CN116024209A - RNAi molecules lethal to Aphis Raphani - Google Patents

Abstract

The invention discloses an RNAi molecule for inhibiting an ATP synthase gene of Aphis Raphani, which is a double-stranded RNA molecule consisting of a sense strand and a complementary antisense strand, wherein the nucleotide sequence of the sense strand is SEQ ID NO. 2. RNAi pesticides containing the RNAi molecules can effectively kill Aphis Raphani.

Description

RNAi molecules lethal to Aphis Raphani

Technical Field

The invention belongs to the field of biological agriculture and pharmacy, and relates to an RNAi molecule for inhibiting a radish aphid ATP synthase gene LeATPf and application thereof in preventing and controlling the radish aphid.

Background

RNA interference (RNAi) refers to the phenomenon of post-transcriptional silencing of genes that are highly conserved during evolution, induced by double-stranded RNA (dsRNA), and specifically degraded by homologous messenger RNA (mRNA). Since RNAi technology can specifically knock out or shut down the expression of a specific gene, it is widely used in functional genomics research.

In agricultural example, RNAi technology has been greatly advanced in recent years to control crop pests, and pesticides developed by using the technology are called RNA biopesticides, also called nucleic acid pesticides, RNA pesticides or RNA interfering agents, and are novel biopesticides developed based on RNA interference technology, and the core component of the novel biopesticide is polynucleotide capable of specifically binding mRNA transcribed from target genes in target organisms. The first international case of insect resistant corn MON87411 expressing insect dsRNA was approved by the US environmental protection agency (US EPA) at 15, 6, 2017. Currently, a great number of pesticide companies such as Bayer-Meng Shandou, tao Shiyi pesticide and Qianzhengda and the like in the world utilize the technology, a great deal of manpower and material resources are input to develop the targeted pesticide, and corresponding products are marketed or are about to be marketed.

The radish aphid (Lipaphis erysimi pseudobrassicae (Davis)) belongs to the genus of the aphis (Lipaphis) of the order hemiptera (Homoptera) Aphididae (Aphididae), is one of the most widely distributed aphids in the world, and mainly damages cruciferous crops such as radishes, cabbages, rapes and the like, and meanwhile, the radish aphid can transmit various vegetable virus diseases, so that more serious damage is caused. At present, the aphid control of the radish is mainly chemical control, but as the drug resistance of pests is increasingly serious, the contradiction of environmental pollution, pesticide residues and the like is increasingly prominent, a novel efficient control method needs to be explored.

Adenosine Triphosphate (ATP) is a life fuel that is produced by an embedded molecular machine (known as ATP synthase) that has a rotating action in the inner mitochondrial membrane of eukaryotic cells. ATP synthase occupies the inner membrane of the organelle and forms dimers through specific interactions in its membrane domain.

Disclosure of Invention

Considering that the ATP synthase gene is very important in the biological growth process, and well accords with the characteristic of screening target genes of RNAi biopesticides, the inventor develops RNAi biopesticides by taking the ATP synthase gene LeATPf as a target for many years.

The nucleotide sequence of the LeATPf gene of the Aphis Raphani is SEQ ID NO. 1, and more than 50 double-stranded RNA molecules are designed by taking the LeATPf gene as a target, and through verification, the individual RNAi molecules have a prominent inhibition effect on the LeATPf gene, so that the Aphis Raphani can be effectively killed. Therefore, the invention comprises the following technical scheme.

An RNAi molecule for inhibiting the aphid ulna ATP synthase gene LeATPf, is a double-stranded RNA molecule consisting of a sense strand and a complementary antisense strand, wherein the nucleotide sequence of the sense strand is SEQ ID No. 2:

CCAUGGACCGUACGAUCCUGCUCGUUACUACGGUACACCCGAUAAACCUUUUGGGCAAUUAAAACUUGGAGAGGUCACUGAAUGGGUGGGACGCCGCAACAAAUCACCAAAAGCAAUUGCAGGAUUAUUUUCUCGCGCCUAUUGGCGUUGGUCACACAAAUACGUUCAACCAAAACGUACAACGGCUGCUCCAUUGAUUCA(SEQ ID NO:2)。

for convenience of description, the double stranded RNA molecule, i.e., RNAi molecule, is referred to as dsLeATPf.

