CN107099498B - Recombinant strain and application thereof and method for preparing 9-fluorine steroid hormone precursor - Google Patents

Abstract

The invention relates to the technical field of genetic engineering, and discloses a recombinant strain, application thereof and a method for preparing a 9-fluorine steroid hormone precursor. The recombinant strain of the invention is transformed in mycobacteria or Escherichia coli with a vector containing kstD, kstD3 and kstD_MA plasmid containing one or more than two genes; or kstD, kstD3, kstD integrated into the genome of Mycobacterium or Escherichia coli_MOne or more than two genes. The invention introduces exogenous genes kstD, kstD3 and kstD_MThe recombinant mycobacterium or escherichia coli is constructed, the recombinant strain cell lysate is used for producing steroid precursor, the obtained 9 β,11 β -epoxy-17 α, 21-dihydroxy-16 β -methyl pregna-1, 4-diene-3, 20-diketone has extremely high conversion rate, the reaction mechanism of biotransformation is clarified, and a theoretical basis is provided for future industrial production.

Description

Recombinant strain and application thereof and method for preparing 9-fluorine steroid hormone precursor

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a recombinant strain, application thereof and a method for preparing a 9-fluorine steroid hormone precursor.

Background

The second broad class of drugs behind steroid hormone drugs as antibiotics is widely used in the treatment and prevention of many diseases, such as anti-inflammatory, diuretic, contraceptive, progestational, antiandrogen and anticancer agents, among others. The high demand of steroid has led to the vigorous development of another important industry, the extraction and preparation of steroid intermediates (steroid precursors). The process for preparing the steroid precursor by the microbiological method has the outstanding advantages of small environmental pollution, few reaction steps, low product loss, high yield and the like, and is widely applied to industrial production. In recent years, various pharmaceutical intermediates have been obtained by carrying out reactions such as dehydrogenation, oxidation, hydroxylation, and side chain cleavage of steroids by microbial biotransformation.

For example, 9 beta, 11 beta-epoxy-17 alpha, 21-dihydroxy-16 beta-methyl pregna-1, 4-diene-3, 20-dione (formula IV) is a key precursor for producing 9-fluoro steroid hormones (such as dexamethasone, betamethasone, triamcinolone and the like), and synthesis of IV by using 9 beta, 11 beta-epoxy-17 alpha, 21-dihydroxy-16 beta-methyl pregna-4-ene-3, 20-dione-21-acetate (formula I) as a substrate is an important method for industrial production of IV. However, no studies on the biotransformation of 9(11) -epoxy steroids have been reported, and the reaction mechanism has not been fully elucidated.

At present, the biotransformation of steroids is mostly based on genetically engineered microorganisms or isolated and purified enzyme catalysis. The methods can improve the conversion rate of the steroid compounds to a certain extent, but the key problems of poor solubility of steroid substrates, bacterial contamination in the microbial fermentation process and high cost of enzyme separation and purification are the key problems which restrict the industrial application of the steroid substrates.

Disclosure of Invention

In view of the above, the present invention aims to provide a recombinant strain, which enables the recombinant mycobacterium to significantly improve the conversion rate of 9 β,11 β -epoxy-17 α, 21-dihydroxy-16 β -methylpregna-1, 4-diene-3, 20-dione;

another object of the present invention is to provide the use of said recombinant strain for the production of 9 β,11 β -epoxy-17 α, 21-dihydroxy-16 β -methylpregna-1, 4-diene-3, 20-dione;

the third object of the present invention is to provide a method for producing 9 beta, 11 beta-epoxy-17 alpha, 21-dihydroxy-16 beta-methyl pregna-1, 4-diene-3, 20-dione based on the recombinant strain.

In order to achieve the above purpose, the invention provides the following technical scheme:

a recombinant strain transformed with a strain comprising kstD, kstD3, kstD in Mycobacterium or Escherichia coli_MA plasmid containing one or more than two genes; or kstD, kstD3, kstD integrated into the genome of Mycobacterium or Escherichia coli_MOne or more than two genes.

Aiming at the lack of a method for synthesizing 9 β,11 β -epoxy-17 α, 21-dihydroxy-16 β -methyl pregn-1, 4-diene-3, 20-diketone (formula IV, hereinafter referred to as IV) by using 9 β,11 β -epoxy-17 α, 21-dihydroxy-16 β -methyl pregn-4-ene-3, 20-diketone-21-acetate (formula I, hereinafter referred to as I) as a substrate in the existing biological conversion process of steroid compounds, the invention expresses kstD, kstD3 and kstD in mycobacteria or escherichia coli by conversion_MThe plasmid of the gene is subjected to biotransformation by using cell lysate of a recombinant strain, and finally the steroid precursor IV with higher transformation rate is obtained.

