CN114717173B

CN114717173B - Genetically engineered strain for producing sterol side chain incomplete degradation product, construction method and application thereof

Info

Publication number: CN114717173B
Application number: CN202210281670.XA
Authority: CN
Inventors: 王风清; 魏东芝; 刘勇军; 宋璐
Original assignee: East China University of Science and Technology
Current assignee: East China University of Science and Technology
Priority date: 2022-03-21
Filing date: 2022-03-21
Publication date: 2023-10-10
Anticipated expiration: 2042-03-21
Also published as: CN114717173A

Abstract

The invention discloses a genetic engineering strain for producing a sterol side chain incomplete degradation product, a construction method and application thereof, wherein the construction method comprises the following steps: the method is characterized in that a gene in a igr operon in a microorganism capable of degrading and converting sterols is subjected to inactivation knockout, and key genes in sterol metabolic pathways are deleted or/and over-expressed, so that a genetically engineered strain is obtained. PDC, PDC-M, delta, and the like can be selectively prepared by using the strains ¹ ‑PDC、△ ¹ PDC-M, 9 alpha-OHPDC-M, and is used for producing steroid medicines such as adrenocortical hormone. The invention can greatly improve the production efficiency and the product quality of the steroid medicine, is beneficial to reducing the energy consumption in the production process of the steroid medicine, simplifying the production steps and improving the utilization rate of the prodrug, thereby reducing the production cost, and has mild overall reaction condition, environmental protection and higher economic value and social value.

Description

Genetically engineered strain for producing sterol side chain incomplete degradation product, construction method and application thereof

Technical Field

The invention relates to the field of biochemical engineering, in particular to a genetic engineering strain for producing a sterol side chain incomplete degradation product, a construction method and application thereof.

Technical Field

Corticosteroids are an important class of steroid compounds widely used in the treatment of inflammation, endocrine disorders, cancer and viral infections, especially in rescue of critically ill patients. For example, low doses of dexamethasone and methylprednisolone have been shown to reduce mortality in patients with severe covd-19 disease and world health organization highly evaluated the initial results of dexamethasone use in the treatment of covd-19 severe patients. The industrial synthesis process of corticosteroids is complex, extremely low in yield due to its complex structure, and is of great interest due to serious environmental pollution problems and high production costs. Pregna-1, 4,9 (11), 16 (17) -tetraene-3, 20-dione (tetraene for short) or its derivative 21-acetoxy-tetraene (tetraene acetate) is an important precursor for the synthesis of many commercial corticosteroids. Currently, there are two semisynthetic routes to tetraene or tetraene acetate (possibly slightly different manufacturers): 1) Based on the semisynthesis route of diosgenin, the key intermediate 16 alpha, 17 alpha-epoxy-progesterone is synthesized from diosgenin, and the product yield is less than 10% after 10-11 steps. 2) The biological transformation route based on the phytosterol takes the phytosterol as a substrate, and is transformed into 9 alpha-hydroxyandrostenedione (9 alpha-OHA) through microorganisms, and the biological transformation route is obtained through 8 steps of chemical reactions, and the yield is about 22.2%. In summary, the second route has significant advantages over the first route in terms of production costs and environmental friendliness, and the recent successful commercial use of phytosterol microorganisms to convert to 9α -OHAD has prompted the industrial deployment of phytosterol-based routes. Nevertheless, the conversion from 9α -OHAD to tetraenes remains a complex, low yield process.

9alpha-hydroxy androstenedione (9 alpha-OHAD), androsta-4-ene-3, 17-dione (AD) and androsta-1, 4-diene-3, 17-dione (ADD) are common 17-ketone products in the mycobacterial sterol catabolic pathways. There is a need in the industry to synthesize corticosteroids by reestablishing a two-carbon pregnane side chain at the C17 position of such steroids. Because of the unique regioselectivity of the C17-keto group, the three-step cyanohydrin process is typically employed to introduce the pregnane side chain into these steroids. However, the stereoselectivity of this process is not satisfactory, since the first step reaction inevitably produces the by-product 17β -cyano intermediate epimer, typically in an effective yield of less than 70%. In fact, in addition to the 17-ketosteroid compounds mentioned above, other useful intermediate metabolites are produced during microbial catabolism of phytosterols and are also valuable for the synthesis of corticosteroids. Among these metabolites, the C-22 metabolite is potential, and it originates from the partial degradation of the C17 alkyl side chain, which propyl side chain may be more convenient for the construction of the pregnane side chain at the C17 position. For example, from 22-hydroxymethylpregn-4-en-3 one (4-HBC) to progesterone, only a two-step reaction is required. However, 4-HBC is not the best precursor for the synthesis of tetraenes, because it is difficult to introduce a double bond between C16 and C17.

After further analysis of the catabolic processes of mycobacteria on phytosterols, we have found that the products of incomplete degradation of the side chains, namely the pregnenadiene-20-carboxylic acid metabolite and its corresponding methyl ester (named PDC metabolite), have structural advantages in their use as precursors for the synthesis of corticosteroids. The three-carbon alkyl side chains and the C17-C20 double bonds which are possessed by the three-carbon alkyl side chains provide great convenience for the side chain synthesis and the modification of the C16-C17 positions which are necessary for the subsequent corticosteroid synthesis. Furthermore, by way of example, we have 9 a-hydroxy-3-oxo-4, 17 (20) -pregnenediene-20-carboxylic acid and its methyl ester, 9a hydroxy is also advantageous for the introduction of double bonds between C9 and C11. To date, only a few cases have been reported for the production of PDC metabolites. Of these, 9-OHPDC and its derivatives 9-OHPDC-M have been demonstrated as metabolites of plant sterols transformed with Mycobacterium mutants, which are obtained mainly by treatment with physicochemical mutagens, spheroplast fusion or transposon mutagenesis. However, these mutants have low product selectivity and production efficiency, and are not currently used on an industrial scale. In recent years, some important mechanisms related to the catabolic pathways and metabolic adaptations of mycobacterial sterols have been well documented. Therefore, we can combine genetic engineering and metabolic engineering to rationally direct metabolic pathways towards the target steroid.

Disclosure of Invention

The invention aims to provide a genetic engineering strain for producing incomplete degradation products of sterols, a construction method and application thereof, thereby solving the problem that the prior art lacks genetic engineering bacteria for producing PDC products.

In order to solve the technical problems, the invention adopts the following technical scheme:

according to a first aspect of the present invention, there is provided a method of constructing a genetically engineered strain for producing a sterol side chain incompletely degraded product, the genetically engineered strain being obtained by metabolizing a microorganism, the method of constructing a genetically engineered strain comprising the steps of: 1) Selecting a microorganism that degrades the converted sterols; 2) For igr operon in microorganism, performing single gene inactivation knockout or combined inactivation knockout on chsE1, chsE2, chsH1, chsH2 and ltp2 in the operon; 3) The key genes cyp125, hsd4A, fadA5, chsE1, chsE2, kshA1, ksdD1 and the like in the sterol metabolic pathway are subjected to non-limiting combination modification, including deletion and/or overexpression; wherein, the genetically engineered strain after metabolic engineering can be used for producing and obtaining pregna-4, 17 (20) -diene-20-carboxylic acid (PDC) and corresponding methyl ester PDC-M and pregna-1,4,17 (20) -triene-20-carboxylic acid ( ¹ -PDC) and its corresponding methyl ester delta ¹ PDC-M, 9α -hydroxy-PDC (9α -OHPDC) and corresponding methyl ester 9 α -OHPDC-M.

According to the invention, the microorganism which can be degraded to convert sterols is a Mycobacteriaceae (Mycobacteriaceae) non-pathogenic microorganism.

The Mycobacteriaceae (Mycobacteriaceae) non-pathogenic microorganisms include Mycobacterium genus (Mycobacterium), mycobacterium genus (Mycobacterium bacterium), mycobacterium genus (Mycobacterium coli), mycobacterium genus (Mycobacterium) and Mycobacterium pseudomycoides genus (Mycobacterium).

Preferably, the microorganism which can be degraded to convert sterols is a strain of microorganism capable of converting phytosterols to produce androsta-4-ene-3, 20-dione (AD), androsta-1, 4-diene-3, 20-dione (ADD) and/or 9 alpha-hydroxy-AD (9 alpha-OHAD).

Step 2) includes single gene inactivation, combined inactivation or combined inactivation of the two or three genes for the chsE1, chsE2, chsH1, chsH2, ltp2 genes in the igr operon, or gene inactivation of the entire igr operon.

Step 2) comprises gene inactivation of chsH2 or/and ltp2.

Step 3) includes non-limiting combinatorial engineering of the key genes cyp125, hsd4A, fadA, chsE1, chsE2, kshA, kstD1 in the sterol metabolic pathway, including gene enhanced expression or gene inactivation.

Step 3) comprises carrying out non-limiting combinatorial enhancement on genes of key genes cyp125, chsE1, chsE2 and hsd4A, fadA5 in sterol metabolic pathways, and carrying out non-limiting enhancement expression or gene inactivation on kshA, kstD1 and the like.

The nucleotide sequences of genes chsE1, chsE2, chsH1, chsH2 and ltp2 are shown in SEQ ID No. 1-5.

The nucleotide sequences of genes chsE1, chsE2, chsH1, chsH2 and ltp2 are orthologous genes with the sequences shown as SEQ ID No. 1-5.