In a second aspect, the invention provides an RNAi pesticide for controlling Aphis Raphani, which comprises the RNAi molecule.

Alternatively, the RNAi pesticide may further comprise a carrier or adjuvant which is advantageous for the RNAi molecule, and which is capable of properly maintaining the stability and activity of the RNA molecule.

In one embodiment, the RNAi pesticides may be in the form of a lyophilized powder for constitution as a solution prior to use.

When the RNAi pesticide is applied as an aqueous solution, the concentration of the RNAi molecule in the aqueous solution may be 50-1000mg/L, for example 100-600mg/L.

In order to enhance the effect of the RNAi molecules on killing the aphids of the radish and improve the pest control efficiency of the RNAi pesticide, the invention also provides a synergistic formula which can be matched with the RNAi molecules to jointly form the RNAi pesticide with improved control effect. Specifically, the above RNAi molecules are dissolved in a synergistic formulation at a concentration of 20-500mg/L, e.g. 25-200mg/L, which can be a liquid formulation reported in patent document CN113100235a, consisting of, in weight percent: 1-3% potassium oleate; 0.1-0.5% geraniol; 0.005-0.05% synergistic ether; 0.05-0.3% diatomite; 0.005-0.03% xanthan gum; 0.5-2% SDS;0.05-0.3% sodium lauroyl sarcosinate; 0.05-0.3% Triton X-100;0.5-2% alkali chloride; 0.1-0.5% alkaline earth chloride; the balance of water.

Preferably, the synergistic formulation comprises the following components in percentage by weight: 2% potassium oleate; 0.3% geraniol; 0.01% synergistic ether; 0.1% diatomaceous earth; 0.01% xanthan gum; 1% SDS;0.1% sodium lauroyl sarcosinate; 0.1% Triton X-100;0.73% sodium chloride; 0.223% potassium chloride; 0.2% magnesium chloride; 0.1% calcium chloride; the balance of water.

In another aspect, the invention provides application of the RNAi molecule or RNAi pesticide in preventing and controlling Aphis Raphani. Namely, the RNAi pesticide is used for inhibiting the growth and breeding of the aphids and killing the aphids.

Specifically, the RNAi pesticide is applied to crops grown by Aphis carota. For example, the RNAi pesticide described above is applied to vegetables.

Experiments show that after the 500mg/L aqueous solution of RNAi molecules dsLeATPf provided by the invention is used for spraying vegetables, the 5-day lethal efficiency of the aphid of the radish can reach 81%, the LeATPf gene expression level is reduced by more than 76%, and excellent control effect is obtained; the synergistic formula can further improve RNAi effect of dsLeATPf; the pesticide effect persistence of RNAi pesticide for preventing and controlling the aphid of the radish is better than that of imidacloprid.

Drawings

FIG. 1 is a statistical bar graph of the rate of reduction of the insect population (A) and inhibition of LeATPf gene (B) of Aphis Raphani after 5 days of spraying of the leaves of Raphanus sativus with an aqueous solution of dsLeATPf.

Detailed Description

Aiming at the nucleotide sequence SEQ ID NO. 1 of the LeATPf gene of the Aphis Raphani, the inventor designs more than 50 double-stranded RNA molecules, and through verification, a plurality of RNAi molecules have inhibition effect on the LeATPf gene, wherein the double-stranded RNA molecule dsLeATPf with the sense strand of SEQ ID NO. 2 has the best RNAi effect.

As used herein, the terms "RNAi molecule", "dsRNAi", "double stranded RNA molecule" or "RNA interfering agent" are used interchangeably and refer to both meaning and scope of the term "RNA interfering agent" as used herein, and refer to a double stranded structural molecule formed by annealing of the sense strand and the antisense strand.

