CN117025709A - Application of cytochrome P450 enzyme and cytochrome P450 reductase combined in synthesis of ursodeoxycholic acid - Google Patents

Application of cytochrome P450 enzyme and cytochrome P450 reductase combined in synthesis of ursodeoxycholic acid Download PDF

Info

Publication number
CN117025709A
CN117025709A CN202310948045.0A CN202310948045A CN117025709A CN 117025709 A CN117025709 A CN 117025709A CN 202310948045 A CN202310948045 A CN 202310948045A CN 117025709 A CN117025709 A CN 117025709A
Authority
CN
China
Prior art keywords
cytochrome
enzyme
reductase
seq
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310948045.0A
Other languages
Chinese (zh)
Inventor
张雷
周珍如
李杉
钟义华
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
South China University of Technology SCUT
Original Assignee
South China University of Technology SCUT
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by South China University of Technology SCUT filed Critical South China University of Technology SCUT
Priority to CN202310948045.0A priority Critical patent/CN117025709A/en
Publication of CN117025709A publication Critical patent/CN117025709A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P33/00—Preparation of steroids
    • C12P33/02—Dehydrogenating; Dehydroxylating
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0036—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on NADH or NADPH (1.6)
    • C12N9/0038—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on NADH or NADPH (1.6) with a heme protein as acceptor (1.6.2)
    • C12N9/0042—NADPH-cytochrome P450 reductase (1.6.2.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C12N9/0077—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14) with a reduced iron-sulfur protein as one donor (1.14.15)
    • C12N9/0081—Cholesterol monooxygenase (cytochrome P 450scc)(1.14.15.6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y106/00—Oxidoreductases acting on NADH or NADPH (1.6)
    • C12Y106/02—Oxidoreductases acting on NADH or NADPH (1.6) with a heme protein as acceptor (1.6.2)
    • C12Y106/02004—NADPH-hemoprotein reductase (1.6.2.4), i.e. NADP-cytochrome P450-reductase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/102—Plasmid DNA for yeast
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C12R2001/84—Pichia

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Mycology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses an application of a cytochrome P450 enzyme and a cytochrome P450 reductase in synthesizing ursodeoxycholic acid, which takes lithocholic acid as a substrate, and uses the cytochrome P450 enzyme and the cytochrome P450 reductase which are co-expressed by host cells to catalyze the substrate to carry out 7 beta-hydroxylation so as to obtain the ursodeoxycholic acid, wherein the cytochrome P450 enzyme and the cytochrome P450 reductase are both derived from Fusarium equisetum (Fusarium equiseti) HG18. The method has mild reaction conditions, simple operation and environmental protection, and the conversion rate reaches 10.2 percent.

