CN115927405A

CN115927405A - Gene sequence for coding P450 enzyme and cytochrome P450 reductase derived from fusarium graminearum and recombinant strain thereof

Info

Publication number: CN115927405A
Application number: CN202211427007.2A
Authority: CN
Inventors: 李爱涛; 李倩; 王玲; 魏灵睿
Original assignee: Hubei University
Current assignee: Hubei University
Priority date: 2022-11-15
Filing date: 2022-11-15
Publication date: 2023-04-07

Abstract

The invention discloses a gene sequence for coding P450 enzyme and cytochrome P450 reductase derived from fusarium graminearum and a recombinant strain thereof, belonging to the technical field of biological engineering, wherein the gene sequence has a nucleotide sequence from 1 to 1542 in SEQ ID NO.1 or an amino acid sequence in SEQ ID NO.3 and a nucleotide sequence from 1 to 2079 in SEQ ID NO.2 or an amino acid sequence in SEQ ID NO. 4. The gene sequence for coding the P450 enzyme from the fusarium graminearum provided by the invention realizes the heterologous expression of the P450 enzyme from the fusarium graminearum by respectively taking saccharomyces cerevisiae INVSC1 and pichia pastoris GS115 as expression hosts. The recombinant strain can hydroxylate progesterone to obtain 12 beta-hydroxy progesterone, 15 alpha-hydroxy progesterone and 12 beta, 15 alpha-dihydroxy progesterone.

Description

Gene sequence for coding P450 enzyme and cytochrome P450 reductase derived from fusarium graminearum and recombinant strain thereof

Technical Field

The invention belongs to the technical field of biological engineering, and particularly relates to a gene sequence for coding P450 enzyme and cytochrome P450 reductase derived from fusarium graminearum and a recombinant strain thereof.

Background

Steroid drugs are widely applied to the aspects of anti-inflammation, anti-allergy, anti-virus, sexual function regulation, life maintenance and the like, are second class drugs to antibiotics at present, more than 400 steroid hormone drugs are used, the market sales amount exceeds 1000 hundred million dollars, the application range of the steroid drugs is more and more extensive, and the specific modification of the parent nucleus of the steroid drugs is often required for further development of new drugs. The chemical synthesis of steroid drug intermediates usually has a plurality of steps, a large amount of chemical raw materials are consumed, and non-green products are generated in the process. The method for converting the steroid compounds by using the special enzymes of the microorganisms has the advantages of few reaction steps, mild reaction conditions and less public hazards, and avoids the problems of poor product selectivity and generation of a large amount of byproducts caused by a plurality of enzymes in the microorganisms when the microorganisms are simply used for conversion, thereby being an important trend for sustainable development of the chemical industry.

The hydroxylation conversion of steroid substances by steroid microorganisms can be regarded as being catalyzed by a P450 enzyme system contained by the microorganisms. Cytochrome P450 enzymes are widely available, and P450 is found in animals, plants, fungi and bacteria. Various types of reactions can be catalyzed, such as hydroxylation, peroxidation, epoxidation, dehalogenation, deamination, etc. The fungi contain a large amount of cytochrome P450, so that the steroid hydroxylation reaction which can be catalyzed by the fungi is large. The catalytic activity of the hydroxylation occurring with P450 is that the P450 enzyme binds to oxygen molecules in the air and takes electrons from NADPH and introduces oxygen atoms into the substrate to hydroxylate steroid molecules.

The hydroxylated steroid can be further chemically synthesized as an intermediate, so that other steroid drugs with diversified structures can be obtained. Furthermore, hydroxylation products of carbon atoms at different positions often exhibit different pharmacological activities. Wherein, the 12 beta-and 15 alpha-hydroxylated steroids have antifungal, anti-inflammatory and anticancer effects, and contraceptive and neuroprotective effects. For example, 12 β -hydroxy-didehydro alcohol is a key precursor to deoxycholic acid, which has antifungal, anti-inflammatory, bile secretion promoting effects; the 15 alpha-hydroxy-nandrolone can be used for preparing estradiol, and the estradiol is an important estrogen and is used for contraception, neuroprotection, breast tumor treatment and the like; the 7 alpha, 15 alpha-DIOH-dehydroepiandrosterone can be used for synthesizing various steroid hormone medicaments, such as drospirenone which is a fourth-generation contraceptive, has the effects of anti-mineralocorticoid and anti-androgen, and has huge market share.