When dsLeATPf is used, the dsLeATPf can be directly dissolved in water to prepare an RNA aqueous solution for controlling the aphid of the radish.

The inventors have also found that the formulation of the synergist reported in patent document CN113100235a to enhance the insecticidal effect of dsRNA is still suitable for RNAi molecules of the present invention, and the use of the synergist in combination can enhance the lethal efficiency on the aphid of turnip, so that the usage amount of the RNAi molecules can be reduced, which is economically advantageous.

Preferably, the synergistic formulation comprises the following components in percentage by weight: about 2% potassium oleate; about 0.3% geraniol; about 0.01% synergistic ether; about 0.1% diatomaceous earth; about 0.01% xanthan gum; about 1% sds; about 0.1% sodium lauroyl sarcosinate; about 0.1% triton X-100; about 0.73% sodium chloride; about 0.223% potassium chloride; about 0.2% magnesium chloride; about 0.1% calcium chloride; the balance of water.

It is to be understood that the term "about" or "approximately" when used herein to describe a numerical feature means that the number represented can have a tolerance range of + -10%, + -9%, + -8%, + -7%, + -6% or + -5% or a float range.

When the synergistic formulation is mixed with RNAi molecules, the RNAi molecules are dissolved in the synergistic formulation at a concentration of 20-500mg/L, preferably 20-400mg/L, more preferably 25-200mg/L.

The invention will be further described with reference to specific examples and drawings. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

In the examples of the present invention, if no specific explanation is given for the experimental operating temperature, this temperature is usually referred to as room temperature (10-30 ℃).

The amounts, amounts and concentrations of various substances are referred to herein, wherein the percentages refer to weight percentages unless otherwise indicated.

Examples

Primer synthesis and RNA synthesis in the examples were performed by platinum Shanghai Biotechnology (Shanghai) and sequencing was performed by Shanghai Sanny Biotechnology Co.

Examples of molecular biology experiments include plasmid construction, digestion, ligation, competent cell preparation, transformation, medium preparation, etc., and are mainly described in "molecular cloning Experimental guidelines (third edition), J.Sam Broker, D.W. Lassel (America) code, huang Peitang, et al, scientific Press, beijing, 2002). The specific experimental conditions can be determined by simple experiments, if necessary.

The PCR amplification experiments were performed according to the reaction conditions or instructions provided by the plasmid or DNA template suppliers. Can be adjusted if necessary by simple tests.

Example 1: extraction of target genes

(1) Extraction of Aphis Raphani Total RNA

The method comprises the steps of taking the aphid of the radish as a material, extracting by adopting a conventional Trizol method, purifying by adopting a conventional method, and treating by DNase to obtain a Total RNA sample with the concentration of more than or equal to 300 ng/mu l, the Total amount of more than or equal to 6 mu g and the OD260/280 of 1.8-2.2.

(2) Isolation of mRNA and synthesis of cDNA

mRNA with polyA was isolated using oligo-dT-bearing magnetic beads, and then cDNA first strand was synthesized using random 6-mer and Invitrogen Superscript II reverse transcriptase kit to give LeATPf gene with nucleotide sequence of SEQ ID NO:1.

(3) Amplification of the LeATPf Gene and sequencing

Primers specific to the LeATPf gene of Aphis Raphani shown in Table 1 were designed.

TABLE 1 primer sequences used in the present invention

Primer name	Primer sequence (5 '. Fwdarw.3')
		LeATPf-F	ATGGGTTTTGGTGATTATCCG
LeATPf-R	TTAATGGTGCTTGTAGTTTCTA
		DsLeATPf-F	TAATACGACTCACTATAGGGCCATGGACCGTACGATCCTG
DsLeATPf-R	TAATACGACTCACTATAGGGTGAATCAATGGAGCAGCCGT
		DSGFP-F	TAATACGACTCACTATAGGGAGGACGACGGCAACT
DSGFP-R	TAATACGACTCACTATAGGGGAACTCCAGCAGGACCAT

Wherein F is a forward primer; r is the reverse primer.