According to a preferred scheme of the invention, the construction method of the genetic engineering strain comprises the following steps: 1): electrically transferring suicide plasmid pQC-H1H2 or pQC-ltp2 or pQC-igr into NwIB-XII or NwIB-I strain competence, coating a double-resistance plate of kanamycin and hygromycin, picking out the grown clone, carrying out PCR amplification screening by using a UF primer of a corresponding upstream homology arm and a DR primer of a downstream homology arm, and selecting a monoclonal with a band size of about 2000bp, namely NwIB-XII delta H1H2, nwIB-XII delta ltp2, nwIB-XII delta igr or NwIB-I delta H1H2, nwIB-I delta ltp2 and NwIB-I delta igr strain; 2): the single gene overexpression plasmids pMV261-cyp125, pMV261-hsd4A, pMV261-fadA5, pMV261-chsE1-E2, pMV261-kshA, pMV261-kstD1 and the combined overexpression plasmids pMV261-hsd4A & kshA1, pMV261-kshA1& chsE1-E2 and pMV261-hsd4A & chsE1-E2 are respectively subjected to electrotransformation and introduced into NwIB-I delta ltp2 to be competent, a kanamycin plate is coated to grow a monoclonal, and PCR amplification verification is carried out by using PMV261-YZ-F & R, if a positive band of about 1500bp is amplified, the strain NwIB-I delta ltp2-Ocyp125 is obtained; if a positive band of about 1500bp is amplified, the positive band is the strain NwIB-XII deltaltp 2-Ohsd4A; if a positive band of about 2000bp is amplified, the positive band is the strain NwIB-XII deltaltp 2-OchsE1-E2; if a positive band of about 2000bp is amplified, the strain NwIB-XII deltaltp 2-oksdD1 is obtained; if a positive band of about 1500bp is amplified, the positive band is a strain NwIB-I delta ltp2-OfadA5; if a positive band of about 2000bp is amplified, the positive band is a strain NwIB-I delta ltp 2-okhA 1; if a positive band of about 3500bp is amplified, the positive band is a strain NwIB-I delta ltp2-Ohsd4A & kshA1; if a positive band of about 3500bp is amplified, the positive band is the strain NwIB-I delta ltp2-okshA1& chsE1-E2; if positive bands of about 4000bp are amplified, the strain NwIB-I deltaltp 2-Ohsd4A & chsE1-E2 is obtained. Similarly, the overexpression plasmid pMV261-kstD1 is electrically transduced into NwIB-XII, and if a positive band of about 2000bp can be amplified, the strain NwIB-XII-okstD1 is obtained.

Construction of suicide plasmid pQC-H1H2 or pQC-ltp2 or pQC-igr comprises the following steps:

a1: using new golden mycobacterium genome as template and using homologous arm primer pQC-H1H2-U-F & R, pQC-H1H2-D-F & R; pQC-ltp2-U-F & R, pQC-ltp2-D-F & R; pQC-igr-U-F & R, pQC-igr-D-F & R respectively amplify the upstream and downstream homology arm sequences of H1H2, ltp2 and igr to obtain upstream and downstream homology arm purified products;

a2: the p2NIL plasmid extract is digested by HindIII and BamHI, the upstream homology arm purified product is digested by HindIII and EcoRI, the downstream homology arm purified product is digested by EcoRI and BamHI, and T4 is connected by enzyme, so as to obtain recombinant plasmids p2NIL-H1H2, p2NIL-ltp2 and p2NIL-igr;

a3: and (3) respectively carrying out enzyme digestion on pGOAL19 plasmid products and p2NIL recombinant plasmids by PacI, connecting by T4 enzyme, transferring into DH5 alpha competence of escherichia coli, carrying out amplification culture, extracting to obtain purified products of suicide plasmids pQC-H1H2, pQC-ltp2 and pQC-igr, carrying out electrotransformation, coating a sucrose lethal plate, and screening a correct double-exchange mutant strain to obtain the knockout strain.

The homology arm primer pQC-H1H2-U-F & R, pQC-H1H2-D-F & R; pQC-ltp2-U-F & R, pQC-ltp2-D-F & R; the nucleotide sequence of pQC-igr-U-F & R and pQC-igr-D-F & R is shown in SEQ ID No. 6-17. Construction of the monogenic overexpression plasmids pMV261-cyp125, pMV261-hsd4A, pMV261-fadA5, pMV261-chsE1-E2, pMV261-kshA and the combined co-expression plasmids pMV261-hsd4A & kshA1, pMV261-kshA1& chsE1-E2, pMV261-hsd4A & chsE1-E2 comprises the following steps:

b1: construction of a single gene overexpression plasmid: taking the construction of hsd4A gene over-expression plasmid as an example:

1) Using new golden mycobacterium genome as template, and using primer 4A-F & R to amplify to obtain hsd4A gene sequence;

2) The gene sequences of pMV261 plasmid products and hsd4A are subjected to enzyme digestion, purification and recovery by HindIII & EcoRI, T4 enzyme connection is performed, and E.coli DH5 alpha competence is transformed to obtain recombinant plasmid pMV261-hsd4A;

b2: construction of the combination overexpression plasmid: the construction of the pMV261-hsd4A & chsE1-E2 combination over-expression plasmid is exemplified by:

1) The genome of new golden mycobacterium is used as a template, and primer 4A1E1E2-F & R is used for amplification to obtain a gene sequence fragment of chsE1-E2;

2) The recombinant plasmid pMV261-hsd4A is subjected to enzyme digestion by HindIII and HpaI, purified and recovered to obtain a plasmid skeleton, and is subjected to T4 connection with a gene sequence fragment of chsE1-E2 to obtain a recombinant plasmid connection product pMV261-hsd4A & chsE1-E2;

3) Converting the connection product pMV261-hsd4A & chsE1-E2 into escherichia coli DH5 alpha, coating a kanamycin resistance flat plate for cloning and screening, and obtaining a recombinant plasmid pMV261-hsd4A & chsE1-E2 through colony PCR, plasmid enzyme digestion and plasmid sequencing verification;

the new Mycobacterium aurum has deposit number ATCC 25795.

The nucleotide sequence of the primer 4A-F & R is shown as SEQ ID No. 18-19. The nucleotide sequence of the primer 4A1E1E2-F & R is shown as SEQ ID No. 20-21.

According to a second aspect of the present invention there is provided a method for producing the sterol side chain incomplete degradation product PDC-M, delta ¹ The genetically engineered strain of PDC-M9 OHPDC-M is constructed by the construction method.

According to a third aspect of the present invention there is also provided a process for the preparation of a sterol side chain incomplete degradation product comprising the steps of: and inoculating the genetic engineering strain constructed by the construction method into a culture medium for culture, thus obtaining the strain.

According to a preferred scheme of the invention, the genetically engineered strain constructed by the construction method is transformed by adding plant sterols in the process of culturing and growing in a fermentation transformation mode, so that PDC, PDC-M and PDC-M can be obtained ¹ -PDC、△ ¹ -any one of the six products PDC-M, 9α -OHPDC-M.

According to a preferred embodiment of the present invention, the genetically engineered strain constructed according to the above construction method can transform plant sterols to obtain PDC, PDC-M, delta by resting cell transformation ¹ -PDC、△ ¹ -any one of the six products PDC-M, 9α -OHPDC-M.

According to a preferred embodiment of the invention, the genetically engineered strain can transform plant sterols to obtain PDC-M and PDC, ¹ PDC-M and delta ¹ -any one of the three combinations PDC, 9α -OHPDC-M and 9α -OHPDC.

The inventors have found through research that, during the transformation of phytosterols by mycobacteria, a conserved operon igr associated with cell growth from the Cho region is critical during the last round of beta oxidation of sterol C17 alkyl side chain degradation. The operon consists of six genes, encoding aldolase (Ltp 2), MAoC-like hydratase (ChsH 1-H2) composed of ChsH1 and ChsH2, acyl-CoA dehydrogenase (ChsE 1-E2) composed of ChsE1 and ChsE2, and one cytochrome P450 Cyp125 (CYP 125), respectively. In addition to Cyp125 being a key enzyme to initiate degradation of the C17 side chain, other enzymes are involved in the last round of β -oxidation of the C17 side chain. Among these enzymes, acyl-CoA dehydrogenase is a functional α2β2 heterotetrameric enzyme formed by ChsE1 and ChsE2, which catalyzes the dehydrogenation of 3-oxo-pregna-4-en-20-carboxy-CoA (PC-CoA) followed by a thiolysis reaction of FadA 5to produce the metabolite 3-oxo-pregna-1,17 (20) -diene-20-carboxy-CoA (PDC-CoA). Subsequently, a MaoC-like hydratase, aFunctional αβ heterodimeric enzymes assembled from ChsH1 and ChsH2 have been shown to catalyze the hydration of PDC-CoA to produce 17-hydroxy-3-oxo-pregna-4-ene-20-carboxylic acid-CoA (17-OHPC-CoA). Finally, aldolase Ltp2 associated with the DUF35 domain in Chush 2 catalyzes the reverse aldol cleavage of 17-OHPC-CoA to form AD. Therefore, based on the function of each gene of the igr operon, we first knocked out the ChosH 1-H2, ltp2 and the entire igr operon in the NwIB-XII strain, and found that the main products were all PDC-M. Comparing the growth status and product accumulation of the knockdown bacteria, we found that the knockout of ltp2 had relatively little effect on strain growth and that product accumulation was relatively high. The knockout of ltp2 gene is the subsequent construction of 9OHPDC-M and delta ¹ The PDC-M engineering bacteria lay a foundation. To accumulate delta ¹ PDC-M, we overexpress 3 ketodelta on the basis of the NwIB-XII deltaltp 2 strain ¹ Dehydrogenase kstD1, constructing delta ¹ PDC-M engineering bacteria NwIB-XII deltaltp 2-OKstD1. To accumulate 9OHPDC-M, we first inactivated all 3 keto delta ¹ Dehydrogenase KstDs and 9alpha hydroxylase KshA are reserved, so that we choose to inactivate ltp2 in NwIB strain to construct 9OHPDC-M engineering bacteria NwIB delta ltp2. In addition, we also found that overexpression of the sterol side chain degradation key genes hsd4A and chsE1-E2 can significantly increase 9OHPDC-M accumulation. Therefore, the invention creatively constructs a series of genetic engineering strains for producing incomplete degradation products of sterol side chains by knocking out the ltp2 gene and carrying out single gene overexpression or combined co-expression on cyp125, hsd4A, fadA5, chsE1, chsE2, kshA1, ksdD1 and the like for the first time.

