His-Tag) ₆ Tag), 5638-5652 nucleotides encode enterokinase cleavage site (EK cleavage site), 5656-5670 nucleotides encode nuclear localization signal, 5701-9801 nucleotides encode spCas9 protein, 9802-9849 nucleotides encode nuclear localization signal, and 9902-9949 nucleotides constitute T7 terminator. The nucleotides encoding the spCas9 protein have been codon optimized for the e.coli BL21 (DE 3) strain.

The main modifications of plasmid pKG-GE4 are as follows: (1) the encoding region of the TrxA protein is reserved, and the TrxA protein can help the expressed target protein to form a disulfide bond and increase the solubility and the activity of the target protein; adding a coding sequence of an alkaline phosphatase signal peptide before a coding region of the TrxA protein, wherein the alkaline phosphatase signal peptide can guide the expressed target protein to be secreted into the periplasmic cavity of the bacteria and can be cut by prokaryotic periplasmic signal peptidase; (2) adding a coding sequence of His-Tag after the coding sequence of the TrxA protein, wherein the His-Tag can be used for enriching the expressed target protein; (3) adding the coding sequence of an enterokinase enzyme cutting site DDDDK (Asp-Asp-Asp-Asp-Lys) at the downstream of the coding sequence of the His-Tag, and removing the His-Tag and the upstream fused TrxA protein by the purified protein under the action of enterokinase; (4) the Cas9 gene which is suitable for being expressed by an escherichia coli BL21 (DE 3) strain after codon optimization is inserted, and meanwhile, the nuclear localization signal coding sequence is added at the upstream and the downstream of the gene, so that the nuclear localization capability of the Cas9 protein purified at the later stage is improved.

The fusion gene in the plasmid pKG-GE4 is shown as SEQ ID NO:1, nucleotides 5209 to 9852 of SEQ ID NO:2 (fusion protein TrxA-His-EK-NLS-spCas9-NLS, abbreviated as PRONCN protein). Due to the existence of the alkaline phosphatase signal peptide and the enterokinase enzyme cutting site, the fusion protein is cut by enterokinase enzyme to form SEQ ID NO:3, the protein shown in SEQ ID NO: the protein shown in 3 is named NCN protein.

2. Inducible expression

1. The plasmid pKG-GE4 was introduced into E.coli BL21 (DE 3) to obtain a recombinant strain.

2. The recombinant strain obtained in step 1 was inoculated into a liquid LB medium containing 100. Mu.g/ml ampicillin and cultured overnight at 37 ℃ with shaking at 200 rpm.

3. Inoculating the bacterial liquid obtained in the step 2 to a liquid LB culture medium, and performing shaking culture at 30 ℃ and 230rpm until the bacterial liquid is OD _600nm The value =1.0, isopropyl thiogalactoside (IPTG) was added to make the concentration in the system 0.5mM, and the mixture was subjected to shaking culture at 230rpm at 25 ℃ for 12 hours, then centrifuged at 10000 ℃ for 15 minutes at 4 ℃ to collect the cells.

4. The cells obtained in step 3 were washed with PBS buffer.

3. Purification of fusion protein TrxA-His-EK-NLS-spCas9-NLS

1. And (3) adding the crude extraction buffer solution into the thalli obtained in the step two, suspending the thalli, then crushing the thalli by a homogenizer (1000 par circulation is carried out for three times), then centrifuging for 30min at 4 ℃ at 15000g, collecting supernate, filtering the supernate by a filter membrane with the aperture of 0.22 mu m, and collecting filtrate. In this step, 10ml of crude extraction buffer solution is prepared for each g of wet-weight thallus.

Crude extraction buffer: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 5mM Imidazole, 1mM PMSF, and the balance ddH ₂ O。

2. The fusion protein was purified by affinity chromatography.

Firstly, balancing a Ni-NTA agarose column by using a balance solution with 5 column volumes (the flow rate is 1 ml/min); then 50ml of the filtrate obtained in step 1 was loaded (flow rate 0.5-1 ml/min); the column was then washed with 5 column volumes of equilibration solution (flow rate 1 ml/min); the column was then washed with 5 column volumes of buffer (flow rate 1 ml/min) to remove contaminating proteins; then eluting with 10 column volumes of eluent at a flow rate of 0.5-1ml/min, and collecting the solution (90-100 ml) after passing through the column.

Ni-NTA agarose column: kinseri, L00250/L00250-C, 10ml of packing.

Balance liquid: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 5mM Imidazole, and the balance ddH ₂ O。

Buffer solution: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 50mM Imidazole, and the balance ddH ₂ O。

Eluent: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 500mM Imidazole, and the balance ddH ₂ O。

4. Enzyme digestion of fusion protein TrxA-His-EK-NLS-spCas9-NLS and purification of NCN protein

1. 15ml of the post-column solution collected in step three was concentrated to 200. Mu.l using Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml) and then diluted to 1ml with 25mM Tris-HCl (pH 8.0). 6 ultrafiltration tubes were used to give a total of 6ml.

2. Providing commercial source with His ₆ Tagged recombinant bovine enterokinase (biol. C620031, recombinant bovine enterokinase light chain with His ₆ The tag, recombinant Bovine Enterokinase Light Chain, his), was added to the solution (about 6 ml) obtained in step 1, and cleaved at 25 ℃ for 16 hours. 2 units of enterokinase are added in the amount of each 50 mug protein.