Description

Application of cytochrome P450 enzyme and cytochrome P450 reductase combined in synthesis of ursodeoxycholic acid
Technical Field
The invention belongs to the technical field of bioengineering, and particularly relates to cytochrome P450 enzyme and P450 reductase from Fusarium equisetum HG18 and application thereof in biosynthesis of ursodeoxycholic acid from hydroxy cholic acid.
Background
Ursodeoxycholic acid (Ursodeoxycholic Acid; UDCA), also known as 3α,7β -dihydroxy-5β cholestan-24-acid, has a molecular formula of C 24 H 40 O 4 Molecular weight 392.58, CAS number 128-13-2. Ursodeoxycholic acid is white powder, bitter in taste, odorless, and soluble in ethanol, sodium hydroxide and glacial acetic acid, and insoluble in chloroform.
Ursodeoxycholic acid is a hydrophilic bile acid with various biological activities, has important clinical effects on treating liver and gall diseases, is used for treating cholecystitis and gall stones, promoting liver transplantation, bile reflux gastritis, alcoholic liver disease, biliary cirrhosis, drug-induced hepatitis and other diseases, and has small side effects and better tolerance compared with chenodeoxycholic acid (CDCA) and other preparations; it also has remarkable therapeutic effects in cancer treatment and progressive nervous system diseases. The preparation method of ursodeoxycholic acid mainly comprises chemical synthesis method and biological synthesis method. The chemical synthesis method generally adopts Cholic Acid (CA), hyodeoxycholic acid (HDCA) and chenodeoxycholic acid (CDCA) as raw materials to complete the preparation of ursodeoxycholic acid through seven steps of synthesis by a redox method or from non-cholic acid steroid, and the two ways have the defects of complex reaction process, low reaction yield and high production cost, and are difficult to realize industrial production. Compared with chemical synthesis, biosynthesis is more green, efficient and safe, and UDCA biosynthesis using bile acid substrates is evolving. Biosynthesis of UDCA is mainly free enzyme catalyzed synthesis or whole cell synthesis. The free enzyme catalytic synthesis takes CDCA or CA as a substrate, and the UDCA is synthesized through a multi-enzyme cascade reaction; whole cell synthesis involves the addition of CDCA or lithocholic acid (LCA) substrates during microbial culture, which are converted to UDCA by microbial cells. In the research of one-step synthesis of UDCA by using LCA as a substrate, the main focus is on screening functional strains with the function of catalyzing LCA to oxidize and generate the UDCA from actinomycetes and fusarium, but no research has been reported on digging P450 monooxygenase with 7 beta-hydroxylation function from the functional strains.
Cytochrome P450 enzymes (CYPs) are commonly presentIn industrial microorganisms, it is a monooxygenating superfamily containing heme, widely distributed in bacteria, fungi and higher organisms, and has the functions of converting endogenous substances (such as cholesterol, steroid, fat, etc.) and catalyzing exogenous substances (such as medicines and environmental substances). Cytochrome P450 enzymes are capable of catalyzing a variety of reactions including hydroxylation, peroxidation, epoxidation, dehalogenation, deamination, and the like. Often, several tens to hundreds of cytochrome P450 genes are contained in the fungal genome, making the fungus an important source of P450 enzyme catalysts. Since fungal cytochrome P450 enzymes are mostly membrane-bound proteins, their catalytic system requires electron transfer by paired P450 reductase (CPR) to function, such as O in hydroxylation reactions 2 The activation of (a) requires cytochrome P450 enzymes to bind to oxygen molecules in the air, transferring two electrons from NAD (P) H to the heme-iron reaction center of P450. In the prior art, the membrane-binding property of the fungal cytochrome P450 enzyme and CPR makes the fungal cytochrome P450 enzyme and CPR difficult to be expressed in a heterologous way, and the fungal source P450 enzyme gene capable of catalyzing lithocholic acid to generate ursodeoxycholic acid has not been reported yet, thus preventing the research, development and production of ursodeoxycholic acid.
Disclosure of Invention
The present invention aims to overcome the above-mentioned technical drawbacks. The inventor subject group obtains a fusarium equiseti (Fusarium equiseti) HG18 which can directly convert lithocholic acid (LCA) into ursodeoxycholic acid (UDCA) through strain screening in the earlier stage, wherein the fusarium equiseti HG18 is preserved in China center for type culture collection, and the preservation number is as follows: cctccc M2023160.
The cytochrome P450 enzyme and the P450 reductase excavated from the fusarium equiseti (Fusarium equiseti) HG18 have the function of generating ursodeoxycholic acid from 7 beta-hydroxy cholic acid, so that the technical problem that no fungal P450 enzyme for catalyzing LCA to generate UDCA exists in the prior art is solved. The recombinant strain of cytochrome P450 enzyme and P450 reductase provided by the invention can catalyze LCA to generate UDCA through one-step 7 beta-hydroxylation, the conversion rate reaches 10.2%, and the reaction formula is shown in figure 1.
In order to achieve the technical purpose, the invention adopts the following technical scheme:
the application of the combination of the cytochrome P450 enzyme and the cytochrome P450 reductase in the synthesis of ursodeoxycholic acid takes lithocholic acid as a substrate, and uses the cytochrome P450 enzyme and the cytochrome P450 reductase which are co-expressed by host cells to catalyze the substrate to carry out 7 beta-hydroxylation so as to obtain the ursodeoxycholic acid, wherein the cytochrome P450 enzyme and the cytochrome P450 reductase are both derived from Fusarium equisetum (Fusarium equiseti) HG18.