The construction method provided by the invention relates to a recombinant suicide plasmid pQC-H1H2, pQC-ltp2 and pQC-igr for knocking out ltp2, chsH1-H2 and igr operon genes, which comprises a plasmid skeleton of pGOAL19 and upstream and downstream homology arm sequences of the ltp2, chsH1-H2 and igr genes. The construction of the suicide plasmid and the acquisition of pGOAL19 plasmid backbone are described in detail in the literature (Xiong LB, liu HH, xu LQ, et al im pro-viding the production of-hydroxy-23, 24-bisnorcal-4-ene-3-one from sterols in Mycobacterium neoaurum by increasing Cell permeability and modifying multiple gene. Microbial Cell industries, 2017,16 (1): 89.).

The construction method provided by the invention also relates to a recombinant plasmid pMV261-genes for constructing cyp125, hsd4A, fadA5, chsE1, chsE2, kshA1 and ksdD1 gene overexpression, which mainly comprises a heat shock protein promoter hsp60, a target gene coding region, a kanamycin resistance gene and the like. The manner of acquisition and the method of construction of the recombinant plasmid are also described in detail in the documents mentioned in the previous paragraph.

The invention constructs a series of sterol side chain incomplete degradation products PDC-M, delta by metabolic engineering of new Mycobacterium aurum (Mycobacterium neoaurum) which can produce AD, ADD or 9-OHAD ¹ Engineering bacteria of PDC-M and 9-OHCD-M.

According to the engineering strain for producing a series of incomplete degradation products of sterol side chains, which is provided by the invention, ltp2 is knocked out by the strain, a methyl esterification target product can be obtained, and then PDC-M steroid compounds with different steroid parent nucleus structures are rationally developed according to the chemical structures of the products. For example, by inactivating ltp2 in a strain that accumulates 9-OHOAD, 9 OHOPCD-M can be obtained. Inactivation of ltp2 in strains accumulating AD or ADD, PDC-M, Δs can be accumulated ¹ PDC-M. In addition, we have found that overexpression of Chu E1-E2 and hsd4A can further enhance accumulation of the target product. The engineering strains can greatly improve the production efficiency and the product quality of the steroid medicaments, are beneficial to reducing the energy consumption in the production process of the steroid medicaments, simplifying the production steps and improving the utilization rate of the prodrug, thereby reducing the production cost, and meanwhile, the whole reaction condition is mild, environment-friendly and high in economic and social benefits.

In summary, the invention obtains a series of engineering strains with incomplete degradation products of sterol side chains by knocking out key genes ltp2 and over-expressing side chain degradation pathway genes in mycobacterium which accumulate AD, ADD and 9-OHAD through genetic engineering and metabolic engineering technologies; the strains can be used for selectively preparing important steroid medicines of adrenocortical hormone, such as 3-oxo-4, 17 (20) -pregnendiene-20-carboxylic acid and methyl ester thereof, 3-oxo-1,4,17 (20) -pregnendiene-20-carboxylic acid and methyl ester thereof, 9 alpha-hydroxy-3-oxo-4, 17 (20) -pregnendiene-20-carboxylic acid and methyl ester thereof and other steroid compounds. The engineering strains can greatly improve the production efficiency and the product quality of the steroid medicaments, are beneficial to reducing the energy consumption in the production process of the steroid medicaments, simplifying the production steps and improving the utilization rate of the prodrug, thereby reducing the production cost, and meanwhile, the whole reaction condition is mild, the environment is friendly, and the economic benefit and the social benefit are higher.

Drawings

FIG. 1 shows the amplification results of the homologous arm upstream and downstream of the ltp2 gene knockout;

FIG. 2 shows the result of PCR verification of ltp2 gene-deleted strain NwIB-XII, nwIB-I;

FIG. 3 is the result of PCR verification of a successfully constructed pMV261-hsd4A-chsE1-E2 plasmid;

FIG. 4 is the result of PCR validation of a successfully constructed NwIB-I.DELTA.ltp2-Ohsd4A & chsE1-E2 strain;

FIG. 5 is the result of PCR validation of a successfully constructed NwIB-XII deltaltp 2-OKSTD1 strain;

FIG. 6 is a mass spectrum of PDC-M;

FIG. 7 is delta ¹ -mass spectrum of PDC-M;

FIG. 8 is a mass spectrum of a 9-OHPDC;

FIG. 9 is a liquid phase diagram of PDC-M;

FIG. 10 is a graph of delta ¹ -a liquid phase diagram of PDC-M;

FIG. 11 is a liquid phase diagram of a 9-OHPDC;

FIG. 12 is PDC, PDC-M, # ¹ -PDC、△ ¹ -PDC-M, 9α -OHPDC-M.

Detailed Description

The present invention will be further described with reference to examples and drawings, but embodiments of the present invention are not limited thereto.

The test methods for specific experimental conditions are not noted in the examples below, and are generally performed under conventional experimental conditions or under experimental conditions recommended by the manufacturer. The materials and reagents used, unless otherwise specified, are those commercially available.

The solution preparation methods referred to herein are as follows:

LB medium: 5g/L yeast extract, 10g/L tryptone, 10g/L sodium chloride (LB solid medium, 20g/L agar powder is added).

Seed culture medium: 20.0g/L glycerol, 2.0g/L citric acid monohydrate, 2.52g/L potassium nitrate, 0.5g/L magnesium sulfate heptahydrate, 0.5g/L dipotassium hydrogen phosphate, 0.05g/L ferric citrate amine, and pH 7.5.

Fermentation medium: 10.0g/L glucose, 2.0g/L citric acid monohydrate, 3.5g/L diammonium phosphate, 0.5g/L magnesium sulfate heptahydrate, 0.5g/L dipotassium phosphate, 0.05g/L ferric citrate amine, and pH 7.5.

The detection method of the incomplete degradation product of the sterol side chain comprises the following steps:

preparation of 9OHPDC-M standard: and taking fermentation liquor of 9OHPDC-M engineering bacteria NwIB-I deltaltp 2 from a 5L bioreactor after fermenting 15g/L of plant sterol in batches for 7 days. First, the pH of the fermentation broth was adjusted to about 3 with phosphoric acid. Then, the cells in the fermentation broth were removed by filtration, and the filtrate was extracted 3 times with an equal volume of ethyl acetate. The organic phases obtained by centrifugation were combined and then washed with distilled water 2 times and saturated brine 1 time, and finally with anhydrous MgSO ₄ Dried, filtered and concentrated under reduced pressure. A mixture of 9-OHPDC-M and its carboxylate 9-OHPDC can be obtained. And (3) performing silica gel column chromatography separation and purification by using petroleum ether/ethyl acetate as an eluent, and finally recovering 9.86g of 9-OHPDC-M and 1.27g of 9-OHPDC.

Preparing a 9OHPDC-M standard substance solution: 10mg of 9OHPDC-M is weighed and dissolved in methanol solution, the volume is fixed in a 10mL volumetric flask, and the concentration of the standard substance mother solution is 1mg/mL.

500. Mu.l of the broth sample was extracted with an equal volume of ethyl acetate, then centrifuged at 12000rpm for 10min, and 300. Mu.l of the upper ethyl acetate was placed in a fresh 1.5ml ep tube and placed in a fume hood for drying, ready for liquid chromatography.

Thin layer chromatography: taking 10 mu L of extracted ethyl acetate, spotting the ethyl acetate on a thin layer chromatography silica gel plate, and using petroleum ether: ethyl acetate=3:2 (v/v) as developing agent. After chromatography is completed, the surface liquid is air-dried, and 10% concentrated sulfuric acid reagent is irradiated or sprayed by a 254nm ultraviolet lamp, and the color development conditions of the standard product and the product extracting solution are compared and observed.

High performance liquid chromatography: if the content of 9-OHPDC-M is to be determined accurately, the HPLC method is to be used. Detection conditions: agilent 1100 chromatograph, eclipse Plus C18 column (250 mm. Times.4.6 mm,5 μm); column temperature 30 ℃, mobile phase is methanol: water=8:2 (v/v); the flow rate is 1mL/min; a detection wavelength of 254nm; the sample injection amount was 10. Mu.L. Each sample was run for 30min to ensure that all samples passed through the detector.

PDC-M and Abstract ¹ The preparation of the PDC-M product standard is consistent with the method of thin layer chromatography and 9-OHPDC-M, and the HPLC detection method is as follows: agilent 1100 chromatograph, eclipse Plus C18 column (250 mm. Times.4.6 mm,5 μm); column temperature 30 ℃, mobile phase is methanol: water=7:3 (v/v); the flow rate is 1mL/min; a detection wavelength of 254nm; the sample injection amount was 10. Mu.L. Each sample was run for 40min to ensure that all samples passed through the detector.

The original strain of Mycobacterium aurum Mycolicibacterium neoaurum was purchased from the American type culture Collection (American type culture collection, ATCC) under accession number: ATCC 25795. The modified chassis strain was selected from 9-OHIB engineering bacteria NwIB-I (K.Yao, L.Q.Xu, F.Q.Wang, D.Z.Wei, characterization and engineering of-ketosteroid-big uptri, open1-dehydrogenase and-ketosteroid-9 alpha-hydroxylase in Mycobacterium neoaurum ATCC 25795to produce 9alpha-hydroxy-4-hydrostene-3, 17-dione through the catabolism of sterols, metab Eng 24 (2014) 181-91) and ADD or AD engineering bacteria NwIB-XII (L.- -Q.xu, Y.- -J.Liu, K.Yao, H.- -H.Liu, X.- -Y.tao, F.- -Q.Wang, D.- -Z.Wei, unraveling and engineering the production of, 24-bisnorcholenic steroids in sterol metabolism, sci Rep 6 (1) (2016) 21928) constructed in the laboratory. The construction process of engineering bacteria of sterol side chain incomplete degradation products mainly comprises the knocking out of key gene ltp2 and the combined overexpression of hsd4A and ChsE1-E2. If accumulation is marked by accumulation ¹ The PDC-M product also requires overexpression of KstD1 in NwIB-XII deltaltp 2. The engineering bacteria constructed can greatly improve the production efficiency and the product quality of the steroid medicine, is beneficial to reducing the energy consumption in the production process of the steroid medicine, simplifying the production steps and improving the utilization rate of the prodrug, thereby reducing the production cost and having higher industrial application prospectThe scene.