Fungal steroid hydroxylases which have been identified as participating in the hydroxylation of steroids are endoplasmic reticulum-localized P450 enzymes which require electron transfer by Cytochrome P450 Reductase (CPR).

In the prior art, the function of P450 from fungi is difficult to determine and heterologous expression is realized, and a P450 enzyme gene from fungi which can catalyze progesterone to generate 12 beta hydroxyprogesterone, 15 alpha hydroxyprogesterone and 12 beta, 15 alpha-dihydroxyprogesterone is not reported yet, so that research and development and production of steroid medicines such as deoxycholic acid, estradiol and the like are hindered.

Disclosure of Invention

The invention aims to overcome the technical defects, provides a gene sequence for coding P450 enzyme and cytochrome P450 reductase derived from Fusarium graminearum (Fusarium graminearum) and a recombinant strain thereof, and solves the technical problems that in the prior art, the function of P450 derived from fungi is difficult to determine, heterologous expression is difficult to realize, and progesterone is catalyzed to generate 12 beta hydroxy progesterone, 15 alpha hydroxy progesterone and 12 beta, 15 alpha-dihydroxy progesterone.

In order to achieve the above technical objects, the present invention provides a gene sequence encoding a P450 enzyme derived from Fusarium graminearum (Fusarium graminearum), having a nucleotide sequence represented by positions 1 to 1542 in SEQ ID No. 1.

The protein encoded by the gene sequence encoding a P450 enzyme derived from Fusarium graminearum described above has the amino acid sequence shown in SEQ ID NO.3.

Expression plasmid 1 containing the gene encoding a P450 enzyme derived from Fusarium graminearum, which contains the nucleotide sequence of SEQ ID No. 1.

A gene sequence of cytochrome P450 reductase derived from fusarium graminearum has a nucleotide sequence shown in 1-2079 positions in SEQ ID NO. 2.

The protein encoded by the gene sequence encoding cytochrome P450 reductase derived from Fusarium graminearum described above has the amino acid sequence shown in SEQ ID NO. 4.

The expression plasmid 2 of the gene for coding the cytochrome P450 reductase derived from the fusarium graminearum contains a nucleotide sequence shown in SEQ ID NO. 4.

A recombinant strain based on the gene for a fungal P450 enzyme of fusarium graminearum as described above, said recombinant strain comprising expression plasmid 1 or comprising on its genome the nucleotide sequence contained in SEQ ID No.1, or comprising expression plasmid 2 or comprising on its genome the nucleotide sequence contained in SEQ ID No. 2. The recombinant strain can convert progesterone to produce 12 beta hydroxyprogesterone, 15 alpha hydroxyprogesterone and 12 beta, 15 alpha-dihydroxyprogesterone.

The invention obtains cDNA by reverse transcription PCR of total RNA of Fusarium graminearum, uses cDNA sequence as a template to amplify target coding genes SEQ ID NO.1 and SEQ ID NO.2, uses pYES2 or pPICZ as the genes to construct recombinant expression plasmids pYES2-CYP68J5_ fg and pPICZ-68J 5_ fg-fgCPR, respectively uses saccharomyces cerevisiae INVSC1 and pichia pastoris GS115 as expression hosts, and realizes the heterologous expression of CYP68J5_ Fusarium graminearum in saccharomyces cerevisiae and pichia pastoris.

The deduced amino acid sequence of the complete target gene CYP68J5_ Fusarium graminearum is SEQ ID NO.3.