Preferably, the sequence encoding the cytochrome P450 enzyme gene comprises at least one of the following: 1) The nucleotide sequence of SEQ ID NO.1 in the sequence table; 2) Has more than 90 percent of homology with the nucleotide sequence shown in SEQ ID NO. 1.
Preferably, the sequence encoding the cytochrome P450 reductase gene comprises at least one of the following: 1) The nucleotide sequence of SEQ ID NO.2 in the sequence table; 2) Has more than 90 percent of homology with the nucleotide sequence shown in SEQ ID NO. 2.
Preferably, the amino acid sequence of the cytochrome P450 enzyme comprises at least one of the following: 1) The amino acid sequence of SEQ ID NO.3 in the sequence table; 2) Has more than 90 percent of homology with the amino acid sequence shown in SEQ ID NO. 3.
Preferably, the amino acid sequence of the cytochrome P450 reductase comprises at least one of the following: 1) The amino acid sequence of SEQ ID NO.4 in the sequence table; 2) Has more than 90 percent of homology with the amino acid sequence shown in SEQ ID NO. 4.
The application specifically comprises the following steps:
(1) Preparing a recombinant plasmid containing genes encoding cytochrome P450 enzymes and cytochrome P450 reductases;
(2) Transforming the recombinant plasmid into a host cell to prepare a recombinant strain;
(3) And fermenting and producing ursodeoxycholic acid by using the recombinant strain by taking lithocholic acid as a substrate.
Preferably, the host cell is Pichia pastoris (Pichia pastoris).
Compared with the prior art, the invention has the following beneficial effects:
the invention provides a catalyst cytochrome P450 enzyme and P450 reductase of fusarium equiseti HG18 and application thereof in catalyzing the biosynthesis of ursodeoxycholic acid, provides a recombinant plasmid containing the gene and a host cell containing the recombinant strain of the gene, and can convert the lithocholic acid into the ursodeoxycholic acid after expressing the cytochrome P450 enzyme and the P450 reductase by the host cell, and has the advantages of mild reaction condition, simple operation, environmental protection and conversion rate of 10.2 percent. Therefore, the cytochrome P450 enzyme and the P450 reductase have great potential in industrial production of ursodeoxycholic acid synthesized by the biocatalytic cholic acid.
Drawings
FIG. 1 is a schematic diagram showing the reactions of cytochrome P450 enzyme and P450 reductase provided by the invention on the biosynthesis of ursodeoxycholic acid from lithocholic acid.
FIG. 2 is a schematic diagram of construction of recombinant plasmid pPICZ alpha A-A09437-feCPR provided by the invention.
FIG. 3 is a comparison of liquid chromatograms of the conversion of LCA to ursodeoxycholic acid catalyzed by biological enzymes: FIG. 3A is a lithocholic acid standard sample; FIG. 3B is a ursodeoxycholic acid standard sample; FIG. 3C is a graph showing the effect of the recombinant strain pPICZαA-A09437 on the conversion of lithocholic acid as a substrate in example 3; FIG. 3D is a graph showing the effect of recombinant strain pPICZαA-A09437-feCPR on the conversion of lithocholic acid as a substrate in example 3; FIG. 3E is a graph showing the effect of the X33-pPICZ alpha A strain in the comparative example on the conversion of lithocholic acid as a substrate.
Detailed Description
For a full understanding of the objects, aspects and advantages of the present invention, reference should be made to the following detailed description of the invention, taken in conjunction with the accompanying drawings and examples. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not limiting the invention.
The term "a09437" is a cytochrome P450 enzyme provided by the invention and the term "feCPR" is a P450 reductase provided by the invention.
Example 1
Gene cloning of cytochrome P450 enzymes and P450 reductases
The nucleotide sequences of cytochrome P450 enzyme and P450 reductase in Fusarium equisetum (Fusarium equiseti) HG18 were obtained by genome sequencing and transcriptome sequencing in the early stage of the subject group, and the designed primer sequences were as follows:
upstream primer P1 of cytochrome P450 enzyme:
AAGAGAGGCTGAAGCTGAATTCATGTCCACCAAATTGGACACCATC
downstream primer P2 of cytochrome P450 enzyme:
CCTCTTCTGAGATGAGTTTTTGTTCTAGATTAAGATTCAACAGAATCGAT
wherein the bolded part is expressed as a homologous fragment to the pPICZ alpha A plasmid.
Upstream primer P3 of P450 reductase:
AAGAGAGGCTGAAGCTGAATTCATGGCAGAATTGGACACCTTGGAC
downstream primer P4 of P450 reductase:
CCTCTTCTGAGATGAGTTTTTGTTCTATTAAGAGACCAAACATCTTCTTGGTATTG
wherein the bolded part is expressed as a homologous fragment to the pPICZ alpha A plasmid.
PCR amplification was performed using genomic cDNA of Fusarium equisetum (Fusarium equiseti) HG18 as a template. PCR amplification System (50. Mu.L): 80ng of template cDNA, 1.5. Mu.L (10. Mu.M) of each of the upstream and downstream primers, 25. Mu.L of 2 XTaq DNA polymerase mix (containing buffer), and finally adding sterilized distilled water to make up the volume to 50. Mu.L.
The PCR products were detected by 1% agarose gel electrophoresis and then cut to recover the products, and the recovered DNA products were used in subsequent experiments. The obtained cytochrome P450 enzyme full-length gene sequence is subjected to DNA sequencing, the full length is 1542bp, the gene sequence is named A09437, and the gene sequence is shown as SEQ ID NO.1 in a sequence table; the obtained full-length gene sequence of the P450 reductase has the full length of 2079bp and is named feCPR after DNA sequencing, and the gene sequence is shown as SEQ ID NO.2 in a sequence table.
Example 2
Preparation of recombinant plasmids and recombinant strains of cytochrome P450 enzymes and P450 reductase