Example 1: construction of PDC-M engineering strains

The inventors have found through research that a conserved operon igr sterol C17 alkyl side chain degradation from the Cho region, which is associated with cell growth, is critical in the last round of beta oxidation during the conversion of phytosterols by mycobacteria. The operon consists of six genes, encoding aldolase (Ltp 2), MAoC-like hydratase (ChsH 1-H2) composed of ChsH1 and ChsH2, acyl-CoA dehydrogenase (ChsE 1-E2) composed of ChsE1 and ChsE2, and one cytochrome P450 Cyp125 (CYP 125), respectively. We first knocked out the ChsH1-H2, ltp2 and the entire igr operon in the laboratory-constructed AD engineering bacteria NwIB-XII (Unraveling and engineering the production of, 24-bisnorcholenic steroids in sterol metabolism, sci Rep 6 (1) (2016) 21928.) and found that the main products were PDC-M. The corresponding knockout strains NwIB-XII ΔH2, nwIB-XII Δltp2 and NwIB-XII Δ igr are named PDC-M series engineering bacteria. Comparing the growth status and product accumulation of the knockdown bacteria, we found that the knockout of ltp2 had relatively little effect on strain growth and that product accumulation was relatively high. Thus, the locked ltp2 gene is a key gene for accumulating PDC-M.

The ltp2 gene (SEQ ID No: 5) of Mycobacterium aurum, whose gene sequence has been uploaded into the NCBI database, geneBank accession number:WP_019512512.1; region 117577:118755: +, the specific sequence is as follows:

GTGACATCGTCCGGAAAGGCCGGCCTGTCCGGCAAAGCGGCGATCGCCGGTATCGGTGCCACCGATTTCTCCAAGAATTCCGGGCGCAGCGAGCTGCGACTGGCTGCCGAGGCGGTGCTCGACGCGCTCGATGACGCCGGGCTGGCGCCGTCCGATGTGGACGGTCTGGTCACCTTCACGATGGACTCCAACCTGGAGACCGCCGTCGCGCGGTCCACCGGCATCGGTGATCTGAAGTTCTTCAGCCAGATCGGTTATGGCGGCGGTGCGGCGGCGGCGACGGTGCAGCAGGCCGCGCTGGCCGTCGCGACCGGGGTGGCCGAGGTCGTGGTGGCCTACCGGGCCTTCAACGAGCGCTCCGAGTTCCGGTTCGGCCAGGTGATGACGGGGTTGACCGTCAACGCCGATTCGCGCGGCGTCGAGTACAGCTGGTCATACCCGCACGGCCTGAGCACACCCGCGGCGTCGGTGGCCATGATCGCGCAGCGCTATATGCACGAATACGGCGCCACCAGCGCCGATTTCGGTGCGGTATCGGTCGCCGATCGCAAGCACGCCGCAACCAACCCCAAGGCGCACTTCTACGGGAAGCCGATCACGATCGAGGATCACCAGAACTCCCGCTGGATCGCCGAACCGCTCCGGCTGCTGGACTGCTGCCAGGAGACCGACGGTGGCGTCGCGATCGTGGTCACCACCCCCGAGCGGGCCAAGGACCTCAAACATCGCCCGGCGGTCATCGAGGCGGCCGCGCAGGGGGCGGGGACCGATCAGTTCACCATGTACTCCTACTACCGCGAGGAGCTCGGGCTGCCCGAGATGGGCCTGGTCGGCCGCCAGCTGTGGGAGCAGAGCGGTCTGACGCCCGCGGATATCCAGACCGCGATCCTCTACGACCATTTCACCCCGTACACGCTGATCCAGCTCGAGGAGCTCGGCTTCTGCGGCAAGGGCGAGGCCAAGGATTTCATCGCCGGCGGGGCCATCGAGATCGGCGGGAAGCTACCCATCAACACCCACGGCGGACAGCTCGGCGAGGCGTATATCCACGGCATGAACGGGATCGCCGAAGGGGTGCGTCAGCTACGGGGAACGTCGGTCAACCAGGTTGACAATGTCGAACATGTGCTGGTCACGGCGGGTACCGGGGTGCCGACATCGGGTCTGATCCTCGGCTGA。

the sequence of the designed homologous arm primer for gene knockout is as follows:

pQC-ltp2-U-F(SEQ ID No:10):TATActgcagACCAGGCTCGCCATCAACGGGGTC

pQC-ltp2-U-R(SEQ ID No:11):GACCaagcttATCCACGGCATGAACGGGATCGCC

pQC-ltp2-D-F(SEQ ID No:12):GCGCaagcttGTCCATCGTGAAGGTGACCAGACC

pQC-ltp2-D-R(SEQ ID No:13):TATAgcggccgcGAGATGGACTGGCGCATCATGAAG。

the primers were synthesized by Shanghai JieRui bioengineering Co., ltd, and diluted to 10. Mu.M with sterile water, and the high-fidelity enzyme used for PCR amplification was Takara PrimerSTAR Max DNA.

Amplification of upstream and downstream homology arms: the genome of the new Mycobacterium aurum is used as a template, and the homologous arm primers pQC-ltp2-U-F & R and pQC-ltp2-D-F & R are used for respectively amplifying the upstream homologous arm sequence and the downstream homologous arm sequence, and the PCR amplification system is as follows.

PCR amplification conditions: pre-denaturation at 98 ℃ for 5min; denaturation at 98℃for 10s, (Tm-5) ℃for 8s, extension at 72℃for 1kb/min, 30 cycles of reaction; extending at 72℃for 5min. The upstream fragment length of the homology arm is 1000bp, and the downstream fragment length of the homology arm is 996bp. The amplified product is subjected to agarose gel electrophoresis detection with single band, purified and recovered by a product purification kit, and stored at 4 ℃ for later use.

P2NIL plasmid and upstream and downstream homology arm enzyme digestion

The p2NIL plasmid extract (from Addgene (www.addgene.org/20188 /) accession # 20188) and purified product of the p2 gene upstream and downstream homology arms were taken, the p2NIL plasmid extract was digested with HindIII and BamHI, the upstream homology arms were digested with HindIII and EcoRI, and the downstream homology arms were digested with EcoRI and BamHI. Endonucleases were purchased from ThermoFisher Scientific company, and the cleavage system and reaction conditions were as follows.

Cleavage reaction conditions: incubate for 1 hour in a metal bath or water bath at 37 ℃. The enzyme-digested product is purified and recovered, and is preserved at-20 ℃ for standby.

T4 enzyme ligation: 1. Mu.L of the T4 ligase system, i.e.ligase, purchased from ThermoFisher Scientific company; 10 Xbuffer, 2. Mu.L; plasmid vector and gene fragment 1:5 ratio, added to T4 ligase system, incubate ligation for 2h at 22 ℃. Subsequently, the ligation product was transformed into E.coli DH 5. Alpha. And screened using kanamycin (50. Mu.g/mL) resistant plates, and after colony PCR amplification and sequencing verification, recombinant plasmid p2NIL-ltp2 was obtained.

Construction of pQC-ltp2 plasmid and electric transformation competence: pGOAL19 plasmid (from Addgene company (www.addgene.org/20190 /) code: # 20190) and the recombinant plasmid p2NIL-Mn_hal were digested with PacI, respectively. The fragment with 8900bp length is recovered from pGOAL19 plasmid cleavage product, and the recombinant plasmid p2NIL-Mn_hal is directly purified after cleavage. The two fragments are connected by T4 ligase, transferred into escherichia coli DH5 alpha competence, amplified by colony PCR and verified by sequencing, the escherichia coli DH5 alpha transformed strain carrying recombinant plasmid pQC-ltp2 is obtained, the purified product of suicide plasmid pQC-ltp2 is obtained by amplification culture and extraction, after alkali treatment, the purified product is transferred into mycobacterium competence cells for electric conversion (2.5 kV,200 ohm, 25 mu F,0.2cm electric conversion cup, electric shock time is 5-6ms, electric shock twice), bacterial liquid after 3-5h incubation is carried out, 4500 Xg is centrifuged for 2min, and 100 mu L of coating kanamycin and hygromycin resistance screening plates are reserved after supernatant is discarded.

After blue colonies were grown on the medium, the selection was transferred to LB medium for amplification, and sucrose lethal plates (2% sucrose, 200. Mu. L X-Gal (20 mg/mL) and 20. Mu.L IPTG (50 mg/mL)) were plated for selection of the correct double-crossover mutant strain:

1) The blue colonies were transferred to a 5mL liquid LB tube containing 50. Mu.g/mL kanamycin, 50. Mu.g/mL hygromycin, and cultured with shaking at 30℃for 24-48 hours.

2) Preparing a screening plate: LB solid medium, 2% sucrose, 200. Mu. L X-Gal (20 mg/mL) and 20. Mu.L IPTG (50 mg/mL).

3) When the bacterial liquid was cultured until the od=1.5, 50 to 100 μl was applied to the plate. Inverted culturing at 37deg.C for 3-5d.

4) The strain completing the double crossover gene deletion does not contain a screening mark. After the strain grows well, yellow monoclonal is selected and colony PCR verification is carried out.

5) Double-exchange verification primers are pQC-ltp2-U-F and pQC-ltp2-D-R, and if about 2000bp single band can be amplified, the correct transformant for deleting the target gene ltp2 can be obtained.