The amino acid sequence of the complete target gene deduced fgCPR is SEQ ID NO 4

The cloning and expression method of P450 oxidase gene CYP68J5_ Fusarium graminearum and cytochrome P450 reductase fgCPR of Fusarium graminearum strain:

(1) Extraction of Fusarium graminearum total RNA

The Fusarium graminearum strain was first cultured in seed medium at 28 ℃ for 48 hours, then transferred to fermentation medium at 1% inoculum size and cultured at 28 ℃ for an additional 36 hours. The cells were collected by centrifugation and washed 2 times with sterile water. Putting wet hypha in a mortar, adding liquid nitrogen quick-frozen hypha, grinding the bacterin into powder in the mortar, and extracting the total RNA of the fusarium graminearum. And (3) rapidly carrying out 0.8% agarose gel electrophoresis on the extracted RNA to detect whether the RNA is successfully extracted.

(2) Obtaining cDNA sequence by reverse transcription reaction

And (3) taking the total RNA of the fusarium graminearum as a template to synthesize cDNA, wherein the whole operation flow is carried out according to the instruction.

(3) Cloning of P450 oxidase from Fusarium graminearum strain

Obtaining nucleotide sequences of P450 enzyme and cytochrome P450 reductase in Fusarium graminearum through transcriptome sequencing, and designing a primer to amplify a target gene according to the obtained information, wherein the primer sequence is as follows:

p450 enzyme and pYES2 plasmid connected upstream primer P1:

downstream primer P2 for connecting P450 enzyme and pYES2 plasmid:

the bold part is shown as a homologous fragment to the pYES2 plasmid.

Upstream primer P3 for connecting P450 enzyme and pPICZ plasmid:

downstream primer P4 for connecting P450 enzyme and pPICZ plasmid:

the bold part is indicated as a homologous fragment to the pPICZ plasmid.

Cytochrome P450 reductase and pPICZ plasmid connected upstream primer P5:

cytochrome P450 reductase and pPICZ plasmid connected downstream primer P6:

the bold part is indicated as a homologous fragment to the pPICZ plasmid.

PCR System (50. Mu.L): using the reverse-transcribed cDNA as a template, 25. Mu.L of Prime STAR Max DNA polymerase (1. Mu.L each) was added to a pair of primers, and 50. Mu.L of the primers was filled with sterile distilled water.

The PCR product was subjected to 1.2% agarose gel electrophoresis and then recovered by cutting the gel.

(4) Construction of pYES2-CYP68J5_ fg plasmid and transformation of Saccharomyces cerevisiae

Coli DH 5. Alpha. Was transformed by ligation with pYES2 using T5 EXO exonuclease, spread evenly on LB agar plates containing 100mg/L ampicillin, cultured overnight at 37 ℃ and then positive transformants were selected on the plates, and single colonies were picked up to 3mL of LB liquid medium containing 100mg/L ampicillin, cultured and then sequenced. Sequencing results were aligned with the P450 monooxygenase sequences obtained from transcriptome sequencing using SnapGene software. A plasmid was extracted from the correctly sequenced strain and designated pYES2-CYP68J5_ fg.

(5) Screening and induced expression of saccharomyces cerevisiae recombinant bacteria

The expression plasmid pYES2 adopted by the invention is a shuttle vector which can be replicated and amplified in escherichia coli and saccharomyces cerevisiae. The constructed plasmid pYES2-CYP68J5_ fg was transformed into Saccharomyces cerevisiae INVSC1 competent cells by lithium acetate transformation, and positive transformants were selected on uracil (URA 3) auxotrophic plates (SC-Ura). Single clones were picked and inoculated into 3mL of SC-Ura (2% glucose as carbon source) liquid medium and cultured at 30 ℃ for 24 hours before PCR verification of Saccharomyces cerevisiae colonies. The primer pairs used for PCR were the above P1 and P2:

PCR System (25. Mu.L): mu.L of monoclonal bacterial solution (boiled at high temperature) was used as a template, 0.5. Mu.L (10. Mu.M) of each primer pair, 12.5. Mu.L of 2 XT 5 Super PCR Mix polymerase was added, and 25. Mu.L of sterile distilled water was added.

