CN115927729A

CN115927729A - Luding lily HIS (human immunodeficiency Virus) reference gene as well as primer and application thereof

Info

Publication number: CN115927729A
Application number: CN202211556584.1A
Authority: CN
Inventors: 马璐琳; 段青; 崔光芬; 贾文杰; 杜文文; 李想; 王祥宁; 王继华
Original assignee: Flower Research Institute of YAAS
Current assignee: Flower Research Institute of YAAS
Priority date: 2022-12-06
Filing date: 2022-12-06
Publication date: 2023-04-07

Abstract

The invention provides a Luding lily HIS reference gene and a primer and application thereof, belonging to the field of genetic engineering. The nucleotide sequence of the Luding lily HIS reference gene is shown as SEQ ID No. 1. The invention provides a Luding lily HIS gene sequence with the length of 402bp, which can be used as an internal reference gene for analyzing expression profiles of Luding lily fusarium wilt disease-resistant genes. Corresponding gene expression analysis (including RT-PCR and qRT-PCR) reference primers are designed according to research needs to analyze the expression conditions of fusarium wilt disease-resistant related genes in Luding lily or other lilium plants close to the Luding lily in relativity. The pair of the qRT-PCR analysis used reference primers can be directly used as the reference primers for qRT-PCR analysis of the expression situation of the Luding lily tissue culture seedling of the Luding lily fusarium wilt disease-resistant related gene in different times of induction of the Luding lily fusarium.

Description

Luding lily HIS (human immunodeficiency Virus) reference gene as well as primer and application thereof

Technical Field

The invention relates to the field of genetic engineering, in particular to a Luding lily HIS reference gene and a primer and application thereof.

Background

Lily (Lilium spp.) is a perennial root flower of liliaceae (liliaceae) Lilium, has beautiful flower appearance and bright color, and is popular among people. The yield value of lily in the global flower market is the third place, china is the first place, and in recent years, the market demand of lily cut flowers is increased year by year. However, with the continuous expansion of the planting area of lily cut flowers, lily diseases are increasingly serious. Fusarium oxysporum Wilt (Lily Fusarium Wilt) caused by Fusarium oxysporum transformation (Fusarium oxysporum f.sp.lilii) is the most important disease for damaging cut flowers and seed ball production of Lily at present. The lily fusarium belongs to soil-borne fungi, and has little chemical control effect. The method for cultivating disease-resistant lily varieties by using disease-resistant lily resources is the most economical and effective method for preventing and treating fusarium wilt of lily. Some Chinese specific wild hundreds resources including Luding lily, etc. show better resistance to lily fusarium wilt.

Yunnan is one of the distribution centers of lily plants, and has abundant wild lily resources. Luding lily (Lilium sangentaceae Wilson) is a unique lily resource in China, has beautiful flower type, white and fragrant flower color and strong adaptability, and shows better resistance to lily fusarium diseases. Although Luding lily has been used for lily breeding for disease resistance as one of important lily breeding parents, the resistance mechanism to fusarium wilt is still unclear.

In recent years, with the development of plant molecular biotechnology, people pay more and more attention to disease resistance mechanisms on the molecular level of lily. Researchers often use some detection technologies which are common at present, such as a transcriptome sequencing technology and the like, to screen and discover disease-resistant related genes from disease-resistant lily resources so as to analyze a resistance molecular mechanism of lily to fusarium wilt. Meanwhile, verification and analysis of the expression quantity of the disease-resistant related genes screened from the transcriptome sequencing result are usually completed through a qRT-PCR technology. However, the accuracy of the qRT-PCR result is easily affected by factors such as RNA quality, reverse transcription efficiency, primer specificity, sample amount, and PCR efficiency, and in order to ensure the accuracy of the qRT-PCR result, one or more stably expressed reference genes must be introduced to correct and standardize the qRT-PCR result. In the research of plant, housekeeping Gene (House-keepi ng Gene) with relatively high and stable expression is often used as an internal reference Gene. Although the ideal reference gene should be stably expressed in all cells, physiological conditions and sample types, a great number of recent studies have shown that absolutely stable genes are not expressed, and the so-called constant expression of any housekeeping gene is constant only in certain types of cells or under test conditions, so that it is important to select a suitable reference gene depending on different species, sample types, test conditions and the like.

When the expression profile analysis is carried out on the genes related to the fusarium wilt disease resistance of lily, the selected reference genes have certain differences due to different varieties, tissue samples, test conditions and the like of lily studied by researchers, even in different lilies under the same test conditions, for example: when researchers carry out expression analysis on fusarium wilt disease resistance related genes in Lilium regale, the most commonly used reference gene is GAPDH, and the reference gene used in the fusarium induced lilium Lanzhou is 18S. In addition, related research on screening and identifying the most suitable reference gene for expression analysis of fusarium wilt disease resistance genes in Luding lily is rarely reported. In view of the above, there is a need to screen and identify the reference gene most suitable for expression analysis of the resistance-related gene of Fusarium oxysporum of Luding lily.

Disclosure of Invention

In order to solve the problems, the invention provides a Luding lily HIS reference gene, a primer and an application thereof, and the Luding lily HIS reference gene sequence with the length of 402bp can be used as the reference gene for analyzing the expression spectrum of fusarium wilt disease-resistant related genes in the Luding lily. Corresponding gene expression analysis (including RT-PCR and qRT-PCR) reference primers are designed according to research needs to analyze the expression conditions of fusarium wilt disease-resistant related genes in Luding lily or other lilium plants close to the genetic relationship of the Luding lily. The pair of qRT-PCR analysis reference primers can be directly used as qRT-PCR reference primers for analyzing the expression conditions of the Luding lily fusarium wilt disease-resistant related genes in the Luding lily tissue culture seedlings at different times induced by the lily fusarium.

In order to achieve the above purpose, the invention provides the following technical scheme:

the invention provides a Luding lily HIS reference gene, the nucleotide sequence of which is shown as SEQ ID No. 1.

The invention also provides a primer for amplifying the Luding lily HIS reference gene in the technical scheme, wherein the nucleotide sequence of an upstream primer of the primer is shown as SEQ ID No.2, and the nucleotide sequence of a downstream primer is shown as SEQ ID No. 3.