6) And (3) verifying correct monoclone, transferring to a 5mL liquid LB test tube, carrying out shaking culture at 30 ℃ and 220rpm for 3 days, and preserving bacteria for later use to obtain engineering bacteria NwIB-XII deltaltp 2.

It should be understood that the construction methods of PDC-M engineering bacteria NwIB-XII delta H12 and NwIB-XII delta igr are the same as those of NwIB-XII delta ltp2, wherein the knockout primer sequences of the ChsH1-H2 and igr are as follows:

pQC-H1H2-U-F(SEQ ID No:6)：TAGCAAGCTTGACGATACCCGGATGACCTGCGGC

pQC-H1H2-U-R(SEQ ID No:7)：TATAGCGGCCGCCGATCGAGCAGCAGATCTTCATCA

pQC-H1H2-D-F(SEQ ID No:8)：TAGCAAGCTTGACGATACCCGGATGACCTGCGGC

pQC-H1H2-D-R(SEQ ID No:9)：TATAGCGGCCGCCGATCGAGCAGCAGATCTTCATCA

pQC-igr-U-F(SEQ ID No:14)：GCACAAGCTTCGCGTTCTCGTCGACGTTCGGCCAC

pQC-igr-U-R(SEQ ID No:15)：TATAGAATTCCCGTCGCGCGGTCCACCGGCATCGG

pQC-igr-D-F(SEQ ID No:16)：GCGCGAATTCCATGTTGAGCAGGACGGCCTTCTGC

pQC-igr-D-R(SEQ ID No:17)：ATCGGGATCCCGTCGAGGTGGTAGTAGGTCTCGGC。

example 2: and (V) ¹ Construction of PDC-M engineering bacteria

The primary PDC-M engineering bacterium NwIB-XII deltaltp 2 constructed in example 1 is used as a chassis strain to overexpress 3 keto-delta ¹ Dehydrogenase kstD1.

The new Mycobacterium aurum kstD1 gene sequence (SEQ ID No: 22), uploaded to the NCBI database, geneBank accession number:WP_006246521.1; region 121522:123153, the specific sequence is as follows.

TCAGGCCTTTCCAGCGAGATGCAATGCGGCGAGGTAGCCGAAGGTCATGGCGGGCCCGATTGTGCCACCCGGGCCGGGATAGGTGTGACCCATCACCGGCGAGCTGACATTGCCTGCCGCATAGAGGCCTTCGATCACCGAATTGTCATCGCGCAGCGCCCGGCCGTGCACGTCGGTGCGGATGCCACCCTTGGTGCCCAGGTCACCGGGCACCATCTTCGCGGCGTAGAACGGGCCGTGTTTGATCTCGCCGAGGTTCGGGTTCGGCTTGTTCGTCGGATCACCGTAGTAGCGGTCGTAGGCGCTCTCGCCGCGGTGGAAGTCCTCGTCGACGCCGGACCGTGCGAAACCGTTGAACCGTTCGATGGTGGCCTTCAGCGCGTCGGCGGCCACACCGGTCTTCTCGGCCAGCTCGGCCAGGCTATCGGCCTTGACGATGATGCCCGATTCCATCCACTTCTTCGGGATGCGTTGTCCGGGTTGCAATCCCGCAAAGATATAGCGATCGCGGTACTGCTGGTCGAAGATCATCCAGGCGGGCACGTTCTCGCCCGGCCCGGCGCCCTGGCCGTACTGACCGCCGTACATGTGGTGGCAGGCCTCCACGTAGGGCATCGATTCGTTCATGAACCGCTTACCGTTCATGTTGACGATGATCGACCCGGGGGAGTTGCGCTCGGAAAGGGCGAACCACGGGGCGCCCTCCAGCGGGACGGTCGGACCCCACCACGCGTCCTCCATGAGTTCCAGTGCCGCACCCAGCTTTTCGGCTGCCAGGATGCCGTCACCGGTGTTGGCGACGGCACCGACGGTCCACTCGGTGGTGATGGGCTGGCGCTGGTACTTGGTGCGCATCTCCTGGTTGTGTTCGAAACCGCCCGAACCGAGGATCACGCCCCTGCGGGCCCGGATCAGCTTCGGCTCGGCAGACTCGGGGGCACCGGCCTCGCGAACGTAGATTCCGCGCACCACCCCGTCCTCGATGTACAGGTCGGTCAGCGCGGTGTTCAGCAGCACCGGCACCCCGGCCTTCTGCAGACCGATGCGCAGCGGCGCGATGAGCGCCCGGCCCATGCCGACCAGGTTCTTGCCGGTGGCGTTGGCCCACACCGATCGCACACCCACCTTGATGCTGCGTAGCACGCCGCGCGGGTGACGCTTGAGCTGGTTGAGCCGGACATAGTCCTGTTGCAGTACCACCATGTTCAGCGGCACCTTGCCGTACGGCGGTTCGAGCCCCTTCTCGTCGGGACCGAGCTTCTTGGCGTTGAACGGCTTCGGCTCGACCGAGCGGCCGGTGGCCTTACCGCCCGGCGTCTCCGGGTAGTAGTCGGAGTAGCCGGGAACCCAGCACAGCTTCAGCGGCGAGTTCTTCAGCACGAACGACAACATCTCCGGACTGCGGTCCAGGTAGGTGTCGATCTTCTCGGCAGGCACCACATCGCCGATGATGGCGTGCAGGTACTTCCGTGCCTCCGCGGCGGTGTCTTTGACCCCGTCACGCTGAAGAACCTCGTTGTTGGGAATCCACAC

The primer sequences were designed as follows:

K1-F(SEQ ID No:23)：TGCAgaattc TCAGGCCTTTCCAGCGAGATGC

K1-R(SEQ ID No:24)：AGTAaagctt CCTCGTTGTTGGGAATCCACAC

261-YZ-F(SEQ ID No:25):GACAGGTAAAAGTCCTGGTAGACGC

261-YZ-R(SEQ ID No:26):ACGTCGCTTTGTTGGCTAGC

Gene expression cassette amplification: the new Mycobacterium aurum genome is used as a template, and the gene sequence of the sequence kstD1 is amplified by using the primers K1-F & R, and the PCR amplification system is prepared, amplified and purified under the same conditions as in example 1.

Construction of the pMV261-kstD1 plasmid:

and (3) carrying out enzyme digestion, purification and recovery on a pMV261 plasmid product and a gene expression frame amplification product by using BamHI & EcoRI, connecting and converting two fragments into escherichia coli DH5 alpha competence by using ligase, coating, colony PCR amplification and sequencing verification to obtain the recombinant plasmid.

The NwIB-XII deltaltp 2 strain is taken to prepare competence, then the pMV261-kstD1 plasmid product is electrically transformed and introduced into the NwIB-XII deltaltp 2 strain to obtain an engineering strain with genotype of NwIB-I deltaltp 2-O hsd4A & chsE1-E2, and the preparation steps are as follows:

1) To NwIB-XII deltaltp 2 competent (100. Mu.L) was added the recombinant plasmid pMV261-kstD1 plasmid product, mixed well and ice-water bath for 20min.

2) Transferring the suspension to an electrode cup precooled at 4 ℃, shocking twice (2.5 kV,200 ohm, 25 muF, 0.2cm electrotransformation cup) by using a Gene Pulser Xcell electroporation apparatus, shocking for 5-6ms, rapidly transferring to an ice water bath, and standing for 5min.

3) Adding 700 μl of LB liquid medium, suspending thoroughly, transferring to a 1.5mL sterile centrifuge tube, shake culturing at 30deg.C for 3-4 hr, spreading 100 μl on a resistant (kanamycin 50 μg/mL) solid plate, and culturing in a 30 deg.C incubator for about 3 days.

4) Single colonies were picked, dissolved in 10. Mu.L of LB medium, kanamycin 50. Mu.g/mL, and treated with 261-YZ-F&R is subjected to PCR verification, and the delta with the genotype of NwIB-XII delta ltp2-okstD1 can be obtained ¹ PDC-M strain.

Example 3: construction of 9OHPDC-M engineering strains

An engineering bacterium NwIB-I (K.Yao, L.Q.Xu, F.Q.Wang, D.Z.Wei, characterization and engineering of 3-ketosteroid-big uptri, open1-dehydrogenase and 3-ketosteroid-9alpha-hydroxylase in Mycobacterium neoaurum ATCC 25795to produce 9alpha-hydroxy-4-android-3, 17-dione through the catabolism of sterols, metab Eng 24 (2014) 181-91) constructed in a laboratory is selected as a chassis strain, a key gene ltp2 is knocked out first, and a primary engineering bacterium with a genotype NwIB-I delta ltp2 is constructed by the same method as in example 1. To enhance the metabolic flux of sterol side chain degradation toward 9OHPDC-M, we next combined the overexpression of hsd4A and Chose 1-E2, optimizing the productivity of NwIB-I.DELTA.ltp2.