The LeATPf-F/LeATPf-R primers in Table 1 were used to amplify the LeATPf gene of Aphis Raphani, the obtained gene fragment was purified and ligated into a PMD-18 vector (Takara Co.), E.coli Top10 strain was transformed, blue-white screening was performed, and positive strain sequencing was verified to be correct.

(4) Synthesis of RNAi molecules

For the LeATPf gene sequence, 53 RNAi molecules were designed. Synthesis of kit MEGAscript Using Thermo Fisher dsRNA ^TM T7 Transcription Kit (am 1334) was synthesized, see kit for specific procedures.

For example, the primer sequences for amplifying dsLeATPf are shown in Table 1, dsLeATPf-F/DsLeATPf-R, the sense strand of the amplified RNAi molecule is SEQ ID NO. 2, and the double-stranded molecule is named dsLeATPf.

In addition, dsGFP, a double stranded RNA molecule with the sense strand nucleotide sequence of SEQ ID NO. 3, was synthesized as a negative control for the comparative test. Primer sequences for amplification of dsGFP are shown in Table 1 for DSGFP-F/DSGFP-R.

Example 2: RNAi pesticide aqua for preventing and controlling Aphis carota

The synthesized double-stranded RNA molecules (including dsLeATPf and negative control dsGFP) are dissolved in pure water, the concentration of the double-stranded RNA aqueous solution is 500mg/L, the double-stranded RNA aqueous solution is uniformly sprayed on the surfaces of radish leaves by a sprayer, 10 nymphs of the aphids of the radish are inoculated into each leaf after the leaves are dried in the air, each treatment is repeated 5 times, the number of aphids and the LeATPf gene expression condition are counted on the 5 th day after the treatment, and the aqueous solution is used as a control. The results are shown in FIG. 1.

Figure 1 shows the statistics of aphid mortality and the levels of expression of the leapfs gene. It can be seen that the rate of aphid mouth drop of radish was 81.64 ±16.54% compared to the control (aqueous solution) after 5 days of RNAi molecule spraying (panel a); the LeATPf gene expression level was examined, and the relative expression level was decreased by 76.95% as compared with the control group (aqueous solution) (Panel B).

Example 3: indoor investigation of synergistic RNAi pesticide for controlling Aphis Raphani

In order to enhance the RNAi effect of the double-stranded RNA molecules and improve the pest control efficiency of the RNAi pesticide, the inventor also provides a synergistic agent which can be matched with the RNAi molecules to jointly form the RNAi pesticide with improved control effect. Specifically, the dsRNA is dissolved in a synergistic formulation at a concentration of 12.5-200mg/L, and the liquid formulation is a synergistic formulation reported in patent document CN113100235A, which consists of the following components in percentage by weight: 1-3% potassium oleate; 0.1-0.5% geraniol; 0.005-0.05% synergistic ether; 0.05-0.3% diatomite; 0.005-0.03% xanthan gum; 0.5-2% SDS;0.05-0.3% sodium lauroyl sarcosinate; 0.05-0.3% Triton X-100;0.5-2% alkali chloride; 0.1-0.5% alkaline earth chloride; the balance of water.

The synergistic RNAi pesticide is uniformly sprayed on the surfaces of radish leaves, and after the radish leaves are dried, aphids are inoculated to feed the radish leaves, and data of 1 day, 3 days and 5 days are tested and investigated indoors, and 70% imidacloprid is used as a reference, wherein 70% imidacloprid is a marketing product 'Bayer Eimeria nectar 70% imidacloprid Germany', and when the pesticide is used, the pesticide is sprayed according to the water proportion of recommended dosage of 1g/15L, and the result is shown in Table 2.