The invention also provides the application of the Luding lily HIS reference gene in the technical scheme in the expression analysis research of the Luding lily fusarium wilt disease-resistant related gene.

Preferably, the disease-resistant related genes of the fusarium wilt of the luding lily comprise one or more of peroxidase genes, phenylalanine ammonia lyase genes, chitinase 1 genes, DIR protein genes, jasmonic acid-amide synthetase JAR1 genes and calcium binding protein CML49 genes.

Preferably, the study is analyzed using the qRT-PCR method.

Preferably, the amplification system used for the analysis and study by the qRT-PCR method is: cDNA 1. Mu.L, upstream primer 10. Mu. Mol. L ^-1 1 μ L, downstream primer 10 μmol. L ^-1 1μL，2×Taq Master Mix10μL，ddH ₂ O7. Mu.L, 20. Mu.L in total.

Preferably, the amplification procedure used for analytical studies using the qRT-PCR method is: pre-denaturation at 94 deg.C for 5min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s,30 cycles; extension at 72 ℃ for 10min and storage at 4 ℃.

The invention utilizes software such as geonorm, normfider, bestkeeper and the like to analyze the expression stability of 9 candidate internal reference genes containing HIS in samples such as 6 different times of Luding lily after induction of lily fusarium, 6 times (as a contrast) corresponding to sterile water treatment and the like. According to the analysis results of 3 pieces of software, calculating the comprehensive ranking of the expression stability of 9 candidate reference genes by adopting a geometric mean value method, screening out the reference gene with the most stable performance as the HIS gene through the comprehensive ranking, and screening out the expression conditions of 6 Luding lily disease-resistant related genes related to different disease-resistant ways by taking HIS as the reference gene in the sequence measurement result of the Luding lily transcriptome induced by fusarium. And (3) displaying a verification result: the analysis result of the expression profile of 6 disease-resistant related genes by utilizing the qRT-PCR reference primer designed according to the HIS gene nucleotide sequence is completely consistent with the expression condition of the 6 disease-resistant related genes in the transcriptome sequencing result of a 24h sample of the Luding lily treated by fusarium and sterile water. In conclusion, the results of the qRT-PCR result comprehensive evaluation on 9 candidate reference genes are combined with the results of the verification on 6 Luding lily disease-resistant related genes to prove that: the expression difference of the HIS gene in different time samples of lily fusarium and luding lily treated by sterile water is the smallest, and the expression is the most stable. A pair of qRT-PCR (quantitative reverse transcription-polymerase chain reaction) internal reference primers designed according to the HIS nucleotide sequence can be used as internal reference primers for analyzing expression conditions of disease-resistant related genes of the Luding lily fusarium wilt.

The invention has the beneficial effects that:

(1) The invention discloses an HIS (human immunodeficiency virus) reference gene in Luding lily (Lilium sanguinaria Wilson) and a pair of qRT-PCR (quantitative reverse transcription-polymerase chain reaction) analysis reference primers designed according to a nucleotide sequence of the HIS reference gene, which are a reference gene and qRT-PCR analysis reference primers for expression spectrum analysis of fusarium wilt disease resistance related genes from Luding lily and are reported for the first time. The reference primer can be directly used as the reference primer for qRT-PCR analysis of expression conditions of disease-resistant related genes of Fusarium oxysporum of Ludinglily. And designing an internal reference primer for carrying out semi-quantitative RT-PCR analysis on the expression conditions of the disease-resistant related genes according to the nucleotide sequence of the HIS gene.

(2) The idealized internal reference gene should be constantly expressed under various types of tissues, cells and environmental conditions. However, a number of studies have shown that absolutely stable genes are not expressed, and that the so-called constant expression of any reference gene is only "in range" constant in a certain cell type or environment. Therefore, the reference genes and primers used for the expression profiling of fusarium wilt disease-resistant related genes of some other plants or other lilies reported in the prior literature are not necessarily suitable for expression analysis of fusarium wilt disease-resistant related genes in Luding lilies or other lilies (different from the other lilies reported in the literature). Moreover, the screening and identification research of the most suitable reference gene used for the expression analysis of fusarium wilt disease-resistant related genes in Luding lily and other lilies of the same genus are rarely reported in the open. The application provides a HIS (human immunodeficiency Virus) reference gene nucleotide sequence from Luding lily and a pair of primers for qRT-PCR (quantitative reverse transcription-polymerase chain reaction) analysis, which can be used as a reference gene and a reference primer for qRT-PCR analysis when the expression condition of fusarium wilt disease-resistant related genes of the Luding lily is analyzed. In addition, the conservation of the same type of reference genes in the same genus species with relatively close relativity is relatively high, so the HIS gene can also be used as the optimum reference gene for expression analysis of fusarium wilt disease resistance related genes in other lily plants with relatively close relativity to Luding lily and a reference primer for qRT-PCR analysis.

(3) The primer for qRT-PCR analysis is short in amplified fragment, generally dozens of bp to 200bp, and the semi-quantitative RT-PCR analysis requires a long amplified fragment, so the primer for qRT-PCR analysis is not necessarily suitable for RT-PCR analysis. The invention not only provides a pair of reference gene primers which can be directly used for filtering the expression spectrum qRT-PCR analysis of the fusarium wilt disease-resistant related gene of lily, but also provides a conserved nucleotide sequence with the length of 402bp of the gene, and a researcher can design the reference primers for semi-quantitative RT-PCR analysis according to the nucleotide sequence of the gene according to the research needs of the researcher.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the embodiments will be briefly described below.