New Mycobacterium aurum hsd4A gene sequence (SEQ ID No: 27), uploaded to NCBI database, geneBank accession number: KP642512.1; region 1:912, the specific sequence is as follows:

ATGAACGACAACCCGATCGACCTGTCCGGAAAGGTTGCCGTCGTCACCGGCGCGGCCGCCGGCCTGGGCCGGGCCGAGGCGATAGGCCTGGCGCGGGCCGGCGCGACGGTCGTGGTCAACGACATGGCCGGCGCGCTGGACAACTCCGACGTGCTGGCCGAGATCGAAGCGGTCGGGTCCAAGGGCGTCGCGGTCGCCGGTGATATCAGCGCGCGCAGCACCGCCGACGAACTCGTCGAGACAGCCGACCGGCTCGGGGGACTGGGCATCGTGGTGAACAACGCCGGCATCACCCGGGACAAGATGCTGTTCAACATGTCCGACGAGGACTGGGACGCGGTGATCGCCGTGCATCTGCGCGGACACTTCCTGTTGACGCGCAATGCTGCGGCGTACTGGAAGGCGAAGGCCAAGGAGACCGCCGACGGACGGGTGTACGGACGGATCGTCAACACCTCCTCGGAGGCCGGGATCGCCGGACCGGTGGGTCAAGCCAATTACGGTGCCGCCAAGGCCGGTATCACGGCGTTGACGCTGTCGGCGGCGCGCGGGTTGAGCAGGTACGGGGTGCGGGCCAATGCCATCGCACCGCGGGCCCGCACCGCCATGACCGCCGGCGTGTTCGGTGATGCACCGGAGCTGGCGGACGGACAGGTCGATGCCCTCTCGCCGGAGCATGTCGTCACGCTCGTCACCTACCTGTCCTCCCCGGCGTCCGAGGATGTCAACGGGCAGCTGTTCATCGTGTACGGACCGACGGTCACCCTGGTTGCGGCGCCGGTTGCCGCCCACCGGTTCGATGCCGCCGGTGATGCCTGGGACCCCGCGGCGTTGAGCGACACGCTCGGTGACTTCTTTGCTAAAAGGGATCCGAATATTGGGTTCTCCGCAACTGAGCTCATGGGTTCTTGA

new Mycobacterium aurum ChsE1, chsE2 gene sequences (SEQ ID No:1, SEQ ID No: 2), uploaded to NCBI database, geneBank accession number:WP_003419299.1, NP_218060.1; region 114566:115564, 115571:116734, the specific sequences are as follows.

ChsE1:GTGGACTTCACGCCGAAGCCCGAACAGCAGGCCGTCGCCGATGTGGTGACCTCGGTGCTGGAACGGGACAACAGCTGGGACGCACTGGTATCCGGTGGGGTGGCGGCGCTGGCGGTGCCCGAGCGCCTCGGTGGTGACGGGCTCGGACTGCCCGAGATCGCCACCGCGCTCACCGAGATCGGCAGGCGCGGTACGACCGGTGCGGCACTGGCCACGCTGGGTCTCGGGTTGCTGCCGCTGCTGGAGGTGGCCACCGATACCGAACAGGACCGCTATCTCGACGGGGTCGCCGGCGGGGCCGTGTTGTCGGCGGCGCTCAACGAGCCCGGAGTCTCGCTTCCCGAGCGCCCCTCGGTGACCCTGACCGACGGGAAGCTCACCGGAACCAAGATCGGTGTGCCCTATGCCGGCACCGCGCGATGGCTGTTGGTCACCGCGGACGGTGGGGTCGCGGTGATCGCTCCGACCGCGAGTGGGGTGACGCTGACCAAGACGCCGACCTCCAACGGCACCGACGAGTACGTGGTGGTCTTCGACGGCGCCGAGGTGGACGGAGTGCTCGCCAACGCCACGACCCGCCGAGTCAACCAGTTGGTGCTGGCCGCCACCGGAGCCTTCGCCGCGGGCCTGGTCGCCGGCGCGCTGCGACTTACCGCCGATTACGTGGCCACTCGCGAACAGTTCGGGCGTCCGCTGTCGACCTTCCAGACCGTCGCCGCGCAGCTCTCGGATGTCTATATCGCCTCGCGGACAATCGATCTCGCGGCCACGTCGGTGATCTACCGGTTGTCCGAGGGCCTCGATGCCGACGACGATCTGGCGCTGCTGGGCTATTGGATCACCTCGCAGGCGCCGCCGGCGATGCGGTTGTGTCATCATCTGCACGGCGGCATGGGAATGGATATCACCTATCCGATGGATCGGTATTTCTCCTCCATCAAGGACCTCACCCGCTTGCTGGGCGGGCCTGCGTATCGACTGGATCTGGTGGGAGCGTAA

ChsE2:ATGTACATCGAACTGACGCCGGAACAGCGCAAGCTGCAAGACGAATTCCGCGAGTACTTCTCGACGCTCATCACGCCGGAGGAAGCCGCGGCGATGGAGTCCGATCGCCACAACGAGGCCTATCGCGCGGTGATCAAGCGGATGGGCTCGGACGGCAAGCTGGGTGTGGGCTGGCCCAAGGAGTACGGCGGGCTCGGCTTCGGGCCGATCGAGCAGCAGATCTTCATCAACGAGGCCAACCGCGCCGATATCCCGCTGCCGATGGTCACGCTGCAGACGGTGGGCCCCACCCTGCAGGTGCACGGGACCGAACTGCAGAAGAAGAAGTTCCTGCCCGGGATCCTCGCCGGCGAGGTGCATTTCGCGATCGGTTACTCCGAGCCGGAGGCGGGCACCGATCTCGCCTCGCTGCGGACCACCGCGGTGCGCCACGGCGACGAGTACATCGTCAACGGCCAGAAGATGTGGACCACCGGCGCCCACGACGCCGACTACATCTGGCTGGCCTGCCGCACCGATCCGGAAGCCGCCAAGCACAAGGGCATTTCGATCCTGATCGTCGATACCAAGGATCCCGGCTACTCCTGGACGCCGATCATCCTCAGCGATGGGGCACACCACACCAACGCGTCGTATTACAACGACGTCCGGGTGCCCGCCGACATGCTGGTCGGCGAGGAACACGGCGGCTGGAAGCTCATCACGACCCAGCTCAACCACGAGCGCGTCGGGCTTGGCCCGGCCGGACGCATCGCCGGGATCTACGACGAGGTCCACGAGTGGGCGTGCATGCCCGGATCCGATGGTGTCGTGCCGATCGAACAGGACGACGCGCGTCGACTGCTGGCCCAGATCAAATCGATCTGGCGGATCAACGAGTTGCTGAACTGGCAGGTGGCCGCCTCGGGCGAGACCATCGCGGTGGCCGATGCGGCGGCGACGAAGGTCTTCTCCACCGAGCGCATCCAAGAGGTCGGCCGGCTGGCCGAAGAGGTCGTCGGCCGCTACGGCAACCCCGCCGATGCCCACACCGGCAGGCTGCTGGACTGGTTGGACAAGATGACCAAACGCAATCTGGTGATCACCTTCGGTGGCGGCGTCAACGAGGTCATGCGCGAAATGATCGCCGCGTCGGGGTTGAAGGTGCCGAGGGTGACCCGGTGA

The primer sequences were designed as follows:

4A-F(SEQ ID No:18)：TAGCCTGCAGAAATGAACGACAACCCGATCGACCTGT

4A-R(SEQ ID No:19)：GCGCAAGCTTTCAAGAACCCATGAGCTCAGTTGCG

4AE1E2-F(SEQ ID No:20)：GTGAAAGCTTGAGAAGGAGATATAATGAACGACAACCCGATC

4AE1E2-R(SEQ ID No:21)：AATTGTTAACTCAAGAACCCATGAGCTCAGTTGCGGAG

261-YZ-F(SEQ ID No:25)：GACAGGTAAAAGTCCTGGTAGACGC

261-YZ-R(SEQ ID No:26)：ACGTCGCTTTGTTGGCTAGC

Gene expression cassette amplification: the new Mycobacterium aurum genome is used as a template, and the primer 4A-F & R is used for amplifying the gene sequence of the sequence hsd4A, and the PCR amplification system is prepared, amplified and purified under the same conditions as in example 1.

Construction of pMV261-hsd4A plasmid:

the pMV261 plasmid product and the gene expression frame amplification product are subjected to enzyme digestion, purification and recovery by BamHI & EcoRI, and the two fragments are connected and transformed into escherichia coli DH5 alpha competence by ligase, and the recombinant plasmid is subjected to coating, colony PCR amplification and sequencing verification.

Construction of pMV261-hsd4A & chsE1-E2 plasmid:

the recombinant plasmid pMV261-hsd4A is subjected to enzyme digestion by HindIII and HpaI, purified and recovered to obtain a plasmid skeleton, and is subjected to T4 connection with a gene sequence fragment of chsE1-E2 to obtain a recombinant plasmid connection product pMV261-hsd4A & chsE1-E2;

3) The ligation product pMV261-hsd4A & chsE1-E2 is transformed into escherichia coli DH5 alpha, a kanamycin resistance plate is coated for cloning and screening, and the recombinant plasmid pMV261-hsd4A & chsE1-E2 is obtained through colony PCR, plasmid digestion and plasmid sequencing verification.

The NwIB-I deltaltp 2 strain is taken to prepare competence, and then the pMV261-hsd4A & chsE1-E2 plasmid product is electrically transformed and introduced into the NwIB-I deltaltp 2 strain to obtain an engineering strain with genotype of NwIB-I deltaltp 2-O hsd4A & chsE1-E2, and the preparation steps are as follows:

1) To NwIB-I.DELTA.ltp2 competent (100. Mu.L) was added the recombinant plasmid pMV261-hsd4A & chsE1-E2 plasmid product, mixed well and ice-water bath for 20min.

4) Single colony is selected, dissolved in 10 mu L of LB culture medium with 50 mu g/mL kanamycin, and subjected to PCR verification by using 4A-F and 4AE1E2-R, so that the enhanced strain with genotype NwIB-I delta ltp2-O hsd4A & chsE1-E2 can be obtained.

Example 4: PDC-M ¹ Production capacity assessment of PDC-M, 9OHPDC-M engineering strains

And (3) carrying out tank loading amplification on primary engineering bacteria NwIB-XII deltaltp 2, nwIB-XII deltaltp 2-OKstD1 and NwIB-I deltaltp 2 of the constructed PDC. Firstly, 50 μl of glycerol bacteria are transferred to a 5mL LB test tube, cultured for 3 days at 30 ℃ and 220rpm, inoculated to 30mL seed culture medium at 10% (v/v), cultured for 2 days at 30 ℃ and 220rpm in a shaking way, then the primary seed culture solution is transferred to 150mL seed culture medium again at 10% (v/v) proportion, and cultured for 1.5 days at 30 ℃ and 220rpm in a shaking way.