The PCR product was subjected to 0.8% agarose gel electrophoresis to confirm that the expression plasmid pYES2-CYP68J5_ fg was successfully transferred into Saccharomyces cerevisiae INVSC 1. The correctly verified strain INVSC1-pYES2-CYP68J5_ fg is inoculated to an SC-U (glucose as a carbon source) liquid culture medium according to the inoculation amount of 1 percent, after the SC-U (glucose as a carbon source) liquid culture medium is cultured for 36 hours at 30 ℃, thalli are collected, and then the SC-U (galactose as a carbon source) liquid culture medium is added for inducing and expressing P450 enzyme CYP68J5_ fg.

(6) Analysis of recombinant saccharomyces cerevisiae transformed steroid substrate

When the recombinant strain was changed to SC-U medium containing galactose as a carbon source, progesterone dissolved in N, N-Dimethylformamide (DMF) at a final concentration of 1mM was added for transformation, and after 24 to 72 hours of transformation, a sample was taken for HPLC analysis. Progesterone belongs to female hormone, is an important precursor of corticoids such as hydrocortisone, cortisone, dexamethasone, prednisone and the like, and has higher economic value.

(7) Construction of pPICZ-CYP68J5_ fg-fgCPR plasmid and transformation of Pichia pastoris

CYP68J5_ fg and fgCPR are respectively connected with pPICZ by T5 EXO exonuclease to transform Escherichia coli DH5 alpha, and are evenly coated on a half-salt LB agar plate containing 25mg/L bleomycin, after overnight culture at 37 ℃, positive transformants are screened on the plate, and a single clone is picked to 3mL half-salt LB liquid culture medium containing 25mg/L bleomycin for culture, and then sequencing is carried out. Sequencing results were aligned with the P450 monooxygenase and cytochrome P450 reductase sequences obtained from transcriptome sequencing using SnapGene software. Plasmids are extracted from strains with correct sequencing, and the plasmids are named as pPICZ-CYP68J5_ fg and pPICZ-fgCPR respectively.

At this time, the expression cassette containing P450 enzyme on pPICZ-CYP68J5_ fg plasmid was amplified and ligated with pPICZ-fgCPR plasmid using T5 EXO, and then DH 5. Alpha. Was transformed in the same manner to spread a half-salt LB agar plate containing 25mg/L of bleomycin, after overnight culture at 37 ℃ positive transformants were selected on the plate, and a single clone was picked up to 3mL of half-salt LB liquid medium containing 25mg/L of bleomycin, followed by culture and sequencing. The correctly sequenced plasmid was designated pPICZ-CYP68J5_ fg-fgCPR.

(8) Screening and induced expression of recombinant pichia pastoris

The expression plasmid pPICZ adopted by the invention is a Pichia pastoris integrated vector, and is required to be linearized, transferred into Pichia pastoris and integrated into a specific locus on a genome. The constructed plasmid pPICZ-CYP68J5_ f-fgCPR is linearized by SalI restriction enzyme, and the system is as follows:

25 μ L of the digestion system, 2.5 μ L of 10 XBuffer, 0.5 μ L of SalI endonuclease, 1 μ g of plasmid pPICZ-CYP68J5_ f-fgCPR, supplemented with water, and digested overnight at 37 ℃.

The enzyme digestion product is transferred into pichia pastoris GS115 competent cells by an electrotransformation method, and positive transformants are screened on a bleomycin YPD plate containing 100 mg/L. Single clones were picked and inoculated into 3mL YPD liquid medium for 24 hours at 30 ℃ for PCR confirmation of Pichia pastoris colonies. The primer pairs used for PCR were the above P3 and P6:

The PCR product was detected by 0.8% agarose gel electrophoresis to confirm that the expression cassette for CYP68J5_ f-fgCPR was successfully integrated into the genome of Pichia pastoris GS 115. Transferring the correctly verified strain GS115-CYP68J5_ f-fgCPR to BMGY liquid culture medium according to the inoculation amount of 1 percent, culturing for 48 hours at 30 ℃, collecting thalli, adding BMMY liquid culture medium for inducing and expressing P450 enzyme CYP68J5_ fg, supplementing 1 percent methanol every 24 hours, and continuously inducing for multiple days.

(9) Analysis of steroid substrate converted from recombinant pichia pastoris

When the recombinant strain was changed to BMMY medium, progesterone at a final concentration of 1mM dissolved in N, N-Dimethylformamide (DMF) was added for transformation, and samples were taken for HPLC analysis 24-72 hours after transformation.