FIG. 1 shows qRT-PCR amplification curves of 9 candidate reference genes such as HIS;

FIG. 2 is qRT-PCR melting curves of 9 candidate reference genes such as HIS;

FIG. 3 is a distribution diagram of Ct values of 9 candidate reference genes such as HIS. The box body represents the concentration range of the Ct value, the central transverse line of the box body represents a median, the upper side and the lower side of the box body respectively represent an upper quartile and a lower quartile, and the upper end and the lower end of the box body respectively represent a maximum value and a minimum value;

FIG. 4 shows the qRT-PCR analysis result of expression of 6 disease-resistant related genes in Luding lily using HIS as the reference gene. F is a Luding lily tissue culture seedling treated by lily fusarium, and W is a control Luding lily tissue culture seedling treated by sterile water; 0h, 6h, 12h, 24h, 48h and 72h are Luding lily tissue culture seedling samples of 0h, 6h, 12h, 24h, 48h and 72h after treatment of the lily fusarium and sterile water respectively; * And represents p <0.05, p <0.01 and p <0.001, respectively.

Detailed Description

The invention provides a Luding lily HIS reference gene, the nucleotide sequence of which is shown as SEQ ID No.1 and specifically comprises the following components:

Atggccgggaagggcggcaagggactgatcgccggcaagaccacctctgccgccaaggacaaggacaagaagcgccccacctcccgctcctctcgcgctggcctccagtttccggtggggaggattcacaggcagttgaagtcgcggatcgcggcgaacggccgcgtgggtgcgacggcggcggtgtactcggcggcgattctggagtacctgacggctgaggtgctggagctggcggggaatgcgagcaaggatctgaaggtgaagcgcataacgcccaggcatctgcagctggcgatccgtggggatgaggagctggatacgctgatcaaggggactattgctgggggtggtgtgattccgcacatccataagtctctgatcaacaaatctgcgaaggag。

the invention also provides a primer for amplifying the Luding lily HIS reference gene in the technical scheme, wherein the nucleotide sequence of an upstream primer of the primer is shown as SEQ ID No.2, the nucleotide sequence of a downstream primer is shown as SEQ ID No.3, and the primer comprises the following specific steps:

SEQ ID No.2：5’-gattcacaggcagttgaagt-3’；

SEQ ID No.3：5’-ttcagatccttgctcgcat-3’。

In the invention, the disease-resistant related genes of the fusarium wilt of the luding lily preferably comprise one or more of peroxidase gene, phenylalanine ammonia lyase gene, chitinase 1 gene, DIR protein gene, jasmonic acid-amide synthetase JAR1 gene and calbindin CML49 gene.

In the invention, the nucleotide sequence of the peroxidase gene is shown as SEQ ID No.4, and specifically comprises the following steps:

tgcccgagcctcttgagtacaattaaaccagtagttcagtctgcgatcaacaccgaggcgcgaatgggtgcctccctcctccgcctcttcttccacgactgctttgtcaatggctgtgacgggtcgttgttattagacgacaccgccaacttcaccggggagaagacggcaacgcccaacaacaactccgtcagaggcttcaacgtcgtcgacaacataaaaaccgtagtcgaaaaggcctgcccgggtattgtctcgtgtgcggacatacttgccatcaccgcaatgcaatctgtaaacatacttggaggcccaagttggagtgtgaagttgggaagaagggatgcaagaacagcgagcctttcgggggctaatagtaacatcccaccaccaacctcaagtctcagcaatatcatctccaagttttcagcacaggggctgtccacaaaggacatggttgctctagctggt。

in the invention, the nucleotide sequence of the phenylalanine ammonia lyase gene is shown as SEQ ID No.5, and specifically comprises the following steps:

atggcacacattgtctgcgagaacggcaacggcttcgccgccgccgctgacggcaacggcaacggcctttgcctccatgccgaccccctcaactggcgggcggcggccgacgccatgtccggaagccatcttgatgaagtcagacagatggcggcagagttccgaaaaccggtggtgcgattagagggtgcaagtctgaatatatcgcaggtggcagcggtggcggctggccgggcggtgaaggtcgagctgtcggaggaggcgaggggccgcgtgaaggcgagcagcgagtgggtgatggagagcatgaataaggggacggacagctacggcgtcaccaccggcttcggcgccacctctcatcggagaaccaagcagggcggcgctttgcagaaggagctcatcagatttctcaatgccgggatcttcggcgccggaccggaagccggccagacgctgccatcgaccaccacccgagcggcgatgctcgtcagagtcaacaccctcctccaaggttactctggcatccgcttcgagatcctcgaggccatctcgagcctcctaaaccacaatgtcacaccctgtctccccctccgcgggacaatctccgcctctggtgacctcgtcccactctcgtacattgccggcatgctcatcggtcggcccaactcaatagccatcggtcccgacggcacgtatgtcaatgccaccgaagcattccgtctagctggcatctccggcggcttctttgagctccaacctaaggaggggctcgccatggtgaacggcactgctgtcggctccggcctcgcctccatggtcctctttgaagccaacatcctcgctgtccttgctgaggtgttatcggccgtcttctgtgaggtcatgcaggggaagccggagttcaccgaccacctcacccacaagctcaagcaccaccccggccagatcgaggccgccgccatcatggagcacatcctcgccggaagctcatacatgaaaatggcagcaaagatacacgaacaagacccactccagaaaccgaaacaagaccgatacgccctccgcacatcgcctcagtggctcggcccgcaaatcgaggtcatccgtgcatcgacaaagtcgatcgagcgggaaatcaattcagtcaacgacaacccgctcatcgatgtgtcacgtaacaaggctatccatggaggcaacttccagggcacccccatcggtgtctcaatggacaatactcgcctcgccatcgctgccatcgggaagctcatgtttgctcagatctcagaactcgtcaacgacttctacaacaatggcctcccctcgaacctctcgggcggtcgcaacccgagcctcgattatggcttcaagggggcagagatcgcaatggcgtcctactgctcggagctccagtttctggcgaatcccgtgacaaaccatgtccagagcgcagagcagcataaccaggatgtcaactctctggggctgatctcgtcaaggaagaccgctgaggcagtggagattctgaaactgatgtcttcgacttttctagtcgctctctgtcaggcggtcgacttgcgccatctggaggaaaatctgaaggcggccatcaagaatacggtcagccaggtggcgaagagggtgctgacaatgggagtcaatggggagctgcatccatcgaggttctgcgagaaggatctgatcaaggtcatagacagggagtacgtgttcgcctatgctgacgacccgtgcagcgccacttatccactgatgcagaaactgcgcggggtattggtggagcacgcactagtcaatggcgagaaggagaaggaagtggggacgtcaatattccagaagatcactgctttcgaggaggagctgaaggcgaccctgccgaaggaagtggagggggtgaggatggcattcgacaacggaaccaatgtgattgcaaacaggatctccgagtgcaggtcgtatccgctgtacaagtttgtcagggaagagctgggggccgggtaccttactggcgagaaggtgcgatcgccaggggaggagttcaacaaggtgttcattgccattagccaatggaaggtgatcgatcctttgctggagtgcttgagcaactggaatggcgcgccgctcccaatttgt。

in the invention, the chitinase 1 gene has a nucleotide sequence shown as SEQ ID No.6, which specifically comprises the following steps:

Atctgtgtctccgtcttgcttatctctgtctccgtcatcttgttctatggttcggcacagcattgcggcagccagctaggagatgcagtatgccccggtggactgtgctgcagcgagttcggctactgcggatctacgaccacgtattgcggtgatggttgccagagccagtgtagcggtgatggaagcggaggaggagttgggggtggaggtggtgtgagctcgattatcagctcatcccttttcaaccagatgctgctccaccgcaacgatgctgtctgccctgccaggggtttctatacctatgatgccttcattgctgccgccaattcctttagcggcttcgggacaaccggggatgccgatactcagaagagggagatagctgctttcttggctcagacttcccatgagacgactggtgggtggtcgactgcaccagacgggcaattcgcttggggctactgctttaaacaggagcaaggcaacccgccgccagactactgtgttgagagctcacagtggccctgtgctgcagacaggaagtactacggccgaggccccatccaaatctcctacaactacaactacggcccagccggacgggacatcaactcggaccttctcaacaacccagatcttgtcatcaccgacccgacaatctctttcaagacagcattgtggttctggatgaccgcgcagtggactaagccgtcgtgccacgcggttgcgactggagaatggactccatcggcggctgaccaatcggccgggcgggttccggggtatggtgtgataacgaacatcatcaatgggggtattgagtgcgggcatggagccgacaataagatggcggataggatcgggtattacaagagatactgtgatatgctgggagtcagctatggagctaacctggactgctacaatcagcagcatttc。

in the invention, the nucleotide sequence of the DIR protein gene is shown as SEQ ID No.7, and specifically comprises the following steps:

Ttgcagggcacagtcagcgggcctaacgccaccctcaccacggtggccaagacctcccccaatgcgaccctctttaccttcggaagcgtctccgtcctcgacgaccttctgacagcggggccagagcggagctcaaaagaggtcgggaggtgccaggggctggtagctcaggctcaactgtcaggcccaccagcatcagtagcagcagagaatttcatcttctcaacagggaagtacaacgggagcagcctcgccatggtagggagggtggaccctgtgaccggcacgtttgagctggcggtggttggtgggagcggcctattcaggctagcgaggggctacgcactcgctaaattcctcagcataaataccaccactggtacatctctcgtcgagtacgatgtctatgtg。

in the invention, the nucleotide sequence of the jasmonic acid-amido synthetase JAR1 gene is shown as SEQ ID No.8, and specifically comprises the following steps:

Atgagagagttcagtcttgactacgtgatagccgaattcgaggccgccacggccgacgccggccgcgtccaggtcgagacgctccgccggatcctcgccgagaacggcgacgccgagtatctccgggatctcggcctcgccggccggaccgatccggcgagcttcaaggcgtgtgtgccgctggtgtcgcaccaagatctggagccctatataaataggattatggatggggatgcttcggtgctgaccgggaagccgattacatcaatttcgctgagttccgggaccacgaaagggaagccgaagttcttgccgtttaatgatgaattgctgaattctactatgcagatttataagacctcgtttgccttcagaaataaagaattccctctcgggcatggaaaggctttgcagttcatttacggtagcaagaagtttgactcgaagggggggctcatagtaacgacagccacctgtaacatataccgaagtgaagaattcaagcacacaatgaaggacatccagtctcagtgttgcagcccagatgaagttgtattcggtcccgacttccatcaatctttatattgccaccttctatgtggcttaatctacgctgacgaagtgcagcttgtgtctgcgaccttcgcgcacagcatcgtccatgcttttcgaacatttgagctcgtttgggaagagctttgtactgatatcagagaaggccttctctccagcaggattactgacccatctgtccgcgcagttttttctaagatactgacccctaatccaagtcttgcagactctattcacaggaaatgtgtgggtttgagcaactggtatggcttgattcccgaactttggcccaatgctaaatatgtttatgggattatgacggggtcaatggagccatatgcaaagaaactgcgccattatgcggggagcttaccgttggtgtgttctgattacggttcgtcggaaggatggattggtgctaatgttaaccctagtttgcctccggagtctgcaactgttgtggttcttcctgatataggttatttcgaatttattcctttagcggaaaaatctgaggaccaggatctggtgaagatggctaccaccattaactataaagaagcagagccagtgggtttgacggacgtcgaaatcggcaaggagtatgagattgtcatcaccaattttgcagggttatatcggtacaggcttggggatgttgtgaggatagccggcttccacaactcaacacctgagctgcagttcgtctgcaggaggagcctacttctcaacataaacattgacaagaacaccgagaaggacctgcagatttccgtcgaagaggcaggcaagctcctagctgcagagaagaacgaagtcgtggacttcaccagccatgtggacttctccacctaccccgctcactatgtgatcttctgggagctgagctctgatgcaactgatgaagttcttaacagctgttgtgactgtttggaccgtgcctttgtggatgctggctacactgggtcgaggaagagtaaagccatcggacccctcgagctccgtgtggtccggaaggggacctttcagaagatcatgatccatcatttgtctctc。

in the invention, the nucleotide sequence of the calcium binding protein CML49 gene is shown as SEQ ID No.9, and specifically comprises the following steps:

Acggatccgaacgttgtggcctgtttccaggcggcggaccatgatgggagtgggtttattgatgatactgagctgcagggggcgctgtcgtcatataatcagagcttcagcatgaggacggtgcatttgctcatgtacctgtttacgtcgtcgaatgttcgcaagatcggcccgaaggaattcacctcggttttttacagtttgcagagttggaggggcatcttcgatagggctgatcgtgatcggagtggcaagattgatgccccggagctgagggacgcacttatgagcctggggttcgctgtctcccccgtggtgttggatctgctcgtctccaagtttgacaagtccggaggaaaaaacaaggccattgagtatgatggttttatcgagtaagttcttctgttaaccacatcttcttttgccactcaggcttccagcattgaaattgatggtatctctagttggcattaatttctattttgtccttctgtataatacacaggtgttgtctcattgtgaagggactgacagagaagttcaaggagaaggatgtggggttcagggggtcggcgactttcacttatgaatctttcatgctgactgttcttcctttcctcg。

the invention preferably adopts qRT-PCR method for analysis and study. In the present inventionThe amplification system used for analysis and research by adopting the qRT-PCR method is preferably as follows: cDNA 1. Mu.L, upstream primer 10. Mu. Mol. L ^-1 mu.L, downstream primer 10. Mu. Mol. L ^-1 1μL，2×Taq Master Mix 10μL，ddH ₂ O7. Mu.L, 20. Mu.L in total. In the present invention, the amplification procedure used for analytical studies using the qRT-PCR method is preferably: pre-denaturation at 94 ℃ for 5min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s,30 cycles; extension at 72 ℃ for 10min and storage at 4 ℃.

In order to further illustrate the present invention, the following examples are given in detail, but they should not be construed as limiting the scope of the present invention.

Example 1

The percentage numbers represent percent by mass unless otherwise specified herein.

Luding lily (a well-known public material, seqing, trefoil, jiavingjie, mallulin, wang Shenhua, du Wen, wang Xiangning Yunan Luding lily 8 wild habitats chromosome karyotype analysis Wen plant proceedings 2016, 36 (3): 0472-0478) was collected from around Jinshajiang, weixi county of Diqing province, yunnan. Luding lily with the same genetic background is propagated and stored through a tissue culture technology, when the tissue culture seedling grows to be about 6-8cm high in a culture room, the tissue culture seedling with basically consistent growth vigor is selected, and the rhizome of the tissue culture seedling is cut to carry out induction on the lily fusarium. After induction of fusarium, 10 tissue culture seedlings are selected and mixed according to the same induction time to be used as samples in the same treatment time period, and meanwhile, samples in the corresponding time period treated by sterile water are used as a control. 3 biological replicates were set per sample. Taking a part of a 24-hour Luding lily tissue culture seedling sample which is induced by fusarium and treated by sterile water for carrying out transcriptome sequencing analysis. The total sample is used for screening the stability of the most suitable reference gene and verifying and analyzing the expression of the disease-resistant related gene.

According to the name of a common reference gene in a plant, searching gene id and a nucleotide sequence corresponding to the gene in a transcriptome sequencing result, and then searching FPKM values of the gene in 6 Luding lily samples of 24h after fusarium induction and 24h after sterile water treatment according to the gene id corresponding to the reference gene. Reference genes having FPKM values of more than 50 and substantially identical among the 6 samples were selected as candidate reference genes. 9 more commonly used candidate reference genes were screened (table 1), wherein the nucleotide sequence of the HIS reference gene was: <xnotran> atggccgggaagggcggcaagg gactgatcgccggcaagaccacctctgccgccaaggacaaggacaagaagcgccccacctcccgctcctctcgcgctggcctccagtttccggtggggaggattcacaggcagttgaagtcgcggatcgcggcgaacggccgcgtgggtgcgacggcggcggtgtactcggcggcgattctggagtacctgacggctgaggtgctggagctggcggggaatgcgagcaaggatctgaaggtgaagcgcataacgcccaggcatctgcagctggcgatccgtggggatgaggagctggatacgctgatcaaggggactattgctgggggtggtgtgattccgcacatccataagtctctgatcaacaaatctgcgaaggag. (SEQ ID No. 1) ( qRT-PCR ). </xnotran>

The other 8 candidate internal reference genes are: the nucleotide sequences of aquaporin gene (AQP), tubulin gene (TUB), glyceraldehyde phosphate dehydrogenase Gene (GAPDH), cyclophilin gene (CYP), transcription elongation factor gene (EF-1. Alpha.), 60S ribosomal protein gene (60S ribosomal protein L13-1, RPL13), polyubiquitin gene (UBQ), phosphoglycerate kinase (PGK) are as follows:

aquaporin gene (SEQ ID No. 10):

Gacaagctcaccggcaacggtcccgccacccccgctggcctcgtcgcggcctccctcgggcacgcctacgcactcttcgtcgctgtctctgtcggagccaacatctccggcggccacgttaaccccgccgtcaccttcggtgccttccttggcggcaacatcaccctcatccgcggcatcctctactggatcgcccagctcctcggctccaccgtcgcctgcttactccttcgctacaccaccggcctccccaccggtaccttcgcccttgttgagggagtcagcgtctggaacggcctggtacttgaaatcgtcatgactttcgggttggtctacaccgtctacgccaccgctattgacccgaagaagggtagtattggtaccattgccccaatcgccattggtttcatcgtcggcgctaacattcttatcggtggggcgttcagcggtgcctcgatgaacccggccatcgcttttggcccggccttggttagctggagctgggcgagccactgggtgtactgggctggtccgctcatcggcggtggccttgctgggatagtctatgagatcttcttcattgatcatcattcgcacgagccgctccccgccaacgactac。

tubulin gene (SEQ ID No. 11):

Atgagggagatcatcagcatccacatcggccaggccgggatccaggtcggcaactcctgctgggagctctactgcctcgagcatggcatccagccggatggaatgatgcccagtgatgactccgtcggcgtcgcgcacgacgcgtttaacacgttcttcagcgaaaccggcgccggcaagcacgtgccgcgggcgatcttcgtggatctggagccgacggtgatcgacgaggtcaggacggggacgtatcgccagctgtttcatcccgagcagctgattaccggcaaggaggacgcggcaaacaacttcgcccgcggacattacacagtggggaaggagattgttgacctgtgcctggatcggatcaggaaattggcggataactgcactggattgcaggggttcttggtgttcaatgcagttggcggtgggactggatcagggtttgggtccttgttgctggagaggttgtcggtggattatgggaagaagtctaagctcggatttaccatctatccttccccgcaggtttctactgcagtcgtggagccatataacagtgtcctctcaacccatgcactgcttgagcatactgatgtttcggttctattggacaatgaggcaatctatgacatttgccgaaggtcactagatattgagagaccgacctacaccaacttgaaccggttgatatcccagaccatatcctctttgaccacttccttgaggtttgatggagccattaatgtcgatataactgagttccagactaacctggtgccctatcctcgaatccatttcatgctctcctcgtatgcccctgtaatctctgcagagaaagcataccatgaacagctttcagtcccggagataacaaatgctgtgtttgagccctcgagcatgatggcgaaatgcgacccaaggcatgggaagtacatggcctgttgtttaatgtaccgtggagatgtcgtgccgaaggatgttaatgctgctgttgccacaatcaaaaccaagaggactgtccagtttgttgattggtgtccgactggtttcaagtgtggaattaactatcaagccccgacagttgtccctggcggagacctagcaaaggtacagcgtgctgtctgcatgatcagtaacaacacagctgttgctgaagtgttctcacggattgaccacaagtttgatcttatgtatgccaagcgtgcatttgttcactggtatgttggggaagggatggaagagggggagttctcggaagcccgagaggatctggctgccctggagaaggactatgaggaagttggagcagagggggctgatgatgatggggaagagccagaagactat。

glyceraldehyde phosphate dehydrogenase gene (SEQ ID No. 12):

Tatgatcagatcaaggctgctatcaaagaagagtctgaggggaaactgaaaggaatccttggctatattgatgaggatttggtgtccactgattttgtgggtgacagcaggtcaagcatttttgatgccaaggctgggattgctttgaatgacaactttgtgaagctggtggcatggtatgacaatgaatggggctacagcactcgtgtggttgatctcctccgccacatggctgcaaccaag。

cyclophilin gene (SEQ ID No. 13):

Atggcgagcaacccccgagtcttcttcgaaatgtctgtcggtggtgcttcggctggccggatcgtgatggagctcttcgccgacgtagtcccccgaacggcggagaacttccgcgccctatgtaccggcgagaaggggaagggccgctccggtaagcccctccacttcaagggatcgagcttccaccgcgtgatccctgactttatgtgccagggcggtgactttactcgcggtaacggcaccggtggcgagtctatctatggcgagaagttcgcggatgagaatttcgtccgcaagcacactgggcctggggttttgtccatggctaatgctgggcctaataccaatgggtctcagtttttcatctgcactgctaagacggcttggctggatggtaagcatgttgtgtttgggcaggttgtggaggggttggatgtggtgaaggcgattgagaaggtggggtcgcagagcggcacgaccaagaagccggttgtgattgttgattgcggccagctt。

transcription elongation factor gene (SEQ ID No. 14):

Atgggtaaagagaaggttcacattaacattgtcgtcattggccatgttgactccggcaagtcaactaccactgggcatcttatttacaagcttggtggtattgacaagcgtgtgatcgagcggtttgagaaggaggctgctgagatgaacaaaaggtcattcaagtatgcgtgggtgcttgataagctgaaggccgagcgtgagcgtggtatcaccattgatattgctctctggaagttcgagaccaccagatactactgcactgtcattgatgcccctggccatcgtgacttcatcaaaaacatgattactggaacttctcaggctgattgtgctgtccttattattgactctaccactggtggttttgaggctggtatttccaaggatggtcagactcgtgagcatgccctgctcgctttcactcttggtgtgaagcagatgatctgttgttgcaacaagatggatgccacaaccccaaagtactccaaggccaggtatgatgaaattatcaaggaggtttcttcatacctcaagaaggtcggttacaacccagaaaaaattccctttgttccgatctctgggtttgagggtgataacatgattgagaggtccaacaacctcgactggtacaagggtcccaccctccttgaggcccttgacttgatcaatgagccaaagaggcccacagacaagcccctccgccttccccttcaggatgtgtacaagattggaggcattggaactgtgccagtcggccgtgtggagactggtattgtgaagcctggtatggtagtgactttcgggccaactggtctgaccactgaagttaagtctgttgagatgcaccatgaggctcttcttgaagccctccctggtgacaatgtgggatttaatgtgaagaatgttgctgtcaaggatcttaagcgtgggtttgtcgcctctaactccaaggatgaccctgccaaggaggcggccaacttcacttcccaggttatcatcatgaaccaccctggccagatcggtaatggttatgctcctgtcctggattgccacacctcccacattgctgttaagtttgctgagatcctgaccaagattgacaggcgatctggtaaggagattgagaaggagcccaagtttttgaagaatggtgatgctggatttgtgaagatgattccgaccaagcctatggtggtggagactttctctgagtatcccccccttgggcgttttgctgttagggacatgcgccagactgttgctgttggggttattaagagtgttgagaagaaggatcccactggtgccaaggtgaccaaggccgctatcaagaagaag。

60S ribosomal protein gene (SEQ ID No. 15):

Ctctcaataaattcgccgccggctcgctctagggtttccaagcggcgacggatctagcacgaacccgccggaatcatgccgaagcagatccgtgagatcaaggatttccttctcacagctcggaggaaagacgcccgctctataaagatcaagaggagcaaggatgtcgtcaagttcaaggtccggtgctccaggtacctctacacgctctgcgtgaatgatccggagaaggcggataagttgaagcagtcacttccgccaggtttaagtgttcaagaggtt。

polyubiquitin enzyme gene (SEQ ID No. 16):

Gagagctcggacaccattgataatgttaaggccaagattcaggacaaggagggcatccctccggaccagcagagactcatctttgctggaaagcagctagaggacggccgcacactggctgactacaacattcagaaggagtccactctccatctggtactccgcctcaggggaggtatgcagatttttgtcaagacccttacagggaaaacgatcaccctggaggttgagagctctgataccattgacaacgtcaaagcgaagattcaggacaaagagggtatccccccagaccagcagcgcctgatctttgcagggaagcaactcgaagatggccgcacccttgcggactataacattcagaaggagtccactctccatctggtactccgcctcaggggtggcatgcagatctttgtcaagacgctcaccggaaagaccattactctagaggtggagagctctgatacaatcgacaatgtgaaggcgaagatccaggacaaggagggaattcctccggaccagcagaggctcatctttgctgggaagcagctggaggacggtcgcacacttgctgattacaacattcagaaggagtcgacgctgcaccttgtcctccgtctccgtggtggccagtaatttctctattctgatccttgttggttatttctctgatctgatgcttggttttgg。

phosphoglycerate kinase (SEQ ID No. 17):

Atggcggcgaagcggagcgttggcgacctcaaggaggcggatctgaagggcaagagggtgtttgtcagggttgatctcaacgtccccctcgacgacagcctcaagatcaccgacgacactcggattcgcgctgccgtgccgacgatcaaatatctcagagatcacggcagccgtgtcatcctatgctcccaccttggacgccccaaaggtgtcactccgaaatacagcttgaagccaattgtccctaggctatctgaacttcttggagtaaatgttgagatggctaatgattgtatcggtgaagaagttgaaaagttggtggctgggctgccagatggaggtgttctactacttgaaaatgtgagattctacaaggaagaagagaagaatgatcctgagtttgcaaagaagctcgcctcgctcgctgacctctatgtgaatgatgcttttggtactgctcacagggctcatgcttcaaccgagggagttgccaaattcttaaagccagctgttgccggcttccttatgcagaaggaacttgattaccttgttggtgctgtagcaaaccccaacaggccctttgccgccattgttggtggctcaaaggtgtcctccaagatcggggttatcgaatcacttttcgagaaggttgatatcctttatcttggcggaggaatgatatttacattttacaaggcacaagggtactctgtcggttcatcacttgtagaggaagacaagcttgatctcgcaacagcacttctcgagaaagcgaaggctaaaggcgtacgactaatgttgcctacggatgtggttgctgctaacaagtttgcagcagatgcggagagcaaggttgtacctgccactggcatcccagatggttggatggggcttgatatcggaccagactctattaaatcttttagtgagtcattggacaccaccaagaccatcatctggaatgggcctatgggagttttcgagtttgagaggtttgctgcaggaacagaggcaattgcgaagaagttggctgaactgactggaaagggggcggtaaccatcatcggaggtggagattctgttgcagcggtggagaaggcgggtcttgcggataagatgagccacatctctaccggtggtggtgccagtttggagttgttggagggcaagtcactcccgggggttcttgcgcttaacgacgcc。

meanwhile, 6 genes possibly participating in plant disease resistance pathways are selected from the differentially expressed genes according to the transcriptome sequencing KEGG clustering result (Table 1).

6 disease resistance related genes: nucleotide sequences of peroxidase gene (POD), phenylalanine ammonia lyase gene (PAL), chitinase 1 gene (CHITINAse 1, CHI 1), DIR protein gene (DIR), jasmonic acid-amide synthetase JAR1 gene (JAR 1), calcium-binding protein CML49 gene (calcium-binding protein CML49, CML 49) are shown in SEQ ID Nos. 4-9.

Primers were designed based on the nucleotide sequences of the above candidate reference genes and disease-resistance-associated genes using the Roche LCPDS2 software (Table 2). qRT-PCR amplification was performed on 36 total samples in 6 time periods each (3 biological replicates each) of fusarium and sterile water treated luding lily tissue culture seedlings. According to mirVana ^TM Total RNA was extracted from each sample according to the RNA Isolation Kit (Invitrogen, USA), and RNA integrity was determined by 1% agarose gel electrophoresis using a NanoDrop2000 spectrophotometer to detect the concentration and OD260/OD280 of the total RNA. 0.5. Mu.g of total RNA was used for cDNA synthesis according to the TransScript All-in-one SuperMix (Tiangen, beijing) instructions, and the synthesized cDNA was diluted 10-fold and stored in a freezer at-20 ℃ for further use.

By using

Type II fluorescent quantitative PCR instrument (Roche, switzerland), referred to PerfectStart ^TM Green qPCR Super Mix (Tiangen, beijing) instructions for qRT-PCR reactions. qRT-PCR reaction System: 1 mu L of cDNA, 10 mu mol.L-11 mu L of upstream primer, 10 mu mol.L-11 mu L of downstream primer, 10 mu L of 2 xTaq Master Mix, 7 mu L of ddH2O, and 20 mu L of total primer; reaction procedure: pre-denaturation at 94 deg.C for 5min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ plus extension for 30s,30 cycles, with 3 technical repeats per reaction set-up. Detecting the product specificity through a melting curve after the reaction is finished: slowly raising the temperature from 60 DEG CThe fluorescence signal was collected 5 times at 1 ℃ per temperature increase to 97 ℃. The mean value was calculated from the raw Ct values by Microsoft Excel 2016. And then 3 pieces of software such as Normfider, geNorm and Bestkeeper are used for analyzing the stability of the reference genes in different samples. When data are analyzed by the NormFinder and the geoNorm, the original Ct value of each sample is converted into a relative expression Q value and then is introduced into software, and finally, an M value reflecting the stability of the candidate gene is calculated. BestKeeper is used for screening the optimum reference gene by directly analyzing SD value and CV value between original Ct values, the smaller the SD and CV is, the more stable the gene expression is, the SD is>1 indicates the instability of gene expression. And finally, calculating gene stability values obtained by analysis of 3 software such as Normfider, geNorm, bestkeeper and the like through a geometric mean value method, comprehensively sequencing the expression stability of all candidate genes, and finally screening to obtain the most stable reference gene according to the comprehensive stability ranking.

And (3) taking the candidate gene HIS which is screened out by comprehensive ranking and has the most stable performance as an internal reference gene, and carrying out qRT-PCR analysis on the expression quantity of 6 disease-resistant related genes in the Luding lily. The qRT-PCR reaction system and procedure were as described above. The results of qRT-PCR employed 2 ^(-ΔΔCt) And (4) calculating by a method. Statistical analysis was performed using mean ± standard deviation, and the comparison between the two groups of samples was performed using independent sample t-test, with p <0.05 considered statistically different and p <0.01 considered very significantly different. The data were processed using Microsoft Excel 2016 and R3.2.3 software to generate a graph.