3. The solution (about 6 ml) that completed step 2 was taken, mixed with 480. Mu.l of Ni-NTA resin (Kinseri, L00250/L00250-C), mixed well by rotation at room temperature for 15min, then centrifuged at 7000g for 3min, and the supernatant (4-5.5 ml) was collected.

4. And (3) taking the supernatant obtained in the step (3), concentrating the supernatant to 200 mu l by using an Amicon ultrafiltration tube (Sigma, UFC9100, the volume of which is 15 ml), adding the concentrated solution into an enzyme stock solution, and adjusting the protein concentration to be 5mg/ml to obtain the NCN protein solution.

And (3) sequencing the protein in the NCN protein solution, wherein the 15N-terminal amino acid residues are shown as SEQ ID NO:3, positions 1 to 15, i.e., the NCN protein.

The NCN protein used in the subsequent examples was provided by NCN protein solution.

Enzyme stock solution (ph 7.4): containing 10mM Tris,300mM NaCl,0.1mM EDTA,1mM DTT,50% (by volume) glycerol, and the balance ddH ₂ O。

Example 2 Performance of NCN proteins

The 2 gRNA targets targeting the TTN gene were selected as follows:

TTN-gRNA1 target: AGAGCACAGTCAGCCTGGCG;

TTN-gRNA2 target: CTTCCAGAATTGGATCTCCG.

Primers used to identify target fragments comprising grnas in the TTN gene were as follows:

TTN-F55：TACGGAATTGGGGAGCCAGCGGA；

TTN-R560：CAAAGTTAACTCTCTGTGTCT。

1. preparation of gRNA

1. Preparing TTN-T7-gRNA1 transcription template and TTN-T7-gRNA2 transcription template

The TTN-T7-gRNA1 transcription template is a double-stranded DNA molecule, and is shown as SEQ ID NO:4, respectively.

The TTN-T7-gRNA2 transcription template is a double-stranded DNA molecule, and is shown as SEQ ID NO:5, respectively.

2. In vitro transcription to obtain gRNA

Taking TTN-T7-gRNA1 Transcription template, adopting a Transcription Aid T7 High Yield Transcription Kit (Fermentas, K0441) to carry out in vitro Transcription, and then using MEGA clear ^TM The Transcription Clean-Up Kit (Thermo, AM 1908) was recovered and purified to obtain TTN-gRNA1.TTN-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: and 6.

Taking TTN-T7-gRNA2 Transcription template, adopting a Transcription Aid T7 High Yield Transcription Kit (Fermentas, K0441) to carry out in vitro Transcription, and then using MEGA clear ^TM The Transcription Clean-Up Kit (Thermo, AM 1908) was recovered and purified to obtain TTN-gRNA2.TTN-gRNA2 is a single-stranded RNA, as shown in SEQ ID NO: shown at 7.

2. gRNA and NCN protein dosage proportion optimization

1. Co-transfected porcine primary fibroblasts

A first group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN proteins. Proportioning: about 10 million porcine primary fibroblasts: 0.5 μ g TTN-gRNA1:0.5 μ g TTN-gRNA2: mu.g NCN protein.

Second group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN proteins. Proportioning: about 10 million porcine primary fibroblasts: 0.75 μ g TTN-gRNA1:0.75 μ g TTN-gRNA2: mu.g NCN protein.

Third group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN proteins. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2: mu.g NCN protein.

And a fourth group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN proteins. Proportioning: about 10 million porcine primary fibroblasts: 1.25 μ g TTN-gRNA1:1.25 μ g TTN-gRNA2: mu.g NCN protein.

And a fifth group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1 and TTN-gRNA2. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2.

Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).

2. After step 1, the culture is carried out for 12 to 18 hours by using the complete culture solution, and then the culture is carried out by replacing the complete culture solution with a new one. The total time of incubation after electroporation was 48 hours.

3. After completion of step 2, cells were digested with trypsin and collected, genomic DNA was extracted, PCR amplified using a primer pair consisting of TTN-F55 and TTN-R560, and then subjected to 1% agarose gel electrophoresis.

The electrophoretogram is shown in FIG. 3. The 505bp band is a wild-type band (WT), and the about 254bp band (the wild-type band is 505bp theoretically deleted by 251 bp) is a deletion mutant band (MT).

Gene deletion mutation efficiency = (MT grayscale/MT band bp number)/(WT grayscale/WT band bp number + MT grayscale/MT band bp number) × 100%. The deletion mutation efficiency of the first group of genes is 19.9 percent, the deletion mutation efficiency of the second group of genes is 39.9 percent, the deletion mutation efficiency of the third group of genes is 79.9 percent, and the deletion mutation efficiency of the fourth group of genes is 44.3 percent. The fifth group was not mutated.

The result shows that when the mass ratio of the two gRNAs to the NCN protein is 1:1:4, actual dosage is 1 mu g:1 μ g: the gene editing efficiency is highest at 4 mug. Thus, the optimal amount of two grnas and NCN proteins was determined to be 1 μ g:1 μ g:4 μ g.

3. Comparison of Gene editing efficiency of NCN protein with that of the commercial Cas9 protein

1. Co-transfected primary porcine fibroblasts

Cas9-a group: co-transfecting TTN-gRNA1, TTN-gRNA2 and a commercial Cas9-A protein to a porcine primary fibroblast. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2:4 μ g Cas9-A protein.

pKG-GE4 group: co-transfecting the porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2 and NCN proteins. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2: mu.g NCN protein.