The invention provides a gene sequence for coding P450 enzyme from fusarium graminearum, provides a plasmid containing the gene and a host cell containing an expression plasmid of the gene, and can convert progesterone (progresterone) to generate 12 beta-Hydroxyprogesterone (12 beta-Hydroxyprogesterone), 15 alpha-Hydroxyprogesterone (15 alpha-Hydroxyprogesterone) and 12 beta, 15 alpha-Dihydroxyprogesterone (12 beta, 15 alpha-Dihydroxyprogesterone) after the host cell expresses the P450 enzyme. Submitting the amino acid sequence of P450 to the International nomenclature Committee for cytochrome P450 (http://drnelson.uthsc.edu/CytochromeP450.html) And then named CYP68J5_ Fusarium graminearum (abbreviated as CYP68J5_ fg). The sequence has 68% homology with CYP68J3 Fusarium oxysporum. The gene is obtained by researching the hydroxylation of 12-site and 15-site of steroid and fusarium graminearumThe excavation of P450 in the bacteria lays a theoretical foundation.

Compared with the prior art, the invention has the beneficial effects that the total length of the gene sequence of the P450 enzyme which is used for coding Fusarium graminearum (Fusarium graminearum) source is 1542bp, 513 amino acids are coded, the total length of the gene sequence of the cytochrome P450 reductase is 2079bp, and 692 amino acids are coded. pYES2 and pPICZ are respectively used as expression plasmids, and Saccharomyces cerevisiae INVSC1 and Pichia pastoris GS115 are used as expression hosts, so that the heterologous expression of CYP68J5_ Fusarium graminearum is realized, and the recombinant strains INVSC1-CYP68J5_ fg, GS115-CYP68J5_ fg-fgCPR can be subjected to hydroxylation at the C12 site and the C15 site of progesterone (progesterone) to respectively obtain 12 beta-Hydroxyprogesterone (12 beta-Hydroxyprogesterone), 15 alpha-Hydroxyprogesterone (15 alpha-Hydroxyprogesterone) and 12 beta, 15 alpha-Dihydroxyprogesterone (12 beta, 15 alpha-Dihydroxyprogesterone).

Drawings

FIG. 1 is a schematic diagram of the 12 β,15 α hydroxylation of progesterone by the P450 enzyme encoded by the gene CYP68J5_ fg provided in accordance with an embodiment of the present invention;

FIG. 2 is a schematic diagram of the construction of a recombinant plasmid pYES2-CYP68J5_ fg provided in the embodiment of the present invention;

FIG. 3 is a schematic diagram of the construction of a recombinant plasmid pPICZ-CYP68J5_ fg-fgCPR provided in the embodiment of the present invention;

FIG. 4 is a HPLC analysis chart of a 12 β hydroxyprogesterone standard sample;

FIG. 5 is a HPLC analysis chart of a 15 α hydroxyprogesterone standard sample;

FIG. 6 is a HPLC analysis chart of a 12 β,15 α -dihydroxyprogesterone standard sample;

FIG. 7 is a HPLC analysis chart of the recombinant strain INVSC1-CYP68J5_ fg provided in example 1 in the embodiment provided by the present invention for converting the substrate progesterone;

FIG. 8 is a HPLC analysis chart of the substrate progesterone converted by the INVSC1-pYES2 strain in the comparative example in the embodiment of the present invention;

FIG. 9 is a HPLC analysis chart of the recombinant strain GS115-CYP68J5_ fg-fgCPR conversion substrate progesterone provided in example 2 in the embodiment provided by the present invention;

FIG. 10 is a HPLC analysis chart of the GS115 strain conversion substrate progesterone.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

The invention obtains cDNA by reverse transcription PCR of total RNA of Fusarium graminearum, uses cDNA sequence as a template to amplify target coding genes SEQ ID NO 1 and SEQ ID NO 2, uses pYES2 or pPICZ as the genes to construct recombinant expression plasmids pYES2-CYP68J5_ fg and pPICZ-68 CYP J5_ fg-fgCPR, respectively uses Saccharomyces cerevisiae INVSC1 and Pichia pastoris GS115 as expression hosts, and realizes the heterologous expression of CYP68J5_ Fusarium graminearum in Saccharomyces cerevisiae and Pichia pastoris.