The stirring speed of the fermentation tank is 300-800 rpm, the substrate is 15g/L of plant sterol, the plant sterol is dissolved by the cosolvent hydroxypropyl beta cyclodextrin, and the plant sterol is: the mass ratio of cyclodextrin is 1:4, dissolved oxygen is coupled, the temperature is controlled at 40%, and the fermentation is carried out for 168 hours. After fermentation, the fermentation broth is respectively subjected to a series of operations such as acidification, filtration, ethyl acetate extraction, washing and drying, column chromatography purification and the like, 9.08g PDC-M and 0.97g carboxylic acid PDC can be obtained from the final engineering bacterium NwIB-XII deltaltp 2, and 8.65g can be obtained from the engineering bacterium NwIB-XII deltaltp 2-OKstD1 ¹ PDC-M and carboxylic acid delta of 0.82g ¹ PDC, 9.86g of 9-OHPDC-M and 1.27g of carboxylate 9-OHPDC were obtained from engineering bacterium NwIB-I.DELTA.ltp2.

The foregoing description is only a preferred embodiment of the present invention, and is not intended to limit the scope of the present invention, and various modifications can be made to the above-described embodiment of the present invention. All simple, equivalent changes and modifications made in accordance with the claims and the specification of the present application fall within the scope of the patent claims. The present invention is not described in detail in the conventional art.

SEQUENCE LISTING

<110> university of Industy of Huadong

<120> a genetically engineered strain for producing a sterol side chain incompletely degraded product, a method of constructing the same, and a use thereof

By using

<160> 26

<170> PatentIn version 3.5

<210> 1

<211> 999

<212> DNA

<213> New golden Mycobacterium (Mycolicibacterium neoaurum)

<400> 1

gtggacttca cgccgaagcc cgaacagcag gccgtcgccg atgtggtgac ctcggtgctg 60

gaacgggaca acagctggga cgcactggta tccggtgggg tggcggcgct ggcggtgccc 120

gagcgcctcg gtggtgacgg gctcggactg cccgagatcg ccaccgcgct caccgagatc 180

ggcaggcgcg gtacgaccgg tgcggcactg gccacgctgg gtctcgggtt gctgccgctg 240

ctggaggtgg ccaccgatac cgaacaggac cgctatctcg acggggtcgc cggcggggcc 300

gtgttgtcgg cggcgctcaa cgagcccgga gtctcgcttc ccgagcgccc ctcggtgacc 360

ctgaccgacg ggaagctcac cggaaccaag atcggtgtgc cctatgccgg caccgcgcga 420

tggctgttgg tcaccgcgga cggtggggtc gcggtgatcg ctccgaccgc gagtggggtg 480

acgctgacca agacgccgac ctccaacggc accgacgagt acgtggtggt cttcgacggc 540

gccgaggtgg acggagtgct cgccaacgcc acgacccgcc gagtcaacca gttggtgctg 600

gccgccaccg gagccttcgc cgcgggcctg gtcgccggcg cgctgcgact taccgccgat 660

tacgtggcca ctcgcgaaca gttcgggcgt ccgctgtcga ccttccagac cgtcgccgcg 720

cagctctcgg atgtctatat cgcctcgcgg acaatcgatc tcgcggccac gtcggtgatc 780

taccggttgt ccgagggcct cgatgccgac gacgatctgg cgctgctggg ctattggatc 840

acctcgcagg cgccgccggc gatgcggttg tgtcatcatc tgcacggcgg catgggaatg 900

gatatcacct atccgatgga tcggtatttc tcctccatca aggacctcac ccgcttgctg 960

ggcgggcctg cgtatcgact ggatctggtg ggagcgtaa 999

<210> 2

<211> 1164

<212> DNA

<213> New golden Mycobacterium (Mycolicibacterium neoaurum)

<400> 2

atgtacatcg aactgacgcc ggaacagcgc aagctgcaag acgaattccg cgagtacttc 60

tcgacgctca tcacgccgga ggaagccgcg gcgatggagt ccgatcgcca caacgaggcc 120

tatcgcgcgg tgatcaagcg gatgggctcg gacggcaagc tgggtgtggg ctggcccaag 180

gagtacggcg ggctcggctt cgggccgatc gagcagcaga tcttcatcaa cgaggccaac 240

cgcgccgata tcccgctgcc gatggtcacg ctgcagacgg tgggccccac cctgcaggtg 300

cacgggaccg aactgcagaa gaagaagttc ctgcccggga tcctcgccgg cgaggtgcat 360

ttcgcgatcg gttactccga gccggaggcg ggcaccgatc tcgcctcgct gcggaccacc 420

gcggtgcgcc acggcgacga gtacatcgtc aacggccaga agatgtggac caccggcgcc 480

cacgacgccg actacatctg gctggcctgc cgcaccgatc cggaagccgc caagcacaag 540

ggcatttcga tcctgatcgt cgataccaag gatcccggct actcctggac gccgatcatc 600

ctcagcgatg gggcacacca caccaacgcg tcgtattaca acgacgtccg ggtgcccgcc 660

gacatgctgg tcggcgagga acacggcggc tggaagctca tcacgaccca gctcaaccac 720

gagcgcgtcg ggcttggccc ggccggacgc atcgccggga tctacgacga ggtccacgag 780

tgggcgtgca tgcccggatc cgatggtgtc gtgccgatcg aacaggacga cgcgcgtcga 840

ctgctggccc agatcaaatc gatctggcgg atcaacgagt tgctgaactg gcaggtggcc 900

gcctcgggcg agaccatcgc ggtggccgat gcggcggcga cgaaggtctt ctccaccgag 960

cgcatccaag aggtcggccg gctggccgaa gaggtcgtcg gccgctacgg caaccccgcc 1020

gatgcccaca ccggcaggct gctggactgg ttggacaaga tgaccaaacg caatctggtg 1080

atcaccttcg gtggcggcgt caacgaggtc atgcgcgaaa tgatcgccgc gtcggggttg 1140

aaggtgccga gggtgacccg gtga 1164

<210> 3

<211> 408

<212> DNA

<213> New golden Mycobacterium (Mycolicibacterium neoaurum)

<400> 3

atgagtctga ccctgaccga cgtcgcggtc ggcaccacac tgcccgaact gcagatctac 60

ggtgacccga cgttcatcgt ctccaccgcc atcgccaccc gcgattacca ggatgtgcac 120

cacgaccggg acaaggcgca ggccaaggga tccaaggaca tcttcgtcaa catcctcacc 180

gataccggtc tggtcgggcg ttatgtcacc gactgggccg gtccggacgc gcgggtcaag 240

tccatcaagt tgcgccttgg ggtgccctgg tacgcctatg acaccatcac cttcagtggt 300

gaggtcaccg agatcgacgg cgatgtggtg accctgaaag tggtgggcgc caacagcctc 360

ggcaaccatg tcatcgccac ctcgacgctc accctggggg acaagtga 408

<210> 4

<211> 972

<212> DNA

<213> New golden Mycobacterium (Mycolicibacterium neoaurum)

<400> 4

gtgagcgaac tgcaggcggg tatcgaggcg gtcctcgcgg cgggcagcag tagtccgacc 60

gtggcgcgcg acccggtgaa ccaacccatg atccatcact gggtcgatgc gatcggggac 120

aagaacccga tctacgtcga cgccgaggcg gcccgtgccg caggtcatcc gggtatcgtc 180

gccccgccgg cgatgatcca ggtgtggacc atgatggggc tggggcgttc ccgctccgat 240

gatgatccgc tcgcccgcgc catgaagctt ttcgatgacg ccggttatgt cggcgtcgtc 300

gccaccaact gcgaccagac ctatcaccgc tacctgcagc cgggggagca ggtggcgatg 360

agtgcggaga tcgtcggcat cgtcggtccc aaacagaccg cgctcggtga gggttacttc 420

atcaaccaga agatcagctg gcataccgtc ggggccggcg cggaggaact ggtcgccgag 480

atggactggc gcatcatgaa gttcctgccg gcagccaacg cggccaagac cgaaacggcc 540

gcgattcccg aggatctcga tcccgacaaa ctgatgcggc cgtcctcgtc gcgtgacacc 600

aagttcttct gggatggcgt caacgcacac gaactgcgta tccagcgccg cccggacggg 660

acgctgcagc acccaccggt ccccgcgatg tgggccgaca aagacgcacc cgccgattat 720

gtcgtctcct ccgggagggg cacggtgttc agctatgtcg tccaccatgc accgaaggtg 780

cccggccgca cgctgccctt cgtgatcgcc ctcgtcgaac tcgaggaggg cgttcggatg 840

ctcggcgagc tgcgtggggt ggatcccgag caggtgaaga tcggaatgcc ggtcaccgca 900

acctatatcg acttccccga cagtgaggtc agcccggcct ggacgttgta tgcatgggag 960

ccgcaagcat ga 972

<210> 5

<211> 1179

<212> DNA

<213> New golden Mycobacterium (Mycolicibacterium neoaurum)