Cas9-B group: co-transfecting the TTN-gRNA1, the TTN-gRNA2 and a commercial Cas9-B protein into a pig primary fibroblast. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2:4 μ g Cas9-B protein.

Control group: co-transfecting the TTN-gRNA1 and the TTN-gRNA2 to the pig primary fibroblasts. Proportioning: about 10 million porcine primary fibroblasts: 1 μ g TTN-gRNA1:1 μ g TTN-gRNA2.

Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).

2. After the completion of step 1, the culture is carried out for 12 to 18 hours by using the complete culture solution, and then the culture is carried out by replacing with a new complete culture solution. The total time of incubation after electroporation was 48 hours.

3. After completion of step 2, cells were digested with trypsin and collected, genomic DNA was extracted, PCR amplified using a primer pair consisting of TTN-F55 and TTN-R560, and then subjected to 1% agarose gel electrophoresis.

The electrophoretogram is shown in FIG. 4. The gene deletion mutation efficiency with the commercial Cas9-a protein was 28.5%, the gene deletion mutation efficiency with the NCN protein was 85.6%, and the gene deletion mutation efficiency with the commercial Cas9-B protein was 16.6%.

The result shows that compared with the Cas9 protein which adopts a commodity, the NCN protein prepared by the invention can obviously improve the gene editing efficiency.

Example 3 screening of efficient gRNA targets of HTT genes

Porcine HTT gene information: encoding huntingtin protein; is located on chromosome 8; gene ID is 39014, sus scrofa. The amino acid sequence of the protein coded by the pig HTT gene is shown as SEQ ID NO: shown in fig. 8. In the pig genome DNA, the HTT gene has 69 exons, the 1 st coding exon and the upstream 2000bp and the downstream 1000bp thereof are shown as SEQ ID NO: shown at 9.

Plasmid pKG-GE3, a circular plasmid, as described in patent application 202010084343.6 SEQ ID NO:2, respectively. SEQ ID NO:2, nucleotides 395 to 680 form a CMV enhancer, nucleotides 682 to 890 form an EF1a promoter, nucleotides 986 to 1006 encode a Nuclear Localization Signal (NLS), nucleotides 1016 to 1036 encode a Nuclear Localization Signal (NLS), nucleotides 1037 to 5161 encode a Cas9 protein, nucleotides 5162 to 5209 encode a Nuclear Localization Signal (NLS), nucleotides 5219 to 5266 encode a Nuclear Localization Signal (NLS), nucleotides 5276 to 5332 encode a polypeptide P2A (the amino acid sequence of the polypeptide P2A is "ATNFSLLKQAGDVEENPGP", the cleavage position is between the first and second amino acid residues from the C-terminal end), nucleotides 5333 to 6046 encode an EGFP protein, nucleotides 6056 to 6109 encode a polypeptide T2A (the amino acid sequence of the polypeptide T2A is "EGRGSLLTCGDVEENPGP", the cleavage position is between the first and second amino acid residues from the C-terminal end), nucleotides 6110 to 6703 encode a polypeptide T2A (the amino acid sequence of the polypeptide T2A is "EGRGSLLTCGDVEENPGP", the cleavage position is between the first and the second amino acid residue from the C-terminal end), nucleotides 6110 to 6703 constitute a WPbx 6747 element sequence, and the nucleotide sequence of GH 7647, or simply called GH 761 element. SEQ ID NO:2, the 911-6706 th nucleotides form fusion gene to express fusion protein. Due to the presence of the self-cleaving polypeptide P2A and the self-cleaving polypeptide T2A, the fusion protein spontaneously forms the following three proteins: proteins with Cas9 protein, proteins with EGFP protein and proteins with Puro protein.

The pKG-U6gRNA vector, plasmid pKG-U6gRNA, is a circular plasmid, as described in patent application 202010084343.6, SEQ ID NO:3, respectively. SEQ ID NO:3, the 2280 th to 2539 th nucleotides form the hU6 promoter, and the 2558 th to 2637 th nucleotides are used for transcription to form a gRNA framework. When the recombinant plasmid is used, a DNA molecule (a target sequence binding region for forming gRNA through transcription) of about 20bp is inserted into the plasmid pKG-U6gRNA to form a recombinant plasmid, and the recombinant plasmid is transcribed in a cell to obtain the gRNA.

1. Conservation analysis of predetermined deletion region and adjacent genome sequence of HTT gene

10 newborn Bama miniature pigs, 6 female pigs (named as BC1, BC2, BC3, BC4, BC5 and BC6 respectively) and 4 male pigs (named as BX1, BX2, BX3 and BX4 respectively).

HTT-E1-JDF1925：CGTCTTTGGTTGTCAATCCCG；

HTT-E1-JDR2875：CTAAACAGCGCACCACGAAC。

10 pig genome DNA was used as templates, PCR amplification was performed using primer pairs consisting of HTT-E1-JDF1925 and HTT-E1-JDR2875, and then 1% agarose gel electrophoresis was performed. The electrophoretogram is shown in FIG. 5. And recovering PCR amplification products, sequencing, and comparing and analyzing the sequencing result with the HTT gene sequence in the public database. A conserved region common to 10 pigs was selected for gRNA target design.