TABLE 1 Fusarium induced Luding lily transcriptome sequencing results screened FPKM values of 9 candidate reference genes and 6 disease-resistant related genes

TABLE 2 qRT-PCR analysis primers for expression of 9 candidate reference genes and 6 disease-resistant related genes of Luding lily

TABLE 3 analysis of Ct values of candidate reference genes

Sorting	Internal reference gene	Mean value (MD)	Standard Deviation (SD)	Coefficient of Variation (CV)
					1	AQP	26.424	0.507	1.919％
2	PGK2	27.813	0.569	2.045％
					3	HIS	26.641	0.729	2.737％
4	CYP	24.449	0.723	2.958％
					5	RPL13	26.490	0.788	2.973％
6	UBQ	23.659	0.704	2.977％
					7	EF-1α	21.526	0.646	3.003％
8	TUB	26.769	0.859	3.210％
					9	GAPDH	32.612	1.242	3.809％

TABLE 4 results of stability analysis of 9 candidate reference genes by geNorm, normFinder and BestKeeper

TABLE 5 comprehensive ranking analysis of candidate internal reference stability

Sorting	Internal reference gene	Geometric mean
			1	HIS	1.587
2	CYP	2.080
			3	PGK	2.884
3	UBQ	4.121
			5	AQP	4.309
6	EF-1α	5.192
			7	TUB	6.000
8	RPL13	7.652
			9	GAPDH	9.000

As can be seen from table 1: according to 9 candidate internal reference genes including HIS screened from the transcriptome sequencing results, FPKM values in 6 samples of 3 different treatments of 24h (L _24_T _) of lily fusarium-induced Luding lily and 24h (L _24_T _) of sterile water-treated Luding lily were both over 50 and substantially consistent. Compared with a sample treated by sterile water, 6 disease-resistant related genes are up-regulated in a 24-hour sample of the fusarium induced Luding lily, and only up-regulation times have certain difference.

As can be seen from fig. 1: the amplification effect of the 9 candidate reference genes is good, the repeatability of the amplification curve is good, and the experimental result is accurate and reliable.

As can be seen from fig. 2: except for GAPDH in some samples, the melting curves of other 8 candidate reference genes in 9 candidate reference genes are all obvious single peaks, and no primer dimer exists, so that the primer specificities of the 8 reference genes except GAPDH are good, the specificity is high, the result is accurate and reliable, and the qRT-PCR standard is met. While the primer specificity of GAPDH performed relatively poorly in some samples.

As can be seen from table 3 and fig. 3: ct values for the 9 candidate reference genes ranged from 20.21 to 34.82.GAPDH has the largest average Ct (MD) of 32.612 and the lowest expression level. The GAPDH also had the largest coefficient of variation, 3.809%, and therefore the stability was the worst.

As can be seen from table 4: analysis of the results by the geNorm and Normfider software showed that the HIS gene had the best stability among the 9 candidate reference genes, while GAPDH had the relatively worst stability. The best stability of CYP and the relatively worst stability of GAPDH are obtained by analyzing Bestkeeper software.

As can be seen from table 5: the comprehensive evaluation result of the stability of 9 candidate internal reference genes analyzed by using Excel to geNorm, normfider and Bestkeepe 3 software shows that the stability of HIS is best shown in the 9 candidate internal reference genes, so that HIS is also most suitable for the internal reference genes for expression analysis of fusarium wilt disease-resistant related genes in lily at different times of fusarium induction.

As can be seen from fig. 4: taking 0h of sterile water treatment as a control, the average expression tendency of 6 disease resistance related genes in fusarium-treated samples is higher than the expression level of the fusarium-treated samples (in 6 time period samples, the expression conditions of 4 or more than 4 fusarium-induced time period samples are higher than the expression level of the control samples). In particular, 24h shows that 24h induced by fusarium of 6 disease-resistant related genes is higher than 24h induced by sterile water, and the result is consistent with the sequencing result of a transcriptome. The results of qRT-PCR verification and analysis of expression profiles of 6 disease-resistant related genes prove that HIS is stably expressed in fusarium and samples treated by sterile water at different times, and the method can be used for carrying out qRT-PCR expression analysis on the disease-resistant related genes in the lily at different times induced by fusarium.

Although the present invention has been described in detail with reference to the above embodiments, it is only a part of the embodiments of the present invention, not all of the embodiments, and other embodiments can be obtained without inventive step according to the embodiments, and the embodiments are within the scope of the present invention.

Claims

1. A Luding lily HIS reference gene is characterized in that the nucleotide sequence of the Luding lily HIS reference gene is shown as SEQ ID No. 1.

2. A primer for amplifying the Luding lily HIS reference gene as defined in claim 1, wherein the nucleotide sequence of the upstream primer of the primer is shown as SEQ ID No.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 3.

3. The use of the Luding lily HIS reference gene of claim 1 as an analysis of expression profiles of Luding lily fusarium wilt disease-resistant related genes.

4. The use of claim 3, wherein the Luding lily fusarium wilt disease-resistance-associated genes comprise one or more of a peroxidase gene, a phenylalanine ammonia lyase gene, a chitinase 1 gene, a DIR protein gene, a jasmonate-amide synthetase JAR1 gene, and a calbindin CML49 gene.

5. Use according to claim 3, characterized in that the study is analysed using the qRT-PCR method.

6. Use according to claim 5, characterized in that the analysis of the amplification system used in the study using the qRT-PCR method is carried out using: cDNA 1. Mu.L, upstream primer 10. Mu. Mol. L ^-1 1 μ L, downstream primer 10 μmol. L ^-1 1μL，2×TaqMasterMix10μL，ddH ₂ O7. Mu.L, 20. Mu.L in total.

7. The use according to claim 5, wherein the analysis study using the qRT-PCR method uses an amplification procedure of: pre-denaturation at 94 ℃ for 5min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s,30 cycles; extension at 72 ℃ for 10min and storage at 4 ℃.