The cytochrome P450 enzyme, the P450 reductase gene DNA fragment and the pPICZ alpha A vector obtained in example 1 were subjected to double digestion with the endonucleases EcoRI and NotI at 37℃for 2 hours, respectively, and then subjected to nucleic acid electrophoresis (1%) to verify whether the digestion was complete. The completely digested pPICZ alpha A, A09437 and feCPR gene fragments were recovered and ligated with T4 DNA ligase at 37℃for 2h to obtain recombinant expression plasmids pPICZ alpha A-A09437 and pPICZ alpha A-feCPR. And by transforming into colibacillus DH5 alpha, screening positive transformants on a plate containing bleomycin resistance, picking up monoclonal, and performing colony PCR to verify positive clones.
Since cytochrome P450 enzymes require electron transfer with P450 reductases to act together as a catalyst. Thus, this example uses the end-to-end nature of BamH I and BgI II in the pPICZaA vector to create a pPICZαA-A09437-feCPR recombinant plasmid.
First, pPICZ alpha A-feCPR was used to eliminate Sac I site, and the primer sequences were as follows:
upstream primer P5 eliminating Sac I site:
CAGTTATTGGGCTTGATTGGAACTCGCTCATTCCAATTCCTTC
downstream primer P6 eliminating Sac I site:
GAAGGAATTGGAATGAGCGAGTTCCAATCAAGCCCAATAACTG
the recombinant expression plasmid pPICZalpha A-feCPR-deSac I is obtained through elimination reaction and PCR amplification. And by transforming into colibacillus DH5 alpha, screening positive transformants on a plate containing bleomycin resistance, picking up monoclonal, and performing colony PCR to verify positive clones.
pPICZαA-feCPR-deSac I was double digested with BgI II and BamH I, and the product was subjected to 1% agarose gel electrophoresis and gel recovery to give BgI II-feCPR-BamH I.
pPICZaA-A09437 was digested singly with BamHI, dephosphorylated with dephosphorylating enzyme AF, and recovered by product purification using PCR product purification kit.
The BgI II-feCPR-BamH I expression cassette recovered after double digestion with BamH I and BglII was ligated with the BamH I single digested single copy vector pPICZaA-A 09437.
All the above-mentioned ligation products were transformed into E.coli DH 5. Alpha. And positive transformants were selected on plates containing bleomycin resistance, single clones were picked up, positive clones were verified by colony PCR, sequencing was performed, and plasmids were extracted from correctly sequenced strains and designated pPICZ. Alpha. A-a09437-feCPR.
The constructed plasmid pPICZαA-A09437-feCPR is linearized by SacI endonuclease, the linearized product is detected by 1% agarose gel electrophoresis and then is recovered, the linearized product is electrically transferred to pichia X33 competent cells by a lithium acetate transformation method, and positive transformants are screened on YPD plates (containing 100 mug/mL bleomycin). Selecting monoclonal bacteria, adding into 50 mu L of sterilized water, and performing wall breaking treatment by heating-cooling to obtain monoclonal bacteria liquid. Finally, carrying out PCR verification on the pichia pastoris colony to obtain the recombinant strain X33-pPICZ alpha A-A09437-feCPR.
Example 3
Pichia pastoris recombinant bacterium conversion lithocholic acid substrate
After methanol induction of the recombinant strain for 48 hours, the bacterial liquid was taken and centrifuged, the obtained bacterial cells were resuspended in buffer (100 mM phosphate buffer (pH=7.0), 200mM sorbitol), lithocholic acid (dissolved in 1% dimethyl sulfoxide) was added to a final concentration of 1mg/mL for conversion, after 48 hours of conversion, the sample was sampled and extracted with three times of ethyl acetate, and the extract was concentrated by a rotary evaporator and then dissolved in methanol and analyzed by HPLC.
FIG. 3A is an HPLC analysis of a standard sample of lithocholic acid; FIG. 3B is an HPLC analysis chart of ursodeoxycholic acid standard sample; FIG. 3C is a graph showing the effect of the recombinant strain pPICZαA-A09437 on the conversion of lithocholic acid as a substrate in this example; FIG. 3D is an HPLC analysis chart of the recombinant strain X33-A09437-feCPR conversion substrate lithocholic acid provided in this example, as shown in FIG. 3C, with compound peaks of retention times 5.292min and 26.149min corresponding to ursodeoxycholic acid, lithocholic acid, respectively; as shown in fig. 3D, the compound peaks with retention times 5.303min and 26.183min correspond to ursodeoxycholic acid, lithocholic acid, respectively.
Comparative example
The comparative example was identical to example 3, except that the expression plasmids in the comparative example did not contain the A09437 and feCPR genes, and the recombinant strain obtained was the X33-pPICZ alpha A strain, and the analysis of the conversion of the recombinant strain into lithocholic acid was performed in the same manner, to obtain the result diagram of FIG. 3E. FIG. 3E shows that the recombinant strains pPICZαA-A09437 and X33-A09437-feCPR of example 3 can convert lithocholic acid to ursodeoxycholic acid when compared with FIG. 3C and FIG. 3D. As compared with FIG. 3D, it was found that the conversion rate of ursodeoxycholic acid was 1.1% when cytochrome P450 enzyme A09437 was expressed alone, and 10.2% when cytochrome P450 enzyme A09437 and P450 reductase feCPR were co-expressed.
The foregoing details of the specific implementation and the technical solution provided by the embodiments of the present invention are not to be construed as limiting the scope of the present invention. Any changes or substitutions that would be easily recognized by those skilled in the art within the technical scope of the present disclosure are intended to be covered by the present invention.