2. Screening target spots

And primarily screening a plurality of targets by screening NGG (avoiding possible mutation sites), and further screening 6 targets from the NGG through a preliminary experiment.

The 6 targets were as follows:

HTT-E1-gU target: CGCTGCTGAGCGGAGCCCCG;

HTT-E1-gU target: CTTTTCCAGGGTCGCCATGG;

HTT-E1-gU target: AGCTTTCATCAGCTTTTCCA.

HTT-E1-gD1 target: AGGGGGCCCGCACTCACGGT;

HTT-E1-gD2 target: CGCACTCACGGTCGGTGCAG;

HTT-E1-gD3 target: CGCTGCACCGACCGTGAGTG.

3. Preparation of gRNA

The plasmid pKG-U6gRNA was digested with the restriction enzyme BbsI, and the vector backbone (approximately 3kb linear large fragment) was recovered.

HTT-E1-gU-S and HTT-E1-gU-A are synthesized respectively, and then mixed and annealed to obtain double-stranded DNA molecules with cohesive ends. The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (HTT-E1-gU). Plasmid pKG-U6gRNA (HTT-E1-gU) expresses the nucleic acid sequence of SEQ ID NO:10 sgRNA _HTT-E1-gU1 。sgRNA _HTT-E1-gU1 (SEQ ID NO：10)：

CGCUGCUGAGCGGAGCCCCGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

HTT-E1-gU-S and HTT-E1-gU-A are synthesized respectively, and then mixed and annealed to obtain double-stranded DNA molecules with cohesive ends. The double-stranded DNA molecule with sticky ends is connected with a vector framework to obtain a plasmid pKG-U6gRNA (HTT-E1-gU 2). Plasmid pKG-U6gRNA (HTT-E1-gU) expresses the nucleic acid sequence of SEQ ID NO:11 sgRNA _HTT-E1-gU2 。sgRNA _HTT-E1-gU2 (SEQ ID NO：11)：

CUUUUCCAGGGUCGCCAUGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

HTT-E1-gU-S and HTT-E1-gU-A are synthesized respectively, and then mixed and annealed to obtain double-stranded DNA molecules with cohesive ends. The double-stranded DNA molecule with sticky ends was ligated to a vector backbone to obtain plasmid pKG-U6gRNA (HTT-E1-gU). Plasmid pKG-U6gRNA (HTT-E1-gU) expresses the nucleic acid sequence of SEQ ID NO:12 sgRNA _HTT-E1-gU3 。sgRNA _HTT-E1-gU3 (SEQ ID NO：12)：

AGCUUUCAUCAGCUUUUCCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

Separate Synthesis of HTT-E1-gD1-S and HTT-E1-gD1-A, then mixed and annealed to give a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (HTT-E1-gD 1). Plasmid pKG-U6gRNA (HTT-E1-gD 1) expresses the nucleic acid sequence of SEQ ID NO:13 sgRNA _HTT-E1-gD1 。sgRNA _HTT-E1-gD1 (SEQ ID NO：13)：

AGGGGGCCCGCACUCACGGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

HTT-E1-gD2-S and HTT-E1-gD2-A are synthesized respectively, and then mixed and annealed to obtain the double-stranded DNA molecule with the cohesive end. The double-stranded DNA molecule having the cohesive ends was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (HTT-E1-gD 2). Plasmid pKG-U6gRNA (HTT-E1-gD 2) expresses the nucleic acid sequence of SEQ ID NO:14 sgRNA _HTT-E1-gD2 。sgRNA _HTT-E1-gD2 (SEQ ID NO：14)：

CGCACUCACGGUCGGUGCAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

HTT-E1-gD3-S and HTT-E1-gD3-A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having a cohesive end. The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (HTT-E1-gD 3). Plasmid pKG-U6gRNA (HTT-E1-gD 3) expresses the nucleic acid sequence of SEQ ID NO:15 sgRNA _HTT-E1-gD3 。sgRNA _HTT-E1-gD3 (SEQ ID NO：15)：

CGCUGCACCGACCGUGAGUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

HTT-E1-gU1-S：caccgCGCTGCTGAGCGGAGCCCCG；

HTT-E1-gU1-A：aaacCGGGGCTCCGCTCAGCAGCGc；

HTT-E1-gU2-S：caccgCTTTTCCAGGGTCGCCATGG；

HTT-E1-gU2-A：aaacCCATGGCGACCCTGGAAAAGc；

HTT-E1-gU3-S：caccgAGCTTTCATCAGCTTTTCCA；

HTT-E1-gU3-A：aaacTGGAAAAGCTGATGAAAGCTc；

HTT-E1-gD1-S：caccgAGGGGGCCCGCACTCACGGT；

HTT-E1-gD1-A：aaacACCGTGAGTGCGGGCCCCCTc；

HTT-E1-gD2-S：caccgCGCACTCACGGTCGGTGCAG；

HTT-E1-gD2-A：aaacCTGCACCGACCGTGAGTGCGc；

HTT-E1-gD3-S：caccgCGCTGCACCGACCGTGAGTG；

HTT-E1-gD3-A：aaacCACTCACGGTCGGTGCAGCGc。

HTT-E1-gU-S, HTT-E1-gU1-A, HTT-E1-gU2-S, HTT-E1-gU-A, HTT-E1-gU-S, HTT-E1-gU3-A, HTT-E1-gD1-S, HTT-E1-gD1-A, HTT-E1-gD2-S, HTT-E1-gD2-A, HTT-E1-gD3-S, HTT-E1-gD3-A are single-stranded DNA molecules.

