CN112575107A

CN112575107A - Reference gene for lily miRNA detection and application thereof

Info

Publication number: CN112575107A
Application number: CN202011518669.1A
Authority: CN
Inventors: 贾桂霞; 张倩; 汪莲娟; 高雪; 赵玉倩; 李介文; 何恒斌; 黄艺璇
Original assignee: Beijing Forestry University
Current assignee: Beijing Forestry University
Priority date: 2020-12-21
Filing date: 2020-12-21
Publication date: 2021-03-30

Abstract

The invention relates to the technical field of molecular biology, in particular to an internal reference gene for lily miRNA detection and application thereof. The invention provides an internal reference gene for lily miRNA detection, which has a nucleotide sequence shown in any one of SEQ ID NO. 1-4. The internal reference genes miRn46 and miR399a provided by the invention can be stably expressed in different growth and development stages, tissue parts, abiotic stress and biotic stress conditions of lily, and are suitable for being used as internal reference genes for relative level detection of lily miRNA under different experimental conditions. Compared with the traditional internal reference gene, the miRn46 and miR399a have higher stability as the internal reference gene, and the accuracy of detecting the relative level of the lily miRNA can be obviously improved.

Description

Reference gene for lily miRNA detection and application thereof

Technical Field

The invention relates to the technical field of molecular biology, in particular to an internal reference gene for lily miRNA detection and application thereof.

Background

The lily is an important bulbous flower with edible, medicinal and ornamental values, and has very important economic value. In order to improve the characteristics of lily plants, important physiological processes of the lily plants, including flowering, disease resistance, asexual propagation regulation and control mechanisms and the like, need to be researched by using modern molecular biological means, and the detection of the expression abundance of lily genes is necessarily involved.

With the refinement of plant biogenetic research, the functional research of miRNA in various physiological processes of lily is also increasing. miRNA (microRNA) is an endogenous non-coding RNA with the length of about 21nt, and is proved to play an important regulation role in the physiological process of plants.

qRT-PCR (quantitative real-time polymerase chain reaction) is one of the most common biological means for researching gene expression patterns and comparing gene expression abundance, and has the characteristics of high sensitivity, easy operation, good specificity and rich information. Among the factors affecting the accuracy of the experimental result, the selection of the reference gene for standardizing the experimental result is a prerequisite and key for ensuring the accuracy of the experimental result. As an internal control, the ideal internal reference gene should ensure a high and stable expression level under experimental conditions, i.e., easy detection and constant expression. However, under different conditions, no reference gene with absolutely stable and constant expression exists. Meanwhile, the qRT-PCR amplification product of miRNA is shorter, the difference of the expression quantity of partial miRNA under different conditions is larger, and the miRNA detection difficulty is larger than that of the qRT-PCR of mRNA. Therefore, in the qRT-PCR experiment of miRNA, stable reference genes are selected, and the method is more important for ensuring the accuracy of results.

Currently, in plants, more traditional reference genes are used, including snRNA U6, rRNA 5S, 5.8S, 18S, GAPDH (glyceraldehyde-3-phosphate dehydrogenase) and the like, which are widely involved in basic cellular processes and are relatively uniformly expressed in all cells. However, under some experimental conditions, these conventional reference genes are not expressed in a constant amount (the tellin O, Zorzi W, Lakaye B, Borman BD, Coumans B, Hennen G, Grisar T, Igout A, Heinen E. Housekeeping genes as internal standards: use and limits. J Biotechnol.1999; 75(2): 291-. In addition, the genome of the lily is huge, the physiological regulation process is complex, but the report of the stability of candidate reference genes suitable for miRNA qRT-PCR in lily under different experimental conditions is not found at present. Therefore, before qRT-PCR detection with miRNA as the detection object, screening of reference genes suitable for as many experimental conditions as possible, especially samples related to different growth and development, is necessary to ensure the accuracy of the detection result.

Disclosure of Invention

The invention aims to provide an internal reference gene for lily miRNA detection and application of the internal reference gene.

In order to obtain the internal reference gene which is stably expressed under different conditions and is used for detecting the lily miRNA, the invention firstly constructs a lily Small RNA library, in the Small RNA library, firstly, the expression profile of the miRNA is determined by adopting a normalization method, and simultaneously, the screening of the differential expression gene is carried out. miRNA with high expression and no significant difference (p-value >0.05) in the library under different conditions are selected as candidate internal reference genes to participate in stability evaluation. 5 miRNAs which are higher in expression quantity and more stable under different conditions are obtained through screening, and are used as candidate reference genes, and the candidate reference genes are further screened by taking lily hybrid varieties of Xinbuhui lily and wild variety Minjiang lily as experimental materials. The new Lilium formolongi and Lilium regale (L.regale) are two kinds of Lilium brownii with excellent properties and wide application, and the Lilium brownii and the Lilium regale are excellent materials for growth and development and disease resistance research respectively. The new ironmaking lily has beautiful posture and pure white flower color, is especially different from most lily seedlings which can bloom in two to three years, can bloom without vernalization in one year, and has the characteristics of short vegetative growth and rapid flowering. The wild Lilium regale, the flowering time of the seedlings is 2-3 years, but the disease resistance, especially the resistance to fungal pathogens, is strong. In the two lilies, different methods are utilized to systematically evaluate the expression stability of candidate internal reference genes under different experimental conditions (including different growth and development stages, tissue parts, abiotic stress and biotic stress), and finally excellent internal reference genes miRn46 (the sequence of a mature body is shown as SEQ ID NO.1, and the sequence of a precursor is shown as SEQ ID NO. 2) and miR399a (the sequence of a mature body is shown as SEQ ID NO.3, and the sequence of a precursor is shown as SEQ ID NO. 4) which can be applied to as many experimental conditions as possible are obtained, and the detection performance of the two miRNAs as the internal reference genes is obviously superior to that of the traditional internal reference genes (5S, 5.8S, U6 and the like).

Specifically, the invention provides the following technical scheme:

in a first aspect, the invention provides an internal reference gene for lily miRNA detection, which has a nucleotide sequence as shown in any one of SEQ ID NO. 1-4.

The internal reference gene provided by the invention is miRNA, specifically miRn46 and miR399a, wherein the nucleotide sequence of a mature body of miRn46 is shown as SEQ ID No.1, the precursor sequence is shown as SEQ ID No.2, the nucleotide sequence of a mature body of miR399a is shown as SEQ ID No.3, and the precursor sequence is shown as SEQ ID No. 4.

The reference gene is used for detecting relative level of lily miRNA.

The miRn46 and the miR399a can be stably expressed in different growth and development stages, tissue parts, abiotic stress and biotic stress conditions of the lily, and are suitable for being used as reference genes for lily miRNA level detection under different experimental conditions. Wherein, the miRn46 is suitable for being used as an internal reference gene for detecting the relative miRNA level of the new lilium cupreum, and the miR399a is more suitable for being used as an internal reference gene for detecting the relative miRNA level of the lilium regale.

In a second aspect, the invention provides a biological material containing the reference gene, wherein the biological material is an expression cassette, a vector or a host cell.

In a third aspect, the invention provides a primer for amplifying the reference gene, wherein the nucleotide sequence of the primer is shown as SEQ ID NO.5-6 or shown as SEQ ID NO. 6-7.

For the internal reference gene miRn46, the amplification primers are shown as SEQ ID NO. 5-6. For the internal reference gene miR399a, amplification primers are shown as SEQ ID NO. 6-7. The primer has higher specificity and sensitivity when used for amplifying miRn46 and miR399 a.

In a fourth aspect, the invention provides a kit comprising primers as shown in SEQ ID NO.5-6 or SEQ ID NO. 6-7. The kit can be used for detecting the relative level of the lily miRNA.

Optionally, the kit further comprises a buffer selected from PCR reaction buffer, DNA polymerase, dNTP, MgCl₂And one or more of a positive control and a negative control.

In a fifth aspect, the invention provides an application of the internal reference gene or a biological material containing the internal reference gene or an amplification primer of the internal reference gene or a kit containing the primer in detecting the relative level of lily miRNA.

Preferably, the invention provides application of an internal reference gene with a sequence shown as SEQ ID NO.1 or 2 in detecting the relative level of the new lilium formosanum miRNA. The invention also provides application of the reference gene with the sequence shown as SEQ ID No.3 or 4 in detecting relative level of Lilium regale miRNA.

In a sixth aspect, the invention provides an application of the internal reference gene or a biological material containing the internal reference gene or an amplification primer of the internal reference gene or a kit containing the primer in quantitative or semi-quantitative PCR detection of lily miRNA.

In a seventh aspect, the invention provides an application of the internal reference gene or a biological material containing the internal reference gene or an amplification primer of the internal reference gene or a kit containing the primer in detection of relative level change analysis of lily miRNA in different tissues, different growth and development periods or different stress conditions.

In an eighth aspect, the invention provides a method for detecting relative levels of lily miRNAs, which uses the internal reference gene as an internal reference gene and adopts quantitative or semi-quantitative PCR to detect the relative levels of the lily miRNAs.

Specifically, the method comprises the following steps: and (3) taking the reference gene as the reference gene, carrying out qRT-PCR on the lily miRNA to be detected and the reference gene simultaneously, and carrying out relative quantification on the level of the miRNA to be detected according to the level of the reference gene.

The invention has the beneficial effects that: the internal reference genes miRn46 and miR399a provided by the invention can be stably expressed in different growth and development stages, tissue parts, abiotic stress and biotic stress conditions of lily, and are suitable for being used as internal reference genes for relative level detection of lily miRNA under different experimental conditions. Compared with the traditional internal reference genes (5S, 5.8S, U6 and the like), the miRn46 and the miR399a have higher stability as the internal reference genes, can obviously improve the accuracy of detecting the relative level of the lily miRNA, and have important significance for the expression and function analysis of the lily miRNA.

Drawings

Fig. 1 is a precursor secondary structure prediction of a new miRNA of lily serving as a candidate reference gene in example 1 of the present invention, wherein a black region is a mature miRNA sequence.

FIG. 2 shows the result of the specificity analysis of the amplification primers for 8 reference genes in example 2 of the present invention, wherein M: DL500DNA Marker; 1-8: 5.8S, 5S, U6, miR399a, miR2916, miR5083, miRn43 and miRn 46.

FIG. 3 is a box plot of Cq values of candidate reference genes under different conditions in Lilium buergerianum and Lilium regale in example 3 of the present invention, with the middle indicator of the box being the median, the top (bottom) of the box being the upper (lower) quartile and the + being the mean.

FIG. 4 is the final ranking of the RankAggreg gene stability of two lilies under each experimental condition in example 3 of the present invention.

FIG. 5 is an analysis of expression patterns of miR156a in two lily growth processes with different genes as internal references in example 4 of the invention; s1, 2-3 rosette leaves period; s2, 5-6 rosette leaves period; s3, 9-10 internode intervals; s4, showing bud period; a, the relative level of miR156a in different growth and development processes of the new lilium formolongi under different internal reference genes; and b, the relative level of miR156a in different growth and development processes of Lilium regale under different reference genes.

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.

Example 1 acquisition of candidate reference genes

In a new lilium formolongi small RNA library, firstly, determining an expression profile of miRNA by a normalization method, and simultaneously, screening differential expression genes by taking P-value less than or equal to 0.05 as a threshold value. According to the expression patterns and the expression quantities of the miRNAs in different growth and development periods, the miRNAs with high expression quantities and no significant difference (p-value >0.05) in expression in libraries under different conditions are selected as candidate reference genes to participate in stability evaluation. The new miRNA meeting the conditions needs to satisfy the general determination conditions of miRNA: the secondary structure of the precursor should conform to the basic principles of reported miRNA annotation (Jeyaraj A, Zhang X, Hou Y, Shangguan M, Gajemerman P, Li Y, Wei C. genome-wide identification of connected and non-micro RNAs in one bud and two tenters leaves of tea Plant) by small RNA sequencing, micro-basic hybridization and genome-basic scanning sequences. Plant biol.2017; 17(1): 212; Jones-Rhoads MW, Bartel DP, Bartel B. MicroRNAS and the microorganism in plants. Nu. Biov.53; 19-19. Biond. 53). The secondary structure of these new miRNA precursors was predicted by the RNAfold online software http:// rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi.

Through screening, 5 miRNAs which are high in expression quantity and stable under different conditions are obtained as candidate internal reference genes, wherein the candidate internal reference genes comprise 3 conservative miRNAs (miR399a, miR2916 and miR5083) and 2 new miRNAs (miRn46 and miRn 43). While the secondary structure of the precursors of 2 new mirnas all fulfilled the conditions for forming mirnas (figure 1). The lengths of the precursors of miRn46 and miRn43 are 101 and 109nt, respectively, the thermodynamic free energies are-38.75 and-58.40 kcal/mol, respectively, and the MFEI is 1.1 and 1.0, respectively, which all meet the basic principles of miRNA annotation. The sequence information of the above 5 mirnas is shown in table 1, and these 5 mirnas were used as candidate reference genes for subsequent stability evaluation. According to the research results of the prior art and the screening results of preliminary experiments, three traditional reference genes, namely 5S, 5.8S and U6, are selected as controls to participate in stability evaluation together with candidate reference genes.

TABLE 1 sequence information of miRNA as candidate reference genes

Example 2 primer design and primer-specific amplification test of candidate reference genes

Primer design is carried out according to the mature sequences of miR399a, miR2916, miR5083, miRn46 and miRn43 which are identified in the library. The primer sequences for each miRNA and the control reference gene are shown in table 2.

TABLE 2 primer sequences and related information for candidate and control reference genes

Before quantitative PCR detection is carried out, the specific amplification effect of the target candidate reference gene on the primer is detected by using the conventional PCR technology. The primers in Table 2 were specifically amplified by PCR, and the reaction system (20. mu.L) was as shown in Table 3, and the reaction procedure included: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 deg.C for 45s, annealing at 62 deg.C for 1min, extension at 72 deg.C for 2min for 30s, and 33 cycles; finally, 2min at 72 ℃.

The specific amplification effect is verified by agarose gel (3%) electrophoresis, and as a result, as shown in fig. 2, a single band of each amplification product can be seen, and the length of the single band is consistent with that expected, so that the primers of the candidate reference genes can be used for subsequent qRT-PCR experimental analysis.

TABLE 3 primer-specific amplification reaction System for candidate reference genes

Example 3 evaluation of stability of candidate reference Gene

In order to evaluate the stability of expression of candidate reference genes in different experimental conditions, the following different experimental conditions were set with the lily hybrid "new lilium formolongi" (l. formolongi) ('leishan No. 2'), wild lily regaining (l. regale) as the study subject:

(1) different growth and development stages

The hybrid lily species "new Cannabis lily" (L.times.formolongi) ('Leishan No. 2'), wild species Lilium regale (L.regale), which were sand-stored (4 ℃) for about 1 month, sowed in a plug and grown under natural conditions in a greenhouse. Selecting 3 robust plants with consistent growth vigor at different growth and development stages of two lily seedlings, including a rosette leaf stage, a pepperweed extraction stage and a visible bud (about 1cm buds), and collecting middle leaves of the plants. All samples were immediately frozen in liquid nitrogen and stored at-80 ℃.

(2) Different organ tissues

The different healthy and strong fresh tissues of the same plant with the same growth vigor, including the leaves, the middle part of the stem, the middle part of the seed ball, the scales, the roots and the tender seeds of the 3 plants in the adult period of the two lilies are respectively collected. Likewise, the frozen liquid nitrogen is stored at low temperature.

(3) Abiotic stress: high temperature treatment

To analyze the stability of the reference genes in the case where two lilies were subjected to abiotic stress, the lilies sown in the pot (10 weeks after sowing) were transplanted to a greenhouse and grown under long-day high-temperature conditions (16h light (32 ℃)/8h dark (16 ℃) with a humidity of 70%). The fresh leaves of the two lilies were collected after heat treatment for 0, 12 and 22 weeks, respectively.

(4) Biotic stress: botrytis ellitica treatment

Respectively collecting mature leaves of the new lilium formolongi and the lilium regale in the bud period (the bud is about 1cm) and positioned in the middle of plant stems. After washing with distilled water, two fresh hypha blocks with a diameter of 5mm were placed in the middle of the leaf while avoiding the main veins. The leaves being processed are placed in a tray containing 90% -100% moisture wrap. Leaves were collected at 0, 6, 12 and 24hpi (time post inoculation, hours) post inoculation and used for material preparation for subsequent extraction of mirnas.

The evaluation method of the expression stability of the candidate reference gene in different experimental conditions is specifically as follows:

1. extraction of miRNA and synthesis of cDNA

(1) MiRNA extraction

miRNA extraction was performed for each sample using miRcute miRNA extraction isolation kit (Tiangen Bio, Beijing, China) according to the kit instructions.

(2) Poly A tailing

The extracted mirnas were polyA tailed using Polymerase e.coli poly (a) Polymerase kit (Invitrogen, USA) in the reaction system shown in table 4. Reacting at constant temperature of 37 ℃ for 1h, and storing the product at-80 ℃.

TABLE 4 MiRNA Poly (A) tailing reaction System

(3) cDNA Synthesis

Then, reverse transcription was performed by using Quant Script RT Kit (Tiangen Bio, Beijing, China), the reaction system is shown in Table 5, Oligo dt primer sequence is GCGAGCACAGAATTAATACGACTCACTATAGG(T)12VN, and the obtained cDNA was diluted and used as a template for subsequent qRT-PCR experiment.

TABLE 5 first Strand cDNA Synthesis reaction System

2. qRT-PCR analysis

The qRT-PCR liquid system was run on a Bio-Rad CFX96(CFX96Touch, BIO-RAD, USA) real-time fluorescent quantitative PCR instrument using the THUNDERBARRD SYBR qPCR Mix Without Rox (Toyobo, Shanghai, China) system and data were read automatically. The 20. mu.L liquid reaction system is as in Table 3, wherein the target gene, the upstream and downstream primers and the template were diluted 10-fold, and the final concentration was 10. mu. mol/L. The reaction procedure comprises: pre-denaturation at 95 ℃ for 30 s; denaturation at 95 deg.C for 10min, annealing at 50-59.4 deg.C (see Table 2 for details) for 15s, extension at 72 deg.C for 15s, and 38 cycles. Each sample contained three technical replicates.

3. Cq values of candidate reference genes in different lilies

The Cq values of the selected 5 candidate reference genes and 3 control reference genes in lilium trifolium (l. times. formolongi) and lilium regale (l. regale) under different experimental conditions were obtained by qRT-PCR experiments. The Cq value is inversely proportional to the expression level, and a higher Cq value indicates a lower expression level.

As shown in FIG. 3, the dispersion degree of Cq values of each reference gene in different lilies is different, and the dispersion degree of Cq values of the reference genes in Lilium regale is larger than that of the new Lilium Candidum. In all samples, the Cq mean values of the internal reference genes of the two lilies are different, the lowest value is Min Jiangzhong 5S (18.60), the highest value is miR399a in the new lilium formolongi, and the Cq mean value is 38.60. In the new cannon, the Cq value of miR399a is the highest, the expression level is the lowest, the Cq value is 38.60, the Cq value of 5.8S is the lowest (16.90), and the expression level is the highest. However, in Lilium regale, the Cq value of U6 was the highest (37.30) and the lowest was 5S (11.87).

4. Evaluation of candidate reference Gene stability

Stability of candidate reference genes three calculation programs geNorm based on Excel software, NormFinder and BestKeeper (Vanderometric J, De PK, Pattyyn F, Poppe B, Van RN, De PA, Speleman F. accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Biol 2002; 3: RESARCH 0034; PfaflMW, Tichoroad A, Prgomet C, New vision TP. determination of stable genetic encoding genes, differential detailed prediction genes and sample integration: BestKeeper-Excel-group rule-related PCR 526. qualitative rule-PCR 5245; sample modification of primer-primer PCR 5245; sample PCR 5245, sample PCR 526. evaluation of sample PCR. In the qRT-PCR experiment, the Cq (RT-qPCR-derived quantification) value directly reflects the expression level of each candidate internal reference gene under a certain experimental condition. The three programs derive expression stability values (M) based on the Cq values obtained, according to the basic principles and different calculation methods in the instruction manual, which are then further compared to rank the stability of the candidate genes. In addition, the stability of these candidate genes was evaluated using the method of delta Ct using pairwise comparisons of Cq of different internal reference genes in the same sample (Vanderampele J, De PK, Pattyn F, Poppe B, Van RN, De PA, Speleman F. Accate nomenclature of real-time qualitative RT-PCR data by genomic organization and orientation of multiple internal control genes. genome biol. 2002; 3: RESARCH 0034; Silver N, test S, Jiang J, the in SL. selection of useful genes for expression in human diagnostic genes. BMC Mol. biol. 2006; 7(1) 33-33. finally, the stability of the candidate genes was evaluated in a comprehensive manner by the method of parallel analysis of four different internal control genes. BMC genome sequencing of BMC. biol. 2006; 7. for coding. 7. for coding. 7. the stability of the same candidate genes. By integration, a final ranking of candidate gene stability comparisons is obtained.

The method for evaluating the stability of the candidate reference gene and the result are as follows:

(1) GeNorm analysis

Through analysis and calculation of the geonorm program, M values of stability expression of the candidate reference genes under different experimental conditions in the two lilies are obtained, and the stability of the candidate reference genes is sequenced. Wherein the smaller the value of M, the higher the stability of the candidate reference gene under the experimental conditions.

(2) NormFinder analysis

The expression variation of the samples among the groups was evaluated by using the NormFinder, and a stable value of each candidate gene was obtained. Likewise, the smaller the stability value, the more stable its expression.

(3) BestKeeper analysis

The stability of 5 candidate and 3 control reference genes were ranked according to the Standard Deviation (SD) and Coefficient of Variation (CV) obtained by bestkoeper. The smaller the standard deviation value, the higher the stability of the candidate reference gene.

(4) Delta CT and Rank Aggreg analysis

The Delta CT (Δ Ct) method compares pairs of genes in each sample using a comparison of relative expression levels (Cq values). And (3) sequencing the stability of the candidate reference genes by comparing the absolute deviation of delta Ct in the two lilies.

Finally, the stability ranking of the candidate internal reference genes obtained by all the previous method programs is integrated by using an R package RankAggreg to obtain a final ranking, so that the candidate internal reference genes are comprehensively evaluated (figure 4).

In conclusion, stability evaluation was performed on neotame lily and Lilium regale under different experimental conditions (including different growth and development stages, different organ tissues and stress conditions) on 3 traditional reference genes and 5 miRNA candidate reference genes screened from the neotame lily small RNA library, and the obtained experimental results show that the new miRNA mirnas miRn46 are most stable in all samples of the neotame lily (Table 6), and miR399a is the most suitable reference gene in the Lilium regale under different experimental conditions (Table 7), compared with other candidate reference genes and traditional reference genes.

TABLE 6 stability comprehensive ranking of candidate reference genes in all samples of Lilium Candidum

TABLE 7 stability comprehensive ranking of candidate reference genes in Lilium regale all samples

Example 4 stability validation of miRn46 and miR399a as candidate reference genes in qRT-PCR detection

In order to further verify the application effect of miRn46 and miR399a as internal references in qRT-PCR detection, important genes miR156a participating in growth and development regulation are taken as detection objects, and the relative levels of the two lily in the growth process are analyzed when the most stable internal reference genes, other stable internal reference genes under the condition and the less stable internal reference genes (determined according to the evaluation result of example 3) in the two lilies are taken as the internal references. In the new lilium formolongi, the used reference genes including miRn46, and miR399a which is more stable and 5.8S which is less stable (as a control) are used as the reference genes for the analysis of the expression pattern. And in Lilium regale, miR399a, miR2916 which is more stable under the condition and miRn46 which is less stable are used as internal reference genes.

The result of relative level detection of miR156a in fresh Cannabis lily by taking miRn46 as an internal reference gene is shown in a of figure 5, and when the most stable miRn46 and the more stable miR399a are taken as internal reference genes, the expression patterns of miR156a are very close, namely, the expression patterns are firstly reduced and then are increased in the S4 period. While a different expression pattern was exhibited when the less stable 5.8S was the internal control. The result can show that the miRn46 can be used as an internal reference gene to be applied to the new lilium formolongi and used for judging the relative level and the change trend of miRNA, and has better standardization effect.

The result of carrying out relative level detection on miR156a in Lilium regale by taking miR399a as an internal reference gene is shown in b of figure 5, and in Lilium regale, miR156a firstly keeps up-regulated expression and then down-regulated expression by taking miR399a as an internal reference gene. The expression pattern is consistent with the trend of taking miR2916 which is more stable in the growth process as an internal reference. When the most unstable miRn46 is used as an internal reference, the level of miR156a shows a gradual rising trend, which is different from the expression patterns when miR399a and miR2916 are used as internal references. The results show that the miR399a can be used as an internal reference gene applied to Lilium regale and used for judging the relative level and the change trend of miRNA, and the accuracy and the reliability of the detection result are higher.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Beijing university of forestry

<120> reference gene for lily miRNA detection and application thereof

<130> KHP201117722.3

<160> 22

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ttcactgcca ccatccgcct gc 22

<210> 2

<211> 116

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gtttctggag ccgcaggaga tcgtgagcag tgaagatgct cagatgctct gctttgcgga 60

gatctgagta tcttcactgc caccatccgc ctgccgctca gaactccgct cttctt 116

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tgccaaagga gacttgccct g 21

<210> 4

<211> 118

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tgtgcagctg cattactggg caacactcct ctgacagtag gcggctcagg tgagttaatg 60

tggcctccaa aatttgtcta ctgccaaagg agacttgccc tgcaatgcaa tttgctct 118

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ttcactgcca ccatccgcct g 21

<210> 6

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gcgagcacag aattaatacg ac 22

<210> 7

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tgccaaagga gaattgccc 19

<210> 8

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

attcctatgt cgctcaatcc aata 24

<210> 9

<211> 138

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ggaaagggag ctgaaggatc cggaatcaat ttgggattga gaacagagga atgaagagct 60

aaattttcat tcctatgtcg ctcaatccaa tagattccgg ttcctcccat tcctcgtcct 120

ctcactgtaa cctttgta 138

<210> 10

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ccataaacga tgccgacc 18

<210> 11

<211> 91

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tgggggctcg aagacgatca gataccgtcc tagtctcaac cataaacgat gccgaccagg 60

gatcggcgga tgttgctttt aggactccgc c 91

<210> 12

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tcagactaca attatctgat c 21

<210> 13

<211> 380

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tcctggcagt tcttcagata atcagatttg tccatgaggt ttcaactgtt gcattccatt 60

gttgagtttt attctgtttg cgtttctgtt tgtttttgtc atggatctgg ctgattggag 120

gctgtgatga ccaaaaaata cctacctatt ttctgaggga ttccagtcct tctgattgat 180

agaaaccaat ggatccttct gagcctgcca agatcttcag attcttagtt ttgtattcgg 240

ctttttcgat ttgtcttcgt atattgcatt cttctaaaag caagcaagat tcgtaacagt 300

tgatgggatg ataacctttc acagaaactg tatgtgttga cccaaaattc agactacaat 360

tatctgatca actcagacat 380

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

aaatgcccga cattaagctg 20

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ttgcaatttc tcaccatcca 20

<210> 16

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

gttgcagggt gcgatcata 19

<210> 17

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

agggggtcac ccatcctagt 20

<210> 18

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

gataaaattg gaacgataca g 21

<210> 19

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

atttggacca tttctcgatt t 21

<210> 20

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

ccataaacga tgccgacc 18

<210> 21

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

tcagactaca attatctgat c 21

<210> 22

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

attcctatgt cgctcaatcc aata 24

Claims

1. An internal reference gene for lily miRNA detection is characterized by having a nucleotide sequence shown in any one of SEQ ID NO. 1-4.

2. The biomaterial containing the reference gene according to claim 1, wherein the biomaterial is an expression cassette, a vector or a host cell.

3. The primer for amplifying the internal reference gene as claimed in claim 1, wherein the nucleotide sequence of the primer is shown as SEQ ID NO.5-6 or shown as SEQ ID NO. 6-7.

4. A kit comprising the primer according to claim 3.

5. The kit of claim 4, wherein the kit further comprises a buffer selected from the group consisting of PCR reaction buffer, DNA polymerase, dNTP, MgCl₂And one or more of a positive control and a negative control.

6. Use of the reference gene of claim 1 or the biological material of claim 2 or the primer of claim 3 or the kit of claim 4 or 5 for detecting relative levels of lily miRNAs.

7. Use of the reference gene of claim 1 or the biological material of claim 2 or the primer of claim 3 or the kit of claim 4 or 5 for quantitative or semi-quantitative PCR detection of lily miRNA.

8. Use of the reference gene of claim 1 or the biological material of claim 2 or the primer of claim 3 or the kit of claim 4 or 5 for detecting the change in the expression level of a lily miRNA in different tissues, different growth and development stages or different stress conditions.

9. A method for detecting relative level of lily miRNA, characterized in that the internal reference gene of claim 1 is used as internal reference gene, and quantitative or semi-quantitative PCR is used to detect relative level of lily miRNA.