(1) Extraction of Fusarium graminearum total RNA

(2) Reverse transcription reaction to obtain cDNA sequence

(3) Cloning of P450 oxidase of Fusarium graminearum strain, obtaining nucleotide sequences of P450 enzyme and cytochrome P450 reductase in Fusarium graminearum by transcriptome sequencing, and designing a primer to amplify a target gene according to the obtained information, wherein the primer sequence is as follows:

p450 enzyme and pYES2 plasmid connected upstream primer P1:

5’-GAATTCTGCAGATATCCAATGTTAACCAAGCTGGATACT ATTCTGG-3’

the downstream primer P2 for connecting the P450 enzyme and pYES2 plasmid:

5’-CTCTAGATGCATGCTCGACTAGGATTCCACAGAATCAAT ATCC-3’

the bold part is shown as a homologous fragment to the pYES2 plasmid.

The upstream primer P3 of the connection of the P450 enzyme and the pPICZ plasmid is as follows:

ACAACTAATTATTCGAAACGATGTTGACTAAGTTGGATACA ATCTTGG

downstream primer P4 of the connection of P450 enzyme and pPICZ plasmid:

GCATTCTGACATCCTCTTGATTAAGATTCAACAGAATCAAT ATCCAATTC

the bold part is indicated as a homologous fragment to the pPICZ plasmid.

Cytochrome P450 reductase and pPICZ plasmid connected upstream primer P5:

AACTAATTATTCGAAACGATGGCTGAATTGGATACTTTGGA TGTTATTG

cytochrome P450 reductase and pPICZ plasmid connected downstream primer P6:

ATTCTGACATCCTCTTGATTAAGACCAAACATCTTCTTGAT ATTG

the bold part is indicated as a homologous fragment to the pPICZ plasmid.

PCR System (50. Mu.L): using the reverse-transcribed cDNA as a template, 1. Mu.L (10. Mu.M) of each of a pair of primers, 25. Mu.L of Prime STAR Max DNA polymerase was added to make up 50. Mu.L.

Example 1

The technical scheme of the invention provides a gene sequence of P450 enzyme derived from Fusarium graminearum, which has a nucleotide sequence shown in 1-1542 position in SEQ ID NO. 1.

The protein encoded by the gene sequence encoding a P450 enzyme derived from Fusarium graminearum as described above has the amino acid sequence shown in SEQ ID NO.3.

A recombinant strain based on the gene for the fungal P450 enzyme of fusarium graminearum as described hereinbefore, said recombinant strain containing the expression plasmid 1, said recombinant strain being capable of transforming progesterone to 12 β hydroxyprogesterone, 15 α hydroxyprogesterone and 12 β,15 α -dihydroxyprogesterone.

Preparing a recombinant strain;

(1) Construction of pYES2-CYP68J5_ fg plasmid and transformation of Saccharomyces cerevisiae

After ligation with pYES2 using T5 EXO exonuclease, E.coli DH 5. Alpha. Was transformed and spread evenly on LB agar plates containing 100mg/L ampicillin, after overnight culture at 37 ℃ positive transformants were selected on the plates, and single clones were picked up to 3mL LB liquid medium containing 100mg/L ampicillin for culture and then sequenced. Sequencing results were aligned with the P450 monooxygenase sequences obtained from transcriptome sequencing using SnapGene software. A plasmid was extracted from the correctly sequenced strain and designated pYES2-CYP68J5_ fg.