4. Comparison of editing efficiency for different target combinations

1. Cotransfection

A first group: the plasmid pKG-U6gRNA (HTT-E1-gU 1) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. Mu.g of plasmid pKG-U6gRNA (HTT-E1-gU): 1.08. Mu.g of plasmid pKG-GE3.

Second group: the plasmid pKG-U6gRNA (HTT-E1-gU 2) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. Mu.g of plasmid pKG-U6gRNA (HTT-E1-gU 2): 1.08. Mu.g of plasmid pKG-GE3.

Third group: the plasmid pKG-U6gRNA (HTT-E1-gU 3) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. Mu.g of plasmid pKG-U6gRNA (HTT-E1-gU): 1.08. Mu.g of plasmid pKG-GE3.

And a fourth group: the plasmid pKG-U6gRNA (HTT-E1-gD 1) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 ten thousand porcine primary fibroblasts: 0.92. Mu.g of plasmid pKG-U6gRNA (HTT-E1-gD 1): 1.08. Mu.g of plasmid pKG-GE3.

And a fifth group: the plasmid pKG-U6gRNA (HTT-E1-gD 2) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. Mu.g of plasmid pKG-U6gRNA (HTT-E1-gD 2): 1.08. Mu.g of plasmid pKG-GE3.

A sixth group: the plasmid pKG-U6gRNA (HTT-E1-gD 3) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 0.92. Mu.g of plasmid pKG-U6gRNA (HTT-E1-gD 3): 1.08. Mu.g of plasmid pKG-GE3.

A seventh group: carrying out electrotransformation operation on primary pig fibroblasts with the same electrotransformation parameters and without plasmids.

Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).

2. After step 1, the culture is carried out for 12 to 18 hours by using the complete culture solution, and then the culture is carried out by replacing the complete culture solution with a new one. The total time of incubation after electroporation was 48 hours.

3. After step 2 was completed, cells were digested with trypsin and collected, lysed, genomic DNA was extracted, PCR amplified using a primer pair consisting of HTT-E1-JDF1925 and HTT-E1-JDR2875, and then subjected to 1% agarose gel electrophoresis. And detecting the mutation condition of the target gene of the cell.

And cutting and recycling the target product, then sending the target product to a sequencing company for sequencing, and analyzing a sequencing peak map by using a webpage version Synthego ICE tool to obtain the gene editing efficiency of different targets. The gene editing efficiencies of the first group, the second group, the third group, the fourth group, the fifth group and the sixth group are 15%, 28%, 48%, 65%, 32% and 8% in sequence, and the gene editing does not occur in the seventh group. The results show that sgRNA _HTT-E1-gU3 And sgRNA _HTT-E1-gD1 The editing efficiency is high.

Example 4 preparation of HTT Gene recombinant monoclonal clones of Bama miniature pigs

1. Construction of PB-purOR-hHTTex1 (81Q) Donor vector

PB-purOR-hHTTex1 (81Q) Donor vector, i.e., plasmid PB-purOR-hHTTex1 (81Q).

Plasmid PB-purOR-hHTTex1 (81Q) is shown in SEQ ID NO:16, which is a circular plasmid, and the structure schematic diagram is shown in FIG. 6.SEQ ID NO:16, nucleotides 1-1070 constitute the upstream Arm of homology (Left Arm), and nucleotides 1071-1667 encode the Puromycin resistance protein (Puro for short) ^R Protein), nuclei 1677 to 1733)The nucleotide codes for P2A polypeptide (the amino acid sequence of P2A polypeptide is 'ATNFSLLKQAGDVEENPGP', the cleavage position of the self-cleavage is between the first amino acid residue and the second amino acid residue from the C terminal), the nucleotides at positions 1734-2176 are exon 1 of the human HTT gene (the encoded protein segment has 81 continuous amino acid residues Q) used for replacing exon 1 of the porcine HTT gene, and the nucleotides at positions 2177-2671 form a downstream homology Arm (Right Arm).

2. Preparation of gRNA

Two high-efficiency gRNA targets (HTT-E1-gU target and HTT-E1-gD1 target) screened in the embodiment 3 are selected.

1. Preparation of HTT-T7-gU transcription template and HTT-T7-gD1 transcription template

The HTT-T7-gU3 transcription template is a double-stranded DNA molecule, and is shown as SEQ ID NO: shown at 17.

The HTT-T7-gD1 transcription template is a double-stranded DNA molecule, and is shown as SEQ ID NO:18, respectively.

2. In vitro transcription to obtain gRNA

Taking HTT-T7-gU Transcription template, adopting Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) to make in vitro Transcription, then using MEGA clear ^TM The sgRNA was obtained by recovering and purifying the Transcription Clean-Up Kit (Thermo, AM 1908) _HTT-gU3 。sgRNA _HTT-gU3 Is single-stranded RNA, as shown in SEQ ID NO: as shown at 19.