Claims (7)

1. The application of the combination of the cytochrome P450 enzyme and the cytochrome P450 reductase in the synthesis of ursodeoxycholic acid is characterized in that the ursodeoxycholic acid is obtained by taking the lithocholic acid as a substrate and catalyzing the substrate to perform 7 beta-hydroxylation by utilizing the cytochrome P450 enzyme and the cytochrome P450 reductase which are co-expressed by host cells, wherein the cytochrome P450 enzyme and the cytochrome P450 reductase are both derived from Fusarium equisetum (Fusarium equiseti) HG18.
2. The use according to claim 1, wherein the sequence of the gene encoding the cytochrome P450 enzyme comprises at least one of the following: 1) The nucleotide sequence of SEQ ID NO.1 in the sequence table; 2) Has more than 90 percent of homology with the nucleotide sequence shown in SEQ ID NO. 1.
3. The use according to claim 2, wherein the sequence of the gene encoding cytochrome P450 reductase comprises at least one of the following: 1) The nucleotide sequence of SEQ ID NO.2 in the sequence table; 2) Has more than 90 percent of homology with the nucleotide sequence shown in SEQ ID NO. 2.
4. The use according to claim 1 or 2 or 3, wherein the amino acid sequence of the cytochrome P450 enzyme comprises at least one of the following: 1) The amino acid sequence of SEQ ID NO.3 in the sequence table; 2) Has more than 90 percent of homology with the amino acid sequence shown in SEQ ID NO. 3.
5. The use according to claim 4, wherein the amino acid sequence of the cytochrome P450 reductase comprises at least one of the following: 1) The amino acid sequence of SEQ ID NO.4 in the sequence table; 2) Has more than 90 percent of homology with the amino acid sequence shown in SEQ ID NO. 4.
6. Use according to claim 1 or 2 or 3, characterized in that it comprises the following steps:
(1) Preparing a recombinant plasmid containing genes encoding cytochrome P450 enzymes and cytochrome P450 reductases;
(2) Transforming the recombinant plasmid into a host cell to prepare a recombinant strain;
(3) And fermenting and producing ursodeoxycholic acid by using the recombinant strain by taking lithocholic acid as a substrate.
7. The use according to claim 6, wherein the host cell is Pichia pastoris.
CN202310948045.0A 2023-07-31 2023-07-31 Application of cytochrome P450 enzyme and cytochrome P450 reductase combined in synthesis of ursodeoxycholic acid Pending CN117025709A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310948045.0A CN117025709A (en) 2023-07-31 2023-07-31 Application of cytochrome P450 enzyme and cytochrome P450 reductase combined in synthesis of ursodeoxycholic acid