TABLE 2 indoor control effect of synergistic RNAi pesticide on Aphis Raphani

The results in Table 2 show that the control effect of the RNA interference agent on Aphis Raphani increases with increasing RNAi molecule concentration and treatment time within 1-5 days after treatment. The control effect (30.09% -78.51%) of the low-concentration RNA interfering agent (12.5 mg/L) on the 1 st to 5 th days after the medicament is obviously lower than that of imidacloprid; the control effect (42.55% -65.26%) of the RNA interfering agent (25 mg/L) with medium concentration on the 1 st day and the 3 rd day after application is obviously lower than that of imidacloprid (60.15% -83.65%); the control effect (86.91%) on day 5 after application was not significantly different from the control effect (98.81%) of imidacloprid. The control effect (49.94% -86.91%, 54.67% -92.96%, 68.05% -93.44%) of the RNA interfering agent (50 mg/L,100mg/L,200 mg/L) with medium and high concentration on the 1 st day to the 5 th day after application is not significantly different from the control effect (60.15% -98.81%) of imidacloprid. This shows that the indoor control effect of the medium-high concentration RNA interfering agent (50 mg/L,100mg/L,200 mg/L) on the Aphis Raphani aphid is not significantly different from that of the imidacloprid treatment group 1-5 days after the medicament treatment.

Example 4: field investigation of synergistic RNAi pesticide for controlling Aphis Raphani

In order to study whether the pest control effect of RNAi pesticide in actual use meets the expectations based on laboratory results, the application condition of the synergistic RNAi pesticide is examined in a vegetable field where radishes are planted, the synergistic RNAi pesticide is uniformly sprayed on the surfaces of leaves of the radishes, and data of 1 day, 3 days, 7 days and 14 days after RNAi pesticide treatment are examined in field tests. The results of the field test are listed in table 3.

TABLE 3 field control effect of synergistic RNAi pesticide on Aphis Raphani

Wherein 70% of imidacloprid is a product sold in the market of '70% imidacloprid of Bayer Eimeria Germany', and the imidacloprid is sprayed according to the water proportion of 1g/15L of recommended dosage when in use.

Table 3 shows that the control effect of the RNA interference agent on Aphis Raphani increases with increasing RNAi molecule concentration and treatment time within 1-7 days after the agent treatment. The control effect of the RNA interfering agent (100 mg/L,200 mg/L) with medium and high concentration on the 1 st to 7 th days after application is not obviously different from that of the imidacloprid; the control effect of the RNA interfering agent (12.5 mg/L,25 mg/L) with medium and low concentration on the 1 st to 7 th days after application is obviously lower than that of imidacloprid; the control effect of the RNA interfering agent (50 mg/L) with medium concentration is obviously lower than that of imidacloprid on the 1 st day after application, and the control effect on the 3 rd and 7 th days after application is not obviously different from that of the imidacloprid. On day 14 after application, the control effect of both the RNA interference agent and the imidacloprid treatment group was reduced, but the control effect of the RNA interference agent treatment group was reduced by a percentage (4.69% -8.69%) lower than that of the imidacloprid treatment group (39.69%). And the control effect (72.10% -82.82%) of the RNA interfering agent with medium and high concentration (50 mg/L,100mg/L and 200 mg/L) is obviously higher than that of the imidacloprid treatment group (51.68%). The result shows that the control effect of the RNA interfering agent with medium and high concentration (50 mg/L,100mg/L and 200 mg/L) on the aphid of the radish is equivalent to that of the imidacloprid in the early stage of application (1-7 days), but the control effect of the RNA interfering agent on the aphid of the radish is obviously higher than that of the imidacloprid in the later stage of application (14 days), and the persistence of the effect of the RNA interfering agent is superior to that of the imidacloprid.

The experiment shows that the RNAi molecule can effectively inhibit the aphid of the radish and lighten the harm of the aphid of the radish to crops such as vegetables, and the persistence of the drug effect of the RNAi pesticide is stronger than that of the traditional chemical imidacloprid, so that the RNAi molecule is environment-friendly, and the long-acting advantage of the biological pesticide relative to the chemical pesticide is reflected.