Taking HTT-T7-gD1 Transcription template, adopting a Transcription Aid T7 High Yield Transcription Kit (Fermentas, K0441) to carry out in vitro Transcription, and then using MEGA clear ^TM The sgRNA was obtained by recovering and purifying the Transcription Clean-Up Kit (Thermo, AM 1908) _HTT-gD1 。sgRNA _HTT-gD1 Is single-stranded RNA, as shown in SEQ ID NO: shown at 20.

sgRNA _HTT-gU3 (SEQ ID NO：19)：

GGAGCUUUCAUCAGCUUUUCCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

sgRNA _HTT-gD1 (SEQ ID NO：20)：

GGAGGGGGCCCGCACUCACGGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

3. Transfection of porcine primary fibroblasts

The sgRNA was synthesized _HTT-gU3 、sgRNA _HTT-gD1 Plasmid PB-purOR-hHTTex1 (81Q) and NCN protein co-transfected porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 1 μ g sgRNA _HTT-gU3 ：1μg sgRNA _HTT-gD1 :2 μ g plasmid PB-purOR-hHTTex1 (81Q): mu.g NCN protein. Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).

4. Puromycin pressure screening

1. Puromycin screening purOR-hHTTex1 (81Q) gene inserted positive cell

(1) And (3) after the third step is finished, culturing for 16-18 hours by using the complete culture solution, and then replacing a new complete culture solution for culturing. The total time of incubation was 48 hours.

(2) After completion of step (1), the selection culture was carried out by replacing the culture broth with 1.5. Mu.g/mL puromycin in a complete culture broth (replacing the culture broth with 1.5. Mu.g/mL puromycin in a fresh form every day) for 3 weeks.

When the cells were cultured for 1 week, the cells died a lot.

When the screening culture is carried out for 2 weeks, the cells die sporadically, part of positive clones begin to divide and proliferate, and the number of the cells is increased continuously.

The purpose of the selection at week 3 of culture was to allow complete degradation of intracellular plasmid to exclude false positive cell clones.

(3) After completion of step (2), the cells were harvested and re-cultured with complete medium for 2 passages (1 passage every 2 days) to restore the cells to good condition for the next single cell sorting.

2. Single cell sorting and enlarged culture

(1) After completion of step 1, the cells were collected, digested with trypsin, neutralized with complete medium, centrifuged at 500g for 5min, the supernatant was discarded, the pellet was resuspended and diluted appropriately with 1mL of complete medium, the cells were picked up with a pipette and transferred to a 96-well plate (100. Mu.l of complete medium was added in advance to each well, one cell was inoculated to each well) for 2 days, and then cultured by replacing with a complete medium containing 1.5. Mu.g/mL puromycin (complete medium containing 1.5. Mu.g/mL puromycin was replaced every 2 to 3 days, during which time the growth of the cells in each well was observed with a microscope, and wells without cells and non-single cell clones were excluded).

(2) After the cells in the wells of the 96-well plate in step (1) grew to the bottom of the wells (about 2 weeks or so), cells were digested with trypsin and collected, 2/3 of the cells were seeded into a 6-well plate containing complete culture broth, and the remaining 1/3 of the cells were collected in a 1.5mL centrifuge tube.

(3) When the cells in the wells of the 6-well plate in step (2) reached 50% fullness, they were digested with 0.25% (Gibco) trypsin and collected, and the cells were cryopreserved using a cell cryopreservation solution (90% complete medium +10% dmso, vol.).

5. Genome level identification of homologous recombination condition of porcine HTT gene exon 1

In order to examine whether or not a target foreign DNA fragment (the target foreign DNA fragment is represented by nucleotides 1071 to 2176 in SEQ ID NO: 16) is integrated into the genome of swine by homologous recombination and replaces a target region (the target region is represented by nucleotides 2001 to 2236 in SEQ ID NO: 9) in the genomic DNA. And (3) taking the centrifuge tube in the step (2) in the step (IV) 2, extracting cell genome DNA, performing PCR amplification by using a specific primer pair (the specific primer pair is an upstream primer pair consisting of HTTex1-Lr-JDF and HTTex1-Lr-JDR, a downstream primer pair consisting of HTTex-Rr-JDF and HTTex-Rr-JDR, and a middle primer pair consisting of HTTex1-wt-JDF and HTTex 1-wt-JDR), performing electrophoresis, and recovering a PCR product for sequencing. Porcine primary fibroblasts were used as wild type controls (WT).

Primer pairs consisting of HTTex1-Lr-JDF and HTTex1-Lr-JDR are used for identifying whether the 5' end of the target exogenous DNA fragment is successfully recombined (the target sequence is 1796 bp), and the electrophoresis result is shown in FIG. 7. Primer pairs consisting of HTTex1-Rr-JDF and HTTex1-Rr-JDR are used for identifying whether the 3' end of the target exogenous DNA fragment is successfully recombined (the target sequence is 1539 bp), and the electrophoresis result is shown in FIG. 8. A primer pair consisting of HTTex1-wt-JDF and HTTex1-wt-JDR is used for identifying whether the recombinant cells are homozygous or heterozygous (a target region in genomic DNA is a template and can amplify a 652bp fragment, and a target exogenous DNA fragment is a template and can amplify a 1522bp fragment); if only 1522bp fragments are amplified, the cells are homozygous recombinant cells (the same recombination occurs to a pair of homologous chromosomes) of which the target exogenous DNA fragments are integrated into the pig genome and replace target regions in the genomic DNA; if the 652bp fragment and the 1522bp fragment are amplified simultaneously, the cell is a heterozygote recombinant cell which integrates a target exogenous DNA fragment into a pig genome and replaces a target region in the genome DNA (one of a pair of homologous chromosomes is recombined, and the other one keeps a wild type); if only the 652bp fragment is amplified, the cells are wild type (no recombination occurs in a pair of homologous chromosomes), and the electrophoresis result is shown in FIG. 9.