(2) Screening and induced expression of saccharomyces cerevisiae recombinant bacteria

The expression plasmid pYES2 adopted by the invention is a shuttle vector which can be replicated and amplified in escherichia coli and saccharomyces cerevisiae. The constructed plasmid pYES2-CYP68J5_ fg is transferred into Saccharomyces cerevisiae INVSC1 competent cells by a lithium acetate conversion method, and positive transformants are screened on uracil (URA 3) auxotrophic plates (SC-Ura). Single clones were picked and inoculated into 3mL of SC-Ura (2% glucose as carbon source) liquid medium and cultured at 30 ℃ for 24 hours before PCR verification of Saccharomyces cerevisiae colonies. The primer pairs used for PCR were the above P1 and P2:

(3) Analysis of recombinant saccharomyces cerevisiae transformed steroid substrate

When the recombinant strain is replaced by SC-U culture medium using galactose as carbon source, progesterone with the final concentration of 1mM dissolved in N, N-Dimethylformamide (DMF) is added for transformation, after 24-72 hours of transformation, samples are taken and subjected to HPLC analysis, and the test results of substrate transformation of the obtained INVSC1-pYES2-CYP68J5_ fg strain are shown in figure 7, wherein peaks of 3.8min,6.8min and 8.2min are respectively 12 beta, 15 alpha-dihydroxyprogesterone, 15 alpha-hydroxyprogesterone and 12 beta-hydroxyprogesterone, and a peak of 13min is progesterone.

FIG. 1 is a schematic diagram showing the 12 β,15 α hydroxylation reaction of progesterone by P450 enzyme encoded by CYP68J5_ fg gene in this example, and FIG. 2 is a schematic diagram showing the construction of recombinant plasmid pYES2-CYP68J5_ fg in this example; FIG. 4 is a HPLC analysis chart of a 12 β hydroxyprogesterone standard sample; FIG. 5 is a HPLC analysis chart of a 15 α hydroxyprogesterone standard sample; FIG. 6 is a HPLC analysis chart of 12 β,15 α -dihydroxyprogesterone standard sample, comparing with FIG. 7, it can be seen that progesterone conversion can be achieved after gene expression of the recombinant strain in this example.

Progesterone belongs to female hormone, is an important precursor of corticoids such as hydrocortisone, cortisone, dexamethasone, prednisone and the like, and has higher economic value.

Example 2

The technical scheme of the invention provides a gene sequence for coding cytochrome P450 reductase derived from fusarium graminearum, which has a nucleotide sequence shown in 1 st to 2079 th sites in SEQ ID NO. 2.

A recombinant strain based on the gene for a fungal P450 enzyme of fusarium graminearum as described hereinbefore, said recombinant strain containing an expression plasmid 2, said recombinant strain being capable of transforming progesterone to 12 β hydroxyprogesterone, 15 α hydroxyprogesterone and 12 β,15 α -dihydroxyprogesterone. FIG. 3 is a schematic diagram of the construction of the recombinant plasmid pPICZ-CYP68J5_ fg-fgCPR in this example;

preparing a recombinant strain;

(1) Construction of pPICZ-CYP68J5_ fg-fgCPR plasmid and transformation of Pichia pastoris

CYP68J5_ fg and fgCPR are respectively connected with pPICZ by T5 EXO exonuclease to transform Escherichia coli DH5 alpha, and are evenly coated on a half-salt LB agar plate containing 25mg/L bleomycin, after overnight culture at 37 ℃, positive transformants are screened on the plate, and a single clone is picked to 3mL half-salt LB liquid culture medium containing 25mg/L bleomycin for culture, and then sequencing is carried out. The sequencing results were aligned with the P450 monooxygenase and cytochrome P450 reductase sequences obtained from the transcriptome sequencing using SnapGene software. Plasmids are extracted from strains with correct sequencing, and the plasmids are named as pPICZ-CYP68J5_ fg and pPICZ-fgCPR respectively.

At this time, the expression cassette containing P450 enzyme on pPICZ-CYP68J5_ fg plasmid is amplified and linked with pPICZ-fgCPR plasmid by T5 EXO, DH5 alpha is transformed similarly, half-salt LB agar plate containing 25mg/L bleomycin is coated, after overnight culture at 37 ℃, positive transformants are screened on the plate, and single clone is picked to 3mL half-salt LB liquid culture medium containing 25mg/L bleomycin for culture, and then sequencing is carried out. The correctly sequenced plasmid was designated pPICZ-CYP68J5_ fg-fgCPR.