Sequence listing

<110> Shanghai plant-derived, uygur-biological technology Co., ltd

<120> RNAi molecules lethal to Aphis Raphani

<130> SHPI2110451

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 324

<212> DNA

<213> Lipaphis erysimi pseudobrassicae

<400> 1

atgggttttg gtgattatcc ggccgagtac aatccaaaag tccatggacc gtacgatcct 60

gctcgttact acggtacacc cgataaacct tttgggcaat taaaacttgg agaggtcact 120

gaatgggtgg gacgccgcaa caaatcacca aaagcaattg caggattatt ttctcgcgcc 180

tattggcgtt ggtcacacaa atacgttcaa ccaaaacgta caacggctgc tccattgatt 240

caaattcttg caggttcaat gttgttcttc tatgctatta actatggcaa atttgtgcat 300

catagaaact acaagcacca ttaa 324

<210> 2

<211> 201

<212> RNA

<213> Artificial sequence ()

<400> 2

ccauggaccg uacgauccug cucguuacua cgguacaccc gauaaaccuu uugggcaauu 60

aaaacuugga gaggucacug aauggguggg acgccgcaac aaaucaccaa aagcaauugc 120

aggauuauuu ucucgcgccu auuggcguug gucacacaaa uacguucaac caaaacguac 180

aacggcugcu ccauugauuc a 201

<210> 3

<211> 368

<212> RNA

<213> Artificial sequence ()

<400> 3

aggacgacgg caacuacaag acccgcgccg aggugaaguu cgagggcgac acccugguga 60

accgcaucga gcugaagggc aucgacuuca aggaggacgg caacauccug gggcacaagc 120

uggaguacaa cuacaacagc cacaacgucu auaucauggc cgacaagcag aagaacggca 180

ucaaggugaa cuucaagauc cgccacaaca ucgaggacgg cagcgugcag cucgccgacc 240

acuaccagca gaacaccccc aucggcgacg gccccgugcu gcugcccgac aaccacuacc 300

ugagcaccca guccgcccug agcaaagacc ccaacgagaa gcgcgaucac augguccugc 360

uggaguuc 368

Claims (10)

1. An RNAi molecule for inhibiting the ATP synthase gene of a turnip aphid, characterized in that it is a double-stranded RNA molecule consisting of a sense strand and a complementary antisense strand, wherein the nucleotide sequence of the sense strand is SEQ ID No. 2.

2. An RNAi pesticide for controlling aphis raphani, comprising the RNAi molecule of claim 1.

3. The RNAi pesticide of claim 1, further comprising a carrier or adjuvant that maintains the stability of the RNAi molecule.

4. The RNAi pesticide of claim 2, in a form of a lyophilized powder or solution.

5. The RNAi pesticide of claim 4, wherein the aqueous solution to which the RNAi molecule is applied has a concentration of 50-1000mg/L.

6. The RNAi pesticide of claim 2, wherein the RNAi molecule is dissolved in a synergistic formulation at a concentration of 20-500mg/L, said synergistic formulation consisting of, in weight percent: 1-3% potassium oleate; 0.1-0.5% geraniol; 0.005-0.05% synergistic ether; 0.05-0.3% diatomite; 0.005-0.03% xanthan gum; 0.5-2% SDS;0.05-0.3% sodium lauroyl sarcosinate; 0.05-0.3% Triton X-100;0.5-2% alkali chloride; 0.1-0.5% alkaline earth chloride; the balance of water.

7. The RNAi pesticide of claim 6, wherein the concentration of RNAi molecules is 25-200mg/L.

8. The RNAi pesticide of claim 6 or 7, wherein the synergistic formulation consists of the following components in weight percent: 2% potassium oleate; 0.3% geraniol; 0.01% synergistic ether; 0.1% diatomaceous earth; 0.01% xanthan gum; 1% SDS;0.1% sodium lauroyl sarcosinate; 0.1% Triton X-100;0.73% sodium chloride; 0.223% potassium chloride; 0.2% magnesium chloride; 0.1% calcium chloride; the balance of water.

9. A method for controlling aphids of the genus r.p, characterized in that the RNAi pesticide of claim 2 is applied to the crop plant in which the aphids of the genus r.p.p.p.p.p.p.p.m.

10. The method of claim 9, wherein the crop is a vegetable.

Images