HTTex1-Lr-JDF：ATGGACAGCAAGTCAGAGGC；

HTTex1-Lr-JDR：CGTGGGCTTGTACTCGGTC；

HTTex1-Rr-JDF：GCCACATCGAGCGGG；

HTTex1-Rr-JDR：GTCAACTCGACCCAATACTCCA；

HTTex1-wt-JDF：CCCGAGTCCCATTCATTGCC；

HTTex1-wt-JDR：CTCGGAAAGGACTCGCCATT。

The results of genotyping 32 single cell clones randomly picked are shown in table 1. The single cell clone numbered 12 was a wild-type cell, the single cell clones numbered 6, 19, 24 and 30 were homozygous recombinant cells, and the remaining single cell clones were heterozygous recombinant cells.

TABLE 1

The amplification products of all cells in table 1 were verified to be correct by Sanger sequencing. Taking the single-cell clone numbered 1 as an example, the sequencing peak of the PCR amplification product of the upstream primer pair is shown in FIG. 10, and the sequencing peak of the PCR amplification product of the downstream primer pair is shown in FIG. 11.

Selecting partial cells in the table 1 to perform whole genome sequencing respectively so as to detect the site-specific integration condition of the exogenous DNA fragment and detect whether random integration phenomenon also exists in the exogenous DNA fragment. No random integration of exogenous DNA fragments was found in any of the single cell clones tested by whole genome sequencing.

Through whole genome sequencing, compared with the porcine primary fibroblasts from the same source, the genome DNA of the homozygous recombinant cells only differs in that: the region of interest in the genomic DNA is replaced by the foreign DNA fragment of interest and is homozygous (i.e., the two homologous chromosomes have been identically replaced).

Through whole genome sequencing, compared with porcine primary fibroblasts from the same source, the genomic DNA of the hybrid recombinant cells only differs in that: the target region in the genomic DNA is replaced by the target foreign DNA fragment and is heterozygous (i.e., one chromosome of a pair of homologous chromosomes is replaced and the other chromosome is not replaced).

The target exogenous DNA fragment is shown as SEQ ID NO: nucleotide numbers 1071-2176 in 16. The target region is shown as SEQ ID NO:9 from nucleotides 2001 to 2236.

The hybrid recombinant cell and the homozygous recombinant cell are both target recombinant cells. The target recombinant cell is used as a nuclear transfer donor cell to carry out somatic cell cloning, and a cloned pig, namely the Huntington chorea model pig can be obtained.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is made possible within the scope of the claims attached below.

Claims (14)

1. A method of making a recombinant porcine cell comprising the steps of: replacing a target region in the chromosome DNA of the pig cell with a DNA molecule named as DNA molecule A to obtain a recombinant pig cell;

the DNA molecule A is (I) or (II) as follows:

(I) SEQ ID NO:16 from nucleotide 1734 to nucleotide 2176;

(II) SEQ ID NO:16 from nucleotide 1071 to nucleotide 2176;

the target region is SEQ ID NO:9, nucleotides 2001-2236.

2. The method of claim 1, wherein: the replacement of the target region in the chromosomal DNA of the pig cells with the DNA molecule designated DNA molecule A is achieved in that: the sgRNA was synthesized _HTT-gU3 、sgRNA _HTT-gD1 Co-transfecting the pig cell with the donor plasmid and the NCN protein; the donor plasmid has the DNA molecule A therein; the sgRNA _HTT-gU3 Is sgRNA, and the target sequence binding region is shown as SEQ ID NO:19 at nucleotides 3 to 22; the sgRNA _HTT-gD1 Is sgRNA, and the target sequence binding region is shown as SEQ ID NO:20, nucleotides 3 to 22; the NCN protein is a Cas9 protein or a fusion protein with a Cas9 protein.

3. A kit comprising sgRNA _HTT-gU3 、sgRNA _HTT-gD1 Donor plasmid and NCN protein;

the sgRNA _HTT-gU3 Is the sgRNA described in claim 2 _HTT-gU3 ；

The sgRNA _HTT-gD1 Is the sgRNA described in claim 2 _HTT-gD1 ；

The donor plasmid is the donor plasmid of claim 2;

the NCN protein is the NCN protein of claim 2;

the application of the kit is as follows (a), (b) or (c): (a) preparing a recombinant porcine cell; (b) preparing a model pig for huntington's disease; (c) Preparing a cell model of Huntington's chorea or a tissue model of Huntington's chorea or an organ model of Huntington's chorea.

4. A kit comprising sgRNA _HTT-gU3 、sgRNA _HTT-gD1 Donor plasmid and PRONCN protein;

the sgRNA _HTT-gU3 Is the sgRNA described in claim 2 _HTT-gU3 ；

The sgRNA _HTT-gD1 Is the sgRNA described in claim 2 _HTT-gD1 ；

The donor plasmid is the donor plasmid of claim 2;

the PRONCN protein sequentially comprises the following elements from upstream to downstream: signal peptide, molecular chaperone protein, protein tag, protease enzyme cutting site, nuclear localization signal, cas9 protein and nuclear localization signal;

the application of the kit is as follows (a), (b) or (c): (a) preparing a recombinant porcine cell; (b) preparing a model pig for huntington's disease; (c) Preparing a cell model of Huntington's chorea or a tissue model of Huntington's chorea or an organ model of Huntington's chorea.

5. A kit comprising sgRNA _HTT-gU3 、sgRNA _HTT-gD1 A donor plasmid and a tool plasmid;

the sgRNA _HTT-gU3 Is the sgRNA described in claim 2 _HTT-gU3 ；

The sgRNA _HTT-gD1 Is the sgRNA described in claim 2 _HTT-gD1 ；

The donor plasmid is the donor plasmid of claim 2;

the tool plasmid comprises the following elements from upstream to downstream in sequence: a promoter, an operator, a ribosome binding site, a PRONCN protein coding gene and a terminator; the PRONCN protein sequentially comprises the following elements from upstream to downstream: signal peptide, molecular chaperone protein, protein tag, protease enzyme cutting site, nuclear localization signal, cas9 protein and nuclear localization signal;

the application of the kit is as follows (a), (b) or (c): (a) preparing a recombinant porcine cell; (b) preparing a model pig for huntington's disease; (c) Preparing a cell model of Huntington's chorea or a tissue model of Huntington's chorea or an organ model of Huntington's chorea.

6.sgRNA _HTT-gU3 、sgRNA _HTT-gD1 The application of the donor plasmid and the NCN protein in the preparation of the kit;

the sgRNA _HTT-gU3 Is the sgRNA of claim 2 _HTT-gU3 ；

The sgRNA _HTT-gD1 Is the sgRNA described in claim 2 _HTT-gD1 ；

The donor plasmid is the donor plasmid of claim 2;

the NCN protein is the NCN protein of claim 2;

the application of the kit is as follows (a), (b) or (c): (a) preparing a recombinant porcine cell; (b) preparing a model pig for huntington's disease; (c) Preparing a cell model of Huntington's chorea or a tissue model of Huntington's chorea or an organ model of Huntington's chorea.

7.sgRNA _HTT-gU3 、sgRNA _HTT-gD1 The application of the donor plasmid and the PRONCN protein in the preparation of the kit;

the sgRNA _HTT-gU3 Is the sgRNA described in claim 2 _HTT-gU3 ；

The sgRNA _HTT-gD1 Is the sgRNA described in claim 2 _HTT-gD1 ；

The donor plasmid is the donor plasmid of claim 2;

the PRONCN protein is the PRONCN protein of claim 4;

the application of the kit is as follows (a), (b) or (c): (a) preparing a recombinant porcine cell; (b) preparing a model pig for huntington's disease; (c) Preparing a cell model of Huntington's chorea or a tissue model of Huntington's chorea or an organ model of Huntington's chorea.

8.sgRNA _HTT-gU3 、sgRNA _HTT-gD1 The application of the donor plasmid and the tool plasmid in the preparation of the kit;

the sgRNA _HTT-gU3 Is the sgRNA of claim 2 _HTT-gU3 ；

The sgRNA _HTT-gD1 Is the sgRNA of claim 2 _HTT-gD1 ；

The donor plasmid is the donor plasmid of claim 2;

the tool plasmid is the tool plasmid of claim 5;

the application of the kit is as follows (a), (b) or (c): (a) preparing a recombinant porcine cell; (b) preparing a model pig for huntington's disease; (c) Preparing a cell model of Huntington's chorea or a tissue model of Huntington's chorea or an organ model of Huntington's chorea.

9. The method according to claim 2 or the kit according to claim 3 or the use according to claim 6, characterized in that: the NCN protein is shown as SEQ ID NO:3, respectively.

10. The method or kit or use according to claim 9, wherein:

the preparation method of the NCN protein comprises the following steps:

(1) Introducing the plasmid pKG-GE4 into escherichia coli BL21 (DE 3) to obtain a recombinant strain;

(2) Culturing the recombinant strain by adopting a liquid culture medium at 30 ℃, adding IPTG (isopropyl-beta-thiogalactoside) and carrying out induced culture at 25 ℃, and then collecting thalli;

(3) Crushing the collected thalli, and collecting a crude protein solution;

(4) Purification of His-bearing protein from the crude protein solution using affinity chromatography ₆ A fusion protein of the tag;

(5) By using a compound having His ₆ Tagged enterokinase cleavage with His ₆ The tagged fusion protein was then removed with His using Ni-NTA resin ₆ A tagged protein, resulting in a purified NCN protein;

plasmid pKG-GE4 has the sequence shown in SEQ ID NO:1, 5209 to 9852 th nucleotide.

11. A recombinant porcine cell produced by the method of claim 1 or 2 or 9 or 10.

12. Use of the recombinant porcine cell of claim 11 for the preparation of a model huntington's disease pig.

13. A porcine tissue, organ or cell of a model huntington's disease porcine produced using the recombinant porcine cell of claim 11.

14. The use of the recombinant porcine cell of claim 11, the porcine tissue of claim 13, the porcine organ of claim 13, the porcine cell of claim 13, or the huntington's disease model porcine produced using the recombinant porcine cell of claim 11, wherein the recombinant cell is (d 1) or (d 2) or (d 3) or (d 4):

(d1) Screening for a drug for treating Huntington's disease;

(d2) Performing drug effect evaluation of the Huntington's disease drug;

(d3) Performing an evaluation of the efficacy of gene therapy and/or cell therapy for Huntington's disease;

(d4) The pathogenesis of Huntington's disease was studied.

Images