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310948045.0A CN117025709A (en) 2023-07-31 2023-07-31 Application of cytochrome P450 enzyme and cytochrome P450 reductase combined in synthesis of ursodeoxycholic acid

Publications (1)

Publication Number Publication Date
CN117025709A true CN117025709A (en) 2023-11-10

Family

ID=88601508

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310948045.0A Pending CN117025709A (en) 2023-07-31 2023-07-31 Application of cytochrome P450 enzyme and cytochrome P450 reductase combined in synthesis of ursodeoxycholic acid

Country Status (1)

Country Link
CN (1) CN117025709A (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021176066A1 (en) * 2020-03-06 2021-09-10 Annikki Gmbh Process for hydroxylating steroids
WO2022115710A1 (en) * 2020-11-30 2022-06-02 Sandhill One, Llc Enzymatic methods for converting lca and 3-kca to udca and 3-kudca
CN116410871A (en) * 2023-03-13 2023-07-11 华南理工大学 Fusarium equisetum and method for hydroxylating cholic acid by using same

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021176066A1 (en) * 2020-03-06 2021-09-10 Annikki Gmbh Process for hydroxylating steroids
WO2022115710A1 (en) * 2020-11-30 2022-06-02 Sandhill One, Llc Enzymatic methods for converting lca and 3-kca to udca and 3-kudca
CN116410871A (en) * 2023-03-13 2023-07-11 华南理工大学 Fusarium equisetum and method for hydroxylating cholic acid by using same

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
KHAN, N., GENBANK ACCESSION NO: CAG7558836.1, 6 July 2021 (2021-07-06) *
KHAN, N., GENBANK ACCESSION NO: CAG7565063.1, 6 July 2021 (2021-07-06) *

Similar Documents

Publication Publication Date Title
CN109097343B (en) Steroid 11 beta-hydroxylase in curvularia lunata as well as coding gene and application thereof
JP5627546B2 (en) Method for enantioselective enzymatic reduction of secodione derivatives
CN112457412B (en) Artificial electron transfer system and application thereof in promoting P450 enzyme hydroxylation reaction
CN112094797B (en) Genetically engineered bacterium and application thereof in preparation of 9 alpha, 22-dihydroxy-23, 24-bis-cholesta-4-en-3-one
CN113528606B (en) Method for preparing 17 beta-hydroxysteroid by enzyme catalysis
CN114015712A (en) Preparation method of ursodeoxycholic acid
WO2019010971A1 (en) Preparation method for dehydroepiandrosterone, and enzyme for preparation thereof
CN109306342B (en) 17 beta-hydroxy steroid dehydrogenase, gene and application thereof
CN113388589B (en) Cytochrome P450 monooxygenase CYP109B2 mutant and application thereof
Li et al. Improved 11α-hydroxycanrenone production by modification of cytochrome P450 monooxygenase gene in Aspergillus ochraceus
US20240209410A1 (en) Method for the hydroxylation of steroids
CN115927405A (en) Gene sequence for coding P450 enzyme and cytochrome P450 reductase derived from fusarium graminearum and recombinant strain thereof
CN117025709A (en) Application of cytochrome P450 enzyme and cytochrome P450 reductase combined in synthesis of ursodeoxycholic acid
CN109722442B (en) 7 beta-hydroxy cholic acid dehydrogenase and application thereof
CN108587997B (en) Method for producing 9-OH-AD by utilizing whole cell transformation of recombinant corynebacterium glutamicum
CN118308315B (en) Cytochrome P450 enzyme mutant and application thereof
CN111808830A (en) Method for producing androstadienedione by microbial degradation of phytosterol
CN108796021B (en) Engineering bacterium and application thereof in preparing testosterone
CN113684191A (en) Pear head mould steroid 11 beta-hydroxylase CYP5311B2 mutant construction and application thereof
CN115786292B (en) 3 beta-hydroxy steroid dehydrogenase and application thereof in preparation of dehydroepiandrosterone
CN114540338B (en) Immobilized modified 7 beta-hydroxysteroid dehydrogenase and application thereof
CN116445529A (en) System for co-expression of multiple cytochrome P450 enzymes and application of system in preparation of deoxycortisone and hydrocortisone
CN116790531A (en) P450 enzyme mutant, coding gene and application thereof
CN116218798A (en) P450 enzyme capable of hydroxylating progesterone C11 alpha site and gene, expression vector, cell and application thereof
CN117247924A (en) Ame1-FgTad2-FgTad3 editing enzyme system, editing tool and editing method

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination