CN115956584A

CN115956584A - RNAi pesticide for preventing and treating sitobion avenae

Info

Publication number: CN115956584A
Application number: CN202111170545.3A
Authority: CN
Inventors: 苗雪霞; 李海超; 关若冰
Original assignee: Shanghai Zhishengyougu Biotechnology Co ltd
Current assignee: Shanghai Zhishengyougu Biotechnology Co ltd
Priority date: 2021-10-08
Filing date: 2021-10-08
Publication date: 2023-04-14

Abstract

The invention discloses RNAi pesticide for preventing and treating sitobion avenae, which comprises double-stranded RNA molecule dsRNA of sitobion avenae gene Saccc 42 with a target nucleotide sequence of SEQ ID NO. 1. The RNAi pesticide disclosed by the invention can effectively reduce the harm of the sitobion avenae to the growth of wheat and can effectively improve the thousand grain weight of the wheat.

Description

RNAi pesticide for preventing and treating sitobion avenae

Technical Field

The invention belongs to the field of biological agriculture and pharmacy, and relates to an RNAi pesticide for preventing and treating sitobion avenae and application thereof.

Background

Myzus avenae, sitobion avenae (Fabricius), an insect of the genus Elephora, belonging to the family Aphidae, the order Hemiptera. Is the most main aphid in wheat, and is also the aphid with destructive power, which affects 65% of wheat producing areas in China and seriously affects the yield and quality of wheat in China.

The early stage of the sitobion avenae is concentrated on the front or back of the wheat leaf blade, and the later stage of the sitobion avenae is concentrated on the ear to prick and absorb juice, so that the damaged plant grows slowly, tillering is reduced, and thousand seed weight is reduced. The aphid is the dominant species in wheat aphids, the aphids occur for 20-30 generations every year, wingless parthenogenetic aphids and several aphids live through the winter in gaps between roots or soil blocks around wheat plants in most regions, and some aphids can continue to live on wheat leaves which are leeward and exposed to the sun. Two harm peaks appear in spring and autumn of the wheat field, and the aphid amount is less in summer and winter. After wheat is turned green, the wheat is bred at the temperature higher than 6 ℃, the wheat is transferred to ear parts to be damaged, the number of insect mouths is rapidly increased until the aphid quantity reaches the peak in the filling and milk stage, the temperature is higher than 22 ℃, a large number of winged aphids are generated, and the aphids fly to a cold region to cross summer.

The sitobion avenae feeds on the bast juice of wheat, so that besides the influence on wheat filling, honeydew secreted by aphids can cause mass propagation of fungi and influence on the photosynthetic capacity of leaves, and in addition, the sitobion avenae can also spread wheat virosis and induce yellow necrosis of wheat in the feeding process. At present, the prevention and treatment of wheat aphids are mainly chemical insecticide prevention and treatment, which not only pollutes the environment and damages natural enemies, but also leads to the improvement of the drug resistance of the aphids. Therefore, the development of a preparation which has strong specificity on the sitobion avenae and has accurate and efficient prevention and control effects has important economic value and important ecological significance.

The phenomenon of RNAi was discovered by Fire et al in 1998, and their studies demonstrated that: double-stranded RNA (dsRNA) can cause the expression of a target gene to be silenced. RNAi is currently used in a large number of applications as a tool for gene function studies, especially in animals and plants with imperfect genetic manipulation tools. In the field of agricultural pest control, two studies in 2002 show that the silencing of specific target genes can cause abnormal insect development, next generation embryo malformation and even death, and the application of RNAi technology in entomology research and application is a starting point. Two reports in 2007 prove that the effect of killing insects can be achieved by using transgenic plants to express dsRNA of insects, and the two researches provide strong evidence for the application of RNAi technology in pest control.

The pesticide developed by the RNAi technology is called RNA biological pesticide, also called RNAi biological pesticide, nucleic acid pesticide, RNA pesticide or RNA interference agent, and is a novel biological pesticide developed based on the RNA interference technology, and the core component of the pesticide is a double-stranded polynucleotide fragment which can be specifically combined with mRNA transcribed by a target gene in a target organism. The RNA biological pesticide can specifically silence the expression of a target gene and has the characteristics of high efficiency and strong specificity. The basic principle is as follows: the specific segment of the endogenous functional gene of an organism is used as a template, double-stranded RNA (dsRNA) complementary with the specific segment is synthesized in vitro and then is introduced into the body of a target species, the dsRNA segment is recognized by an RNAi interference mechanism endogenous to the organism and is cut into small interfering RNA (siRNA) of 18-25nt, and the siRNA cuts information RNA (mRNA) of the target gene under the action of the RNA interference mechanism endogenous to inhibit the expression of the target gene, prevent the function exertion of the gene and finally influence the growth and development of the target species until death. The technology has the characteristics of target species specificity, target development convenience, easy degradation and the like, has most of functions required by green pesticides, draws the attention of numerous scientists and pesticide companies, and is called as a third revolution in the pesticide production history. Currently, many international pesticide companies, such as bayer-monsanto, bengala virginiana and jundada, utilize the technology and invest a lot of manpower and material resources to develop targeted pesticides, and it is reported that corresponding products are on the market or are about to come on the market.

Disclosure of Invention

The RNAi technology is applied to the prevention and control of the sitobion avenae for years, and in recent years, the fact that RNA interference is carried out by taking the gene Saccd 42 of the sitobion avenae as a target is found, and a relatively good lethal effect can be obtained. The nucleotide sequence of the gene Sacc 42 is SEQ ID NO. 1, 200 pieces of dsRNA are designed by taking the gene Sacc 42 as a target, and experimental comparison shows that some dsRNA molecules have excellent RNAi effect on the sitobion avenae. Based on this finding and further studies, the present invention comprises the following technical solutions.

An RNAi pesticide for preventing and treating the sitobion avenae is characterized by comprising a double-stranded RNA molecule dsRNA of the sitobion avenae gene Saccc 42 with a target nucleotide sequence of SEQ ID NO. 1. For convenience of description, the double stranded RNA molecule is abbreviated dsSaccd 42.

For example, the sense strand nucleotide sequence of the above-mentioned dsRNA is selected from SEQ ID NOs:2-7, and for convenience of description, the double-stranded RNA molecule thereof is abbreviated as dsSacc.

It will be readily understood by those skilled in the art that each of the above-described dsRNA molecules also has an antisense strand complementary to SEQ ID NOs: 2-7.

CCGUUAUGAUUGGCGGGGAGCCAUAUACAUUGGGUUUAUUUGAUACAGCAGGUCAGGAAGAUUAUGAUCGCCUCAGACCUUUGAGUUAUCCACAAACUGAUGUGUUUCUUGUUUGUUUCUCCGUGGUUUCACCAUCUUCAUUUGAAAAUGUCAAAGAAAAAUGGGUUCCAGAGAUAACACGUCACUGUCAAAAAACACCAUUCCUGUUGGUUGGCACACAAAUAGACCUUAGAGAAGAUGCCACGACUGUAGAGAAACUAGCCAAAAAUAAACAAAAAUCAAUAUCAUCUGAACAAGGAGAGAAGCUAGCUAAAGAACUUAAAGCUGUAAAAUAUGUUGAAUGCUCAGCACUUACACAAAAAGGACUAAAAAAUGUAUUUGAUGAAGCUAUUCUUGCAGCUUUAGAGCCUCCUGAACC(SEQ ID NO:2)；

UAGGAGUCUUUCCAUAGCGGCAACAUGCAGACCAUCAAGUGCGUGGUUGUUGGUGAUGGAGCUGUUGGUAAGACUUGUCUGCUCAUAUCGUACACGACAAACAAGUUUCCUUCAGAAUAUGUACCGACUGUUUUUGACAAUUAUGCAGUGACCGUUAUGAUUGGCGGGGAGCCAUAUACAUUGGGUUUAUUUGAUACAGCAGGUCAGGAAGAUUAUGAUCGCCUCAGACCUUUGAGUUAUCCACAAACUGAUGUGUUUCUUGUUUGUUUCUCCGUGGUUUCACCAUCUUCAUUUGAAAAUGUCAAAGAAAAAUGGGUUCCAGAGAUAACACGUCACUGUCAAAAAACACCAUUCCUGUUGGUUGGCACACAAAUAGACCUUAGAGAAGAUGCCACG(SEQ ID NO:3)；

AUCUUCAUUUGAAAAUGUCAAAGAAAAAUGGGUUCCAGAGAUAACACGUCACUGUCAAAAAACACCAUUCCUGUUGGUUGGCACACAAAUAGACCUUAGAGAAGAUGCCACGACUGUAGAGAAACUAGCCAAAAAUAAACAAAAAUCAAUAUCAUCUGAACAAGGAGAGAAGCUAGCUAAAGAACUUAAAGCUGUAAAAUAUGUUGAAUGCUCAGCACUUACACAAAAAGGACUAAAAAAUGUAUUUGAUGAAGCUAUUCUUGCAGCUUUAGAGCCUCCUGAACCAGUUAAGAAGAGGAAGUGUGUUAUAUUGUAAGGCUGCGGAUAAAUAAACAGUGCGACAAUUAUGUC(SEQ ID NO:4)；

GUGCUGCUUAUUCACCAGUGUACACAUAGGAGUCUUUCCAUAGCGGCAACAUGCAGACCAUCAAGUGCGUGGUUGUUGGUGAUGGAGCUGUUGGUAAGACUUGUCUGCUCAUAUCGUACACGACAAACAAGUUUCCUUCAGAAUAUGUACCGACUGUUUUUGACAAUUAUGCAGUGACCGUUAUGAUUGGCGGGGAGCCAUAUACAUUGGGUUUAUUUGAUACAGCAGGUC(SEQ ID NO:5)；

UUGAUACAGCAGGUCAGGAAGAUUAUGAUCGCCUCAGACCUUUGAGUUAUCCACAAACUGAUGUGUUUCUUGUUUGUUUCUCCGUGGUUUCACCAUCUUCAUUUGAAAAUGUCAAAGAAAAAUGGGUUCCAGAGAUAACACGUCACUGUCAAAAAACACCAUUCCUGUUGGUUGGCACACAAAUAGACCUUAGAGAAGAUGCCACGACUGUAGAGAAACUAGCCAAAAAUAAACAAAAAUCAAUAUCAUCUGAACAAGGAGAGAAGCUAGCUAAAGAACUUAAAGCUGUAAAAUAUGUUGAAUGCUCAGCACUUACACAAAAAGGACUA(SEQ ID NO:6)；

GAGUCUUUCCAUAGCGGCAACAUGCAGACCAUCAAGUGCGUGGUUGUUGGUGAUGGAGCUGUUGGUAAGACUUGUCUGCUCAUAUCGUACACGACAAACAAGUUUCCUUCAGAAUAUGUACCGACUGUUUUUGACAAUUAUGCAGUGACCGUUAUGAUUGGCGGGGAGCCAUAUACAUUGGGUUUAUUUGAUACAGCAGGUCAGGAAGAUUAUGAUCGCCUCAGACCUUUGAGUUAUCCACAAACUGAUGUGUUUCUUGUUUGUUUCUCCGUGGUUUCACCAUCUUCAUUUGAAAAUGUCAAAGAAAAAUGGGUUCCAGAGAUAACACGUCACUGUCAAA(SEQ ID NO:7)。

Preferably, the sense strand nucleotide sequence of the dsRNA is SEQ ID NO 2. For convenience of description, it is simply referred to as dsSacdc42.

In order to enhance the RNAi effect of the dsRNA for inhibiting the growth and breeding of the sitobion avenae and improve the efficiency of the RNAi pesticide in preventing and treating the sitobion avenae pest, the inventor also provides a synergist which can be compatible with the dsRNA, and the synergist and the dsRNA together form the RNAi pesticide with improved prevention and treatment effect. For convenience of description, the synergist is abbreviated as MLG2; accordingly, the RNAi pesticide formulation is abbreviated as dsSaccd 42-MLG2.

The synergist (MLG 2) comprises the following components in terms of 1L of the dosage of the aqueous solution: 1.76-30.0g/L KCl, 0.15-1.52g/L H ₈ MoN ₂ O ₄ 、0.01-0.10g/L Na ₂ SeO ₄ 、0.01-0.10g/L Na ₂ SeO ₃ 0.2-5.0g/L potassium oleate, 0.15-0.6g/L geraniol and 0.01-1.0g/L diatomite.

Preferably, the above synergist (MLG 2) comprises the following ingredients: 4.88-6.21g/L KCl, 0.45-0.54g/L H ₈ MoN ₂ O ₄ 、0.02-0.05g/L Na ₂ SeO ₄ 、0.02-0.05g/L Na ₂ SeO ₃ 0.25-4.0g/L potassium oleate, 0.25-0.40g/L geraniol and 0.2-0.8g/L diatomite.

For example, the above synergist may comprise the following ingredients: about 3.05g/L KCl, about 0.45g/L H ₈ MoN ₂ O ₄ About 0.03g/L Na ₂ SeO ₄ About 0.022g/L Na ₂ SeO ₃ About 0.35g/L potassium oleate, about 0.30g/L geraniol, about 0.5g/L diatomaceous earth.

In one embodiment, the RNAi pesticide dsSacc 42-MLG2 comprising the above synergist (MLG 2) has a pH of pH6.0-8.0.

In the RNAi pesticide dsSacc 42-MLG2, the content of the dsRNA can be 0.10-0.90g/L

Preferably, in the RNAi pesticide dsSacc 42-MLG2, the dosage of dsRNA is 0.40-0.80g/L.

The second purpose of the invention is to provide the application of the RNAi pesticide in protecting the growth of wheat.

Specifically, the RNAi pesticide is used for inhibiting the growth and breeding of the sitobion avenae and killing the sitobion avenae.

In one embodiment, the RNAi pesticide is used at about 1L per acre in a wheat field.

The field plot test result shows that the 5-day control effect of the sitobion avenae on the dsRNA (dsSacc 42) water solution with the sense strand of SEQ ID NO. 2 is 71.49 percent; the RNAi pesticide formulation dsSaccc 42-MLG2 containing the synergist MLG2 is sprayed, the control effect on the sitobion avenae within 5 days reaches 79.80%, and the thousand grain weight of wheat is improved by 6.57% compared with a chemical pesticide. Therefore, the RNAi pesticide can effectively prevent and control the sitobion avenae and has important significance for protecting the normal growth and yield increase of wheat and guaranteeing the food safety of China.

Drawings

FIG. 1 is a bar graph showing the control effect of water, synergist solution MLG2, RNAi pesticide dsSacc 42 aqueous solution, RNAi pesticide formulation dsSacc 42-MLG2, and chemical insecticide imidacloprid on Entomophthora avenae in the field for 5 days.

FIG. 2 is a bar graph showing the effect of water, synergist solution MLG2, RNAi pesticide dsSacc 42 aqueous solution, RNAi pesticide formulation dsSacc 42-MLG2, and the chemical insecticide imidacloprid on the thousand-grain weight gain of wheat after field application.

Detailed Description

The method for killing the pest avenae by using an RNA interference technology is a research project of an inventor for many years, and an avenae gene Saccd 42 is a target selected from many multifunctional genes, and the nucleotide sequence of the avenae gene is SEQ ID NO. 1.

gtgctgcttattcaccagtgtacacataggagtctttccatagcggcaacatgcagaccatcaagtgcgtggttgttggtgatggagctgttggtaagacttgtctgctcatatcgtacacgacaaacaagtttccttcagaatatgtaccgactgtttttgacaattatgcagtgaccgttatgattggcggggagccatatacattgggtttatttgatacagcaggtcaggaagattatgatcgcctcagacctttgagttatccacaaactgatgtgtttcttgtttgtttctccgtggtttcaccatcttcatttgaaaatgtcaaagaaaaatgggttccagagataacacgtcactgtcaaaaaacaccattcctgttggttggcacacaaatagaccttagagaagatgccacgactgtagagaaactagccaaaaataaacaaaaatcaatatcatctgaacaaggagagaagctagctaaagaacttaaagctgtaaaatatgttgaatgctcagcacttacacaaaaaggactaaaaaatgtatttgatgaagctattcttgcagctttagagcctcctgaaccagttaagaagaggaagtgtgttatattgtaaggctgcggataaataaacagtgcgacaattatgtc(SEQ ID NO:1)。

Theoretically, dsRNA molecules including siRNA molecules designed aiming at the gene SEQ ID NO. 1 have the biological function of inhibiting the expression of the gene more or less so as to inhibit the growth and breeding of the sitobion avenae. However, unexpectedly, most of the 200 dsRNA molecules designed by the inventor have NO expected function of inhibiting the Aphis avenae, and only a few of the dsRNA molecules have RNAi effect of killing the Aphis avenae, including dsRNA with a sense strand nucleotide sequence of SEQ ID NOs:2-7, namely dsSacc, for example dsSacc 42 with a sense strand of SEQ ID NO:2.

As used herein, the terms "dsRNA," "dsRNA molecule," or "double-stranded RNA molecule" are used interchangeably and refer to both meaning and scope to a double-stranded structure formed by annealing a sense strand to an antisense strand.

The double-stranded dsRNA is a macromolecular compound and is also easily degraded by nuclease RNase and DNase, and in order to promote the dsRNA molecules to penetrate through the epidermal tissues of the Aphis avenae to enter the insect body and avoid the damage of the nuclease generated by environmental microorganisms, the invention develops the formula of the synergist MLG2 capable of enhancing the RNAi effect of the dsRNA molecules.

In a typical embodiment, the synergist MLG2 of the present invention may comprise the following ingredients: about 3.05g/L KCl, about 0.45g/L H ₈ MoN ₂ O ₄ About 0.03g/L Na ₂ SeO ₄ About 0.022g/L Na ₂ SeO ₃ About 0.35g/L potassium oleate, about 0.30g/L geraniol, about 0.5g/L diatomaceous earth.

It should be understood that when numerical features are expressed herein, the terms "about" or "approximately" mean that the number indicated may have a margin of error or variance of 10%, ± 9%, ± 8%, ± 7%, ± 6% or ± 5%.

In field experiments, the effect of the RNAi pesticide formula preparation dsSacc 42-MLG2 on preventing and controlling the sitobion avenae is better than that of dsRNA molecule dsSacc 42 aqueous solution, and the promoting effect of the synergist MLG2 is proved.

The present invention will be further described with reference to the following embodiments and the accompanying drawings. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

In the examples of the present invention, if no specific description is made about the experimental operating temperature, the temperature is usually room temperature (10 to 30 ℃).

The amount, content and concentration of various substances are referred to herein, wherein the percentages are by weight unless otherwise indicated.

Examples

The primer synthesis and RNA synthesis herein were performed by Pidao Biotechnology (Shanghai) Co., ltd., and the sequencing was performed by Shanghai Sangni Biotechnology Co., ltd.

The molecular biological experiments herein include plasmid construction, digestion, ligation, competent cell preparation, transformation, culture medium preparation, and the like, and are mainly performed with reference to molecular cloning, a manual of experiments (third edition), J. Samsburg, D.W. Lassel (America), and translation of Huang Peitang, scientific Press, beijing, 2002). The specific experimental conditions can be determined by simple experiments if necessary.

PCR amplification experiments were performed according to the reaction conditions or instructions provided by the plasmid or DNA template supplier. If necessary, can be adjusted by simple experimentation.

Example 1: obtaining target gene sequences

(1) Extraction of total RNA of sitobion avenae

Taking the sitobion avenae as a material, extracting by adopting a conventional Trizol method, purifying by adopting a conventional method, and treating by using DNA enzyme to obtain a Total RNA sample with the concentration of more than or equal to 300 ng/mu l, the Total amount of more than or equal to 6 mu g and the OD260/280 of 1.8-2.2.

(2) Isolation of mRNA and Synthesis of cDNA

PolyA-bearing mRNA was isolated using magnetic beads carrying oligo-dT, and the first strand cDNA was synthesized using random 6-mer and Invitrogen Superscript II reverse transcriptase kit to give the Sacdc42 gene with the nucleotide sequence of SEQ ID NO:1.

(3) Amplification and sequencing of Saccc 42 gene

Primers specific to the Adenophora avenae Sacdc42 gene shown in Table 1 were designed.

TABLE 1 primer sequences used in the present invention

Primer name	Sequence (5 '→ 3')
		Sacdc42 F	ATGATGAAGTGGTGGACGTG
Sacdc42R	TTACAACTCGTTGCGTGGTC
		dsSacdc42F	TAATACGACTCACTATAGGGCCGTTATGATTGGCGGGGAGCC
dsSacdc42R	TAATACGACTCACTATAGGGGGTTCAGGAGGCTCTAAAGCTGCAA

The Saccd 42 gene of the avenae Saccd 42 is amplified by using the primer Saccd 42F/Saccd 42R in the table 1, the obtained gene fragment is purified and connected to a PMD-18 vector (Takara company), an escherichia coli Top10 strain is transformed, a blue white spot is screened, and the sequencing of a positive strain is verified to be correct.

(4) dsRNA synthesis

More than 200 dsRNA molecules are designed aiming at the sequence of the Saccc 42 gene. Synthesis of kit MEGAscript by using Thermo Fisher dsRNA ^TM T7 Transcription Kit (am 1334) was synthesized, and the specific procedures were as described in the Kit.

For example, the primer sequence for amplifying dsSacc 42 is shown in table 1 as dsSacc 42F/dsSacc 42R, and the sense strand of the amplified dsRNA sequence is SEQ ID NO. 2.

According to a similar method, the obtained dsRNA molecules comprise dsRNA molecules with sense strands of SEQ ID NO. 3-7 respectively.

Example 2: preparing RNAi pesticide synergist MLG2 and formula preparation

The synergist is prepared according to the following formula: 3.05g/L KCl, 0.45g/L H ₈ MoN ₂ O ₄ 、0.03g/L Na ₂ SeO ₄ 、0.022g/L Na ₂ SeO ₃ 0.35g/L potassium oleate, 0.30g/L geraniol and 0.5g/L diatomite.

Taking dsSaccc 42 as an example, the content of the dsSaccc 42 is set to be 0.4g/L, and an RNAi formulation preparation dsSaccc 42-MLG2 is prepared: 0.4g/L dsSaccc 42, 3.05g/L KCl, 0.45g/L H ₈ MoN ₂ O ₄ 、0.03g/L Na ₂ SeO ₄ 、0.022g/L Na ₂ SeO ₃ 0.35g/L potassium oleate, 0.30g/L geraniol and 0.5g/L diatomite.

As a control for formulation dsSaccd 42-MLG2, dsSaccd 42 was dissolved in water to give an aqueous solution with a concentration of 0.4 g/L.

Example 3: experiment for preventing and controlling sitobion avenae in field

The field test was carried out in the wheat fields of the Xinxiang experimental base of the agricultural academy of Henan province and the school district of Schchang of the university of Henan agriculture. Firstly, counting the number of the sitobion avenae in the field, then respectively and uniformly spraying water (negative control), a synergist solution MLG2, a dsSacc 42 aqueous solution, a formula preparation dsSacc 42-MLG2 and a chemical insecticide imidacloprid on the wheat at the later stage of heading, wherein each liquid preparation is treated by 1.0 mu, and the steps are repeated for 3 times. And (5) counting the aphids 5 days after spraying, and calculating the control effect. And when the wheat is harvested, the thousand grain weight and the cell yield of the wheat are counted, and the results are shown in figure 1 and figure 2.

Referring to fig. 1, the insecticidal effect of the chemical insecticide imidacloprid on myzus avenae is the highest and is 86%; secondly, the formulation dsSaccc 42-MLG2 is 79.80 percent; the dsSaccd 42 aqueous solution is 71.49%, lower than the formulation; the synergist MLG2 and water have little insecticidal effect. The results show that the double-stranded RNA molecule dsSacc 42 has lethal effect on Aphis avenae, and the synergist MLG2 can improve RNAi effect.

As shown in FIG. 2, the thousand kernel weight of wheat treated with the formulation dsSaccd 42-MLG2 was increased by 11.11% with the greatest increase compared to the field not sprayed with any agent (including water); thousand kernel weight of wheat treated with dsSacdc42 increased by 8.0%; the thousand grain weight of the wheat treated by MLG2 is improved by 7.12 percent; the thousand grain weight of wheat treated with imidacloprid is only increased by 4.54%, which is not balanced with the insecticidal effect, and probably suggests that chemical insecticides have adverse effects on wheat growth. The result shows that the synergist MLG2 does not influence the growth of wheat and even has a promoting effect; the RNAi pesticide, especially the formulation dsSaccd 42-MLG2, can increase the yield of wheat.

Although the technical solution of the present invention has been illustrated above by the double stranded RNA molecule dsSacc 42, it will be apparent to those skilled in the art that the RNAi pesticide of the present invention is also applicable to other RNA molecules in light of the present disclosure. Therefore, without departing from the spirit of the invention, those skilled in the art can make various changes or modifications to the invention, and equivalents of the various changes or modifications should also fall within the scope of the invention.

Sequence listing

<110> Shanghai vegetarian Yougu Biotechnology Co., ltd

<120> RNAi pesticide for preventing and treating sitobion avenae

<130> SHPI2110338

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 661

<212> DNA

<213> Sitobion avenae (Fabricius)

<400> 1

gtgctgctta ttcaccagtg tacacatagg agtctttcca tagcggcaac atgcagacca 60

tcaagtgcgt ggttgttggt gatggagctg ttggtaagac ttgtctgctc atatcgtaca 120

cgacaaacaa gtttccttca gaatatgtac cgactgtttt tgacaattat gcagtgaccg 180

ttatgattgg cggggagcca tatacattgg gtttatttga tacagcaggt caggaagatt 240

atgatcgcct cagacctttg agttatccac aaactgatgt gtttcttgtt tgtttctccg 300

tggtttcacc atcttcattt gaaaatgtca aagaaaaatg ggttccagag ataacacgtc 360

actgtcaaaa aacaccattc ctgttggttg gcacacaaat agaccttaga gaagatgcca 420

cgactgtaga gaaactagcc aaaaataaac aaaaatcaat atcatctgaa caaggagaga 480

agctagctaa agaacttaaa gctgtaaaat atgttgaatg ctcagcactt acacaaaaag 540

gactaaaaaa tgtatttgat gaagctattc ttgcagcttt agagcctcct gaaccagtta 600

agaagaggaa gtgtgttata ttgtaaggct gcggataaat aaacagtgcg acaattatgt 660

c 661

<210> 2

<211> 418

<212> RNA

<213> Artificial sequence ()

<400> 2

ccguuaugau uggcggggag ccauauacau uggguuuauu ugauacagca ggucaggaag 60

auuaugaucg ccucagaccu uugaguuauc cacaaacuga uguguuucuu guuuguuucu 120

ccgugguuuc accaucuuca uuugaaaaug ucaaagaaaa auggguucca gagauaacac 180

gucacuguca aaaaacacca uuccuguugg uuggcacaca aauagaccuu agagaagaug 240

ccacgacugu agagaaacua gccaaaaaua aacaaaaauc aauaucaucu gaacaaggag 300

agaagcuagc uaaagaacuu aaagcuguaa aauauguuga augcucagca cuuacacaaa 360

aaggacuaaa aaauguauuu gaugaagcua uucuugcagc uuuagagccu ccugaacc 418

<210> 3

<211> 396

<212> RNA

<213> Artificial sequence ()

<400> 3

uaggagucuu uccauagcgg caacaugcag accaucaagu gcgugguugu uggugaugga 60

gcuguuggua agacuugucu gcucauaucg uacacgacaa acaaguuucc uucagaauau 120

guaccgacug uuuuugacaa uuaugcagug accguuauga uuggcgggga gccauauaca 180

uuggguuuau uugauacagc aggucaggaa gauuaugauc gccucagacc uuugaguuau 240

ccacaaacug auguguuucu uguuuguuuc uccgugguuu caccaucuuc auuugaaaau 300

gucaaagaaa aauggguucc agagauaaca cgucacuguc aaaaaacacc auuccuguug 360

guuggcacac aaauagaccu uagagaagau gccacg 396

<210> 4

<211> 351

<212> RNA

<213> Artificial sequence ()

<400> 4

aucuucauuu gaaaauguca aagaaaaaug gguuccagag auaacacguc acugucaaaa 60

aacaccauuc cuguugguug gcacacaaau agaccuuaga gaagaugcca cgacuguaga 120

gaaacuagcc aaaaauaaac aaaaaucaau aucaucugaa caaggagaga agcuagcuaa 180

agaacuuaaa gcuguaaaau auguugaaug cucagcacuu acacaaaaag gacuaaaaaa 240

uguauuugau gaagcuauuc uugcagcuuu agagccuccu gaaccaguua agaagaggaa 300

guguguuaua uuguaaggcu gcggauaaau aaacagugcg acaauuaugu c 351

<210> 5

<211> 231

<212> RNA

<213> Artificial sequence ()

<400> 5

gugcugcuua uucaccagug uacacauagg agucuuucca uagcggcaac augcagacca 60

ucaagugcgu gguuguuggu gauggagcug uugguaagac uugucugcuc auaucguaca 120

cgacaaacaa guuuccuuca gaauauguac cgacuguuuu ugacaauuau gcagugaccg 180

uuaugauugg cggggagcca uauacauugg guuuauuuga uacagcaggu c 231

<210> 6

<211> 329

<212> RNA

<213> Artificial sequence ()

<400> 6

uugauacagc aggucaggaa gauuaugauc gccucagacc uuugaguuau ccacaaacug 60

auguguuucu uguuuguuuc uccgugguuu caccaucuuc auuugaaaau gucaaagaaa 120

aauggguucc agagauaaca cgucacuguc aaaaaacacc auuccuguug guuggcacac 180

aaauagaccu uagagaagau gccacgacug uagagaaacu agccaaaaau aaacaaaaau 240

caauaucauc ugaacaagga gagaagcuag cuaaagaacu uaaagcugua aaauauguug 300

aaugcucagc acuuacacaa aaaggacua 329

<210> 7

<211> 340

<212> RNA

<213> Artificial sequence ()

<400> 7

gagucuuucc auagcggcaa caugcagacc aucaagugcg ugguuguugg ugauggagcu 60

guugguaaga cuugucugcu cauaucguac acgacaaaca aguuuccuuc agaauaugua 120

ccgacuguuu uugacaauua ugcagugacc guuaugauug gcggggagcc auauacauug 180

gguuuauuug auacagcagg ucaggaagau uaugaucgcc ucagaccuuu gaguuaucca 240

caaacugaug uguuucuugu uuguuucucc gugguuucac caucuucauu ugaaaauguc 300

aaagaaaaau ggguuccaga gauaacacgu cacugucaaa 340

Claims

1. An RNAi pesticide for preventing and treating the sitobion avenae is characterized by comprising a double-stranded RNA molecule dsRNA of the sitobion avenae gene Saccc 42 with a target nucleotide sequence of SEQ ID NO. 1.

2. The RNAi pesticide of claim 1, wherein the sense strand nucleotide sequence of the dsRNA is selected from the group consisting of SEQ ID NOs 2-7.

3. The RNAI pesticide of claim 1, wherein the sense strand nucleotide sequence of the dsRNA is SEQ ID NO 2.

4. The RNAi pesticide of claim 1, further comprising a potentiator of the RNAi pesticide, the potentiator comprising the following ingredients, based on a 1L aqueous dosage: 1.76-30.0g/L KCl, 0.15-1.52g/L H ₈ MoN ₂ O ₄ 、0.01-0.10g/L Na ₂ SeO ₄ 、0.01-0.10g/L Na ₂ SeO ₃ 0.2-5.0g/L potassium oleate, 0.15-0.6g/L geraniol and 0.01-1.0g/L diatomite.

5. The RNAi pesticide of claim 4, wherein the potentiator comprises the following ingredients: 4.88-6.21g/L KCl, 0.45-0.54g/L H ₈ MoN ₂ O ₄ 、0.02-0.05g/L Na ₂ SeO ₄ 、0.02-0.05g/L Na ₂ SeO ₃ 0.25-4.0g/L potassium oleate, 0.25-0.40g/L geraniol and 0.2-0.8g/L diatomite.

6. The RNAi pesticide of claim 4, wherein the potentiator comprises the following ingredients: 3.05g/L KCl, 0.45g/L H ₈ MoN ₂ O ₄ 、0.03g/L Na ₂ SeO ₄ 、0.022g/L Na ₂ SeO ₃ 0.35g/L potassium oleate, 0.30g/L incenseLeaf alcohol, 0.5g/L diatomaceous earth.

7. The RNAi pesticide of claim 4, wherein the pH of the RNAi pesticide is pH6.0-8.0.

8. The RNAi pesticide of claim 4, wherein the dsRNA is present in an amount of 0.10-0.90g/L.

9. Use of the RNAi pesticide of any one of claims 1-8 for protecting wheat growth.

10. The use of claim 9, wherein the RNAi pesticide is administered to the wheat field at a dose of 1L per acre.