<400> 5

gtgacatcgt ccggaaaggc cggcctgtcc ggcaaagcgg cgatcgccgg tatcggtgcc 60

accgatttct ccaagaattc cgggcgcagc gagctgcgac tggctgccga ggcggtgctc 120

gacgcgctcg atgacgccgg gctggcgccg tccgatgtgg acggtctggt caccttcacg 180

atggactcca acctggagac cgccgtcgcg cggtccaccg gcatcggtga tctgaagttc 240

ttcagccaga tcggttatgg cggcggtgcg gcggcggcga cggtgcagca ggccgcgctg 300

gccgtcgcga ccggggtggc cgaggtcgtg gtggcctacc gggccttcaa cgagcgctcc 360

gagttccggt tcggccaggt gatgacgggg ttgaccgtca acgccgattc gcgcggcgtc 420

gagtacagct ggtcataccc gcacggcctg agcacacccg cggcgtcggt ggccatgatc 480

gcgcagcgct atatgcacga atacggcgcc accagcgccg atttcggtgc ggtatcggtc 540

gccgatcgca agcacgccgc aaccaacccc aaggcgcact tctacgggaa gccgatcacg 600

atcgaggatc accagaactc ccgctggatc gccgaaccgc tccggctgct ggactgctgc 660

caggagaccg acggtggcgt cgcgatcgtg gtcaccaccc ccgagcgggc caaggacctc 720

aaacatcgcc cggcggtcat cgaggcggcc gcgcaggggg cggggaccga tcagttcacc 780

atgtactcct actaccgcga ggagctcggg ctgcccgaga tgggcctggt cggccgccag 840

ctgtgggagc agagcggtct gacgcccgcg gatatccaga ccgcgatcct ctacgaccat 900

ttcaccccgt acacgctgat ccagctcgag gagctcggct tctgcggcaa gggcgaggcc 960

aaggatttca tcgccggcgg ggccatcgag atcggcggga agctacccat caacacccac 1020

ggcggacagc tcggcgaggc gtatatccac ggcatgaacg ggatcgccga aggggtgcgt 1080

cagctacggg gaacgtcggt caaccaggtt gacaatgtcg aacatgtgct ggtcacggcg 1140

ggtaccgggg tgccgacatc gggtctgatc ctcggctga 1179

<210> 6

<211> 34

<212> DNA

<213> Synthesis

<400> 6

tagcaagctt gacgataccc ggatgacctg cggc 34

<210> 7

<211> 36

<212> DNA

<213> Synthesis

<400> 7

tatagcggcc gccgatcgag cagcagatct tcatca 36

<210> 8

<211> 34

<212> DNA

<213> Synthesis

<400> 8

tagcaagctt gacgataccc ggatgacctg cggc 34

<210> 9

<211> 36

<212> DNA

<213> Synthesis

<400> 9

tatagcggcc gccgatcgag cagcagatct tcatca 36

<210> 10

<211> 34

<212> DNA

<213> Synthesis

<400> 10

tatactgcag accaggctcg ccatcaacgg ggtc 34

<210> 11

<211> 34

<212> DNA

<213> Synthesis

<400> 11

gaccaagctt atccacggca tgaacgggat cgcc 34

<210> 12

<211> 34

<212> DNA

<213> Synthesis

<400> 12

gcgcaagctt gtccatcgtg aaggtgacca gacc 34

<210> 13

<211> 36

<212> DNA

<213> Synthesis

<400> 13

tatagcggcc gcgagatgga ctggcgcatc atgaag 36

<210> 14

<211> 35

<212> DNA

<213> Synthesis

<400> 14

gcacaagctt cgcgttctcg tcgacgttcg gccac 35

<210> 15

<211> 35

<212> DNA

<213> Synthesis

<400> 15

tatagaattc ccgtcgcgcg gtccaccggc atcgg 35

<210> 16

<211> 35

<212> DNA

<213> Synthesis

<400> 16

gcgcgaattc catgttgagc aggacggcct tctgc 35

<210> 17

<211> 35

<212> DNA

<213> Synthesis

<400> 17

atcgggatcc cgtcgaggtg gtagtaggtc tcggc 35

<210> 18

<211> 37

<212> DNA

<213> Synthesis

<400> 18

tagcctgcag aaatgaacga caacccgatc gacctgt 37

<210> 19

<211> 35

<212> DNA

<213> Synthesis

<400> 19

gcgcaagctt tcaagaaccc atgagctcag ttgcg 35

<210> 20

<211> 42

<212> DNA

<213> Synthesis

<400> 20

gtgaaagctt gagaaggaga tataatgaac gacaacccga tc 42

<210> 21

<211> 38

<212> DNA

<213> Synthesis

<400> 21

aattgttaac tcaagaaccc atgagctcag ttgcggag 38

<210> 22

<211> 1533

<212> DNA

<213> New golden Mycobacterium (Mycolicibacterium neoaurum)

<400> 22

tcaggccttt ccagcgagat gcaatgcggc gaggtagccg aaggtcatgg cgggcccgat 60

tgtgccaccc gggccgggat aggtgtgacc catcaccggc gagctgacat tgcctgccgc 120

atagaggcct tcgatcaccg aattgtcatc gcgcagcgcc cggccgtgca cgtcggtgcg 180

gatgccaccc ttggtgccca ggtcaccggg caccatcttc gcggcgtaga acgggccgtg 240

tttgatctcg ccgaggttcg ggttcggctt gttcgtcgga tcaccgtagt agcggtcgta 300

ggcgctctcg ccgcggtgga agtcctcgtc gacgccggac cgtgcgaaac cgttgaaccg 360

ttcgatggtg gccttcagcg cgtcggcggc cacaccggtc ttctcggcca gctcggccag 420

gctatcggcc ttgacgatga tgcccgattc catccacttc ttcgggatgc gttgtccggg 480

ttgcaatccc gcaaagatat agcgatcgcg gtactgctgg tcgaagatca tccaggcggg 540

cacgttctcg cccggcccgg cgccctggcc gtactgaccg ccgtacatgt ggtggcaggc 600

ctccacgtag ggcatcgatt cgttcatgaa ccgcttaccg ttcatgttga cgatgatcga 660

cccgggggag ttgcgctcgg aaagggcgaa ccacggggcg ccctccagcg ggacggtcgg 720

accccaccac gcgtcctcca tgagttccag tgccgcaccc agcttttcgg ctgccaggat 780

gccgtcaccg gtgttggcga cggcaccgac ggtccactcg gtggtgatgg gctggcgctg 840

gtacttggtg cgcatctcct ggttgtgttc gaaaccgccc gaaccgagga tcacgcccct 900

gcgggcccgg atcagcttcg gctcggcaga ctcgggggca ccggcctcgc gaacgtagat 960

tccgcgcacc accccgtcct cgatgtacag gtcggtcagc gcggtgttca gcagcaccgg 1020

caccccggcc ttctgcagac cgatgcgcag cggcgcgatg agcgcccggc ccatgccgac 1080

caggttcttg ccggtggcgt tggcccacac cgatcgcaca cccaccttga tgctgcgtag 1140

cacgccgcgc gggtgacgct tgagctggtt gagccggaca tagtcctgtt gcagtaccac 1200

catgttcagc ggcaccttgc cgtacggcgg ttcgagcccc ttctcgtcgg gaccgagctt 1260

cttggcgttg aacggcttcg gctcgaccga gcggccggtg gccttaccgc ccggcgtctc 1320

cgggtagtag tcggagtagc cgggaaccca gcacagcttc agcggcgagt tcttcagcac 1380

gaacgacaac atctccggac tgcggtccag gtaggtgtcg atcttctcgg caggcaccac 1440

atcgccgatg atggcgtgca ggtacttccg tgcctccgcg gcggtgtctt tgaccccgtc 1500

acgctgaaga acctcgttgt tgggaatcca cac 1533

<210> 23

<211> 32

<212> DNA

<213> Synthesis

<400> 23

tgcagaattc tcaggccttt ccagcgagat gc 32

<210> 24

<211> 32

<212> DNA

<213> Synthesis

<400> 24

agtaaagctt cctcgttgtt gggaatccac ac 32

<210> 25

<211> 25

<212> DNA

<213> Synthesis

<400> 25

gacaggtaaa agtcctggta gacgc 25

<210> 26

<211> 20

<212> DNA

<213> Synthesis

<400> 26

acgtcgcttt gttggctagc 20

Claims

1. The construction method of the genetically engineered strain for producing the sterol side chain incomplete degradation product is characterized in that the genetically engineered strain is formed by metabolic engineering of microorganisms, and the construction method of the genetically engineered strain comprises the following steps:

1) Selecting a microorganism that is degradable for sterol conversion, said microorganism being a novel mycobacterium aurum capable of converting phytosterols to produce androsta-4-ene-3, 20-dione, androsta-1, 4-diene-3, 20-dione and/or 9α -hydroxy-AD;

2) For the igr operon in microorganisms, for the sameltp2Carrying out inactivation knockout on the gene;

3) For key genes in sterol metabolic pathwayshsd4A、chsE1、chsE2Performing over-expression;

wherein, the genetically engineered strain after metabolic engineering transformation can be used for producing and obtaining pregna-4, 17 (20) -diene-20-carboxylic acid and corresponding methyl ester PDC-M, pregna-1,4,17 (20) -triene-20-carboxylic acid and corresponding methyl ester PDC-M through plant sterol transformation ¹ PDC-M, 9α -hydroxy-PDC and their corresponding methyl esters 9α -OHPDC-M.

2. The method of constructing as claimed in claim 1, wherein the genechsE1、chsE2、ltp2The nucleotide sequences of (2) are shown as SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 5.

3. A genetically engineered strain for producing a series of sterol side chain incomplete degradation products, characterized in that it is constructed by the construction method of the genetically engineered strain according to any one of claims 1-2.

4. A method for preparing a sterol side chain incomplete degradation product, which is characterized in that a genetic engineering strain constructed by the construction method according to any one of claims 1-2 is prepared by the following two methods: 1) Adding plant sterol in the process of culturing and growing in a fermentation conversion mode, or 2) converting plant sterol in a resting cell conversion mode to prepare PDC, PDC-M and delta ¹ -PDC、△ ¹ -any one of the six products PDC-M, 9α -OHPDC-M.

5. According to claim 4The preparation method is characterized in that the genetically engineered strain can transform plant sterol to obtain PDC-M and PDC, and the genetic engineering strain can transform plant sterol to obtain PDC-M and PDC ¹ PDC-M and delta ¹ -any one of the three combinations PDC, 9α -OHPDC-M and 9α -OHPDC.