(2) Screening and induced expression of pichia pastoris recombinant bacteria

25 μ L of the digestion system, 2.5 μ L of 10 XBuffer, 0.5 μ L of SalI endonuclease, 1 μ g of plasmid pPICZ-CYP68J5_ f-fgCPR, supplemented with water, and digested overnight at 37 ℃. The enzyme digestion product is transferred into pichia pastoris GS115 competent cells by an electrotransformation method, and positive transformants are screened on a bleomycin YPD plate containing 100 mg/L. Single clones were picked and inoculated in 3mL YPD liquid medium for 24 hours at 30 ℃ for PCR confirmation of Pichia pastoris colonies. The primer pairs used for PCR were the above-mentioned P3 and P6:

The PCR product was subjected to 0.8% agarose gel electrophoresis to confirm that the expression cassette for CYP68J5_ f-fgCPR was successfully integrated into the genome of Pichia pastoris GS 115. Transferring the correctly verified strain GS115-CYP68J5_ f-fgCPR to BMGY liquid culture medium according to the inoculation amount of 1 percent, culturing for 48 hours at 30 ℃, collecting thalli, adding BMMY liquid culture medium for inducing and expressing P450 enzyme CYP68J5_ fg, supplementing 1 percent methanol every 24 hours, and continuously inducing for multiple days.

(3) Analysis of steroid substrate converted from recombinant pichia pastoris

When the recombinant strain was changed to BMMY medium, progesterone was added to a final concentration of 1mM dissolved in N, N-Dimethylformamide (DMF) for transformation, and samples were taken for HPLC analysis 24-72 hours after transformation.

FIG. 9 is an HPLC analysis chart of the recombinant strain GS115-CYP68J5_ fg-fgCPR conversion substrate progesterone provided in this example; FIG. 10 is a HPLC analysis chart of the GS115 strain conversion substrate progesterone. As shown in FIG. 9, the peak values of 3.8min,6.8min and 8.2min are 12 beta, 15 alpha-dihydroxyprogesterone, 15 alpha-hydroxyprogesterone and 12 beta-hydroxyprogesterone, respectively, and the peak value of 13min is progesterone.

Comparative example

The comparative example is the same as example 1, except that the expression plasmid in the comparative example does not contain CYP68J5_ fg gene, the obtained recombinant strain is INVSC1-pYES2 strain, the analysis of the recombinant bacterium for transforming steroid substrates is also carried out, and the result chart of FIG. 8 is obtained

The above-described embodiments of the present invention should not be construed as limiting the scope of the present invention. Any other corresponding changes and modifications made according to the technical idea of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. A gene sequence encoding a P450 enzyme derived from Fusarium graminearum, which has the nucleotide sequence shown in positions 1-1542 of SEQ ID NO. 1.

2. The protein encoded by the gene sequence encoding a P450 enzyme derived from Fusarium graminearum according to claim 1, which has the amino acid sequence shown in SEQ ID No.3.

3. The expression plasmid of claim 1, which contains the nucleotide sequence of claim 1, wherein the expression plasmid encodes a P450 enzyme derived from Fusarium graminearum.

4. A gene sequence for coding cytochrome P450 reductase derived from fusarium graminearum is characterized by having a nucleotide sequence shown in 1 st to 2079 th positions in SEQ ID No. 2.

5. The protein encoded by the gene sequence encoding a cytochrome P450 reductase derived from fusarium graminearum as claimed in claim 4, which has the amino acid sequence shown in SEQ ID No. 4.

6. The expression plasmid for a gene encoding a cytochrome P450 reductase derived from fusarium graminearum as claimed in claim 4, comprising the nucleotide sequence as claimed in claim 4.

7. A recombinant strain of the fungal P450 enzyme gene of Fusarium graminearum comprising the expression plasmid of claim 3, or comprising the nucleotide sequence contained in claim 1 on the genome, or comprising the expression plasmid of claim 6, or comprising the nucleotide sequence contained in claim 4 on the genome.

8. The recombinant strain of claim 7, wherein the recombinant strain is capable of converting progesterone to 12 β hydroxyprogesterone, 15 α hydroxyprogesterone, and 12 β,15 α -dihydroxyprogesterone.