Preferably, kstD3, kstD are used_MAll are derived from Mycobacterium neogold. In the specific implementation process of the invention, the kstD and kstD3 are both derived from Mycobacterium neoaurum ATCC 25795(kstD Genbank ID: GQ 476982, kstD3Genbank ID: KF 772210), and the sequences are respectively shown as SEQ ID NO.1 and SEQ ID NO. 2. The kstD_MDerived from Mycobacterium neoaurum NwIB-01 (kstD)_MGenbankID: GQ 228843) with the sequence shown in SEQ ID NO. 3.

The plasmid transformed in the present invention may be any one of various plasmids commonly used in the art, and in the practice of the present invention, the plasmid of pMV261 commercially available from Biosci is used.

In the specific implementation process of the invention, the Mycobacterium is Mycobacterium with the collection number of CGMCC No.13532, is classified and named as Mycobacterium sp, and is stored in the China general microbiological culture Collection center at 1/5 of 2017. The Escherichia coli is Escherichia coli BL21(DE), and can be purchased or constructed according to the conventional construction method in the field.

By adopting the cell lysate of the recombinant strain to convert the substrate I, the recombinant mycobacterium can obtain IV with at least 60 percent of conversion rate, and the highest conversion rate of IV can reach more than 90 percent after the pH value of a buffer solution of a reaction system is optimized. The recombinant Escherichia coli can obtain IV with at least 45% of conversion rate, and the highest conversion rate can reach about 80%.

Based on the excellent technical effects, the invention provides the application of the recombinant strain or/and the cell lysate thereof in the preparation of 9 beta, 11 beta-epoxy-17 alpha, 21-dihydroxy-16 beta-methyl pregna-4-ene-3, 20-dione-21-acetate as a substrate to synthesize 9 beta, 11 beta-epoxy-17 alpha, 21-dihydroxy-16 beta-methyl pregna-1, 4-diene-3, 20-dione.

Meanwhile, based on the excellent performance of the recombinant strain in biotransformation, the present invention also provides a method for preparing a 9-fluoro steroid hormone precursor (i.e., IV), comprising:

step 1, preparing cell lysate of the recombinant strain;

and 2, adding a substrate 9 beta, 11 beta-epoxy-17 alpha, 21-dihydroxy-16 beta-methyl pregn-4-ene-3, 20-diketone-21-acetate into the cell lysate in the step 1 to react to obtain beta, 11 beta-epoxy-17 alpha, 21-dihydroxy-16 beta-methyl pregn-1, 4-diene-3, 20-diketone.

Preferably, step 1 comprises:

step 1.1, carrying out propagation on the recombinant strain, then adding hydrocortisone for induction culture, collecting thalli, washing with a buffer solution (such as PBS) and carrying out heavy suspension;

and 1.2, ultrasonically crushing the resuspended thallus cells to obtain cell lysate of the recombinant strain.

In the specific implementation process of the invention, step 1.1 is as follows:

inoculating the recombinant strain into 5mL of liquid culture medium (10 g/L of glycerol, 10g/L of yeast extract, 1.5g/L of diammonium hydrogen phosphate, 0.5g/L of dipotassium hydrogen phosphate, 0.5g/L of monopotassium phosphate, 802.5 g/L of tween, 10g/L of anhydrous magnesium sulfate, 0.5g/L of ferrous sulfate, 0.2g/L of zinc sulfate and pH of 7.2-7.3), adding 1 to the solid culture medium5g/L agar powder) at 30 ℃ overnight, then transferred to 50mL of fresh liquid medium, cultured at 30 ℃ at 200r/min to OD₆₀₀0.5-0.6, adding hydrocortisone with final concentration of 0.1g/L, inducing at 30 deg.C and 200r/min for 24 hr, collecting thallus, washing with PBS buffer, and resuspending to OD₆₀₀Is 2.0.

In the specific implementation process of the invention, the pH value of the buffer solution is 6, 6.5, 7, 7.5 or 8, and the PBS buffer solution can adopt KH₂PO₄/K₂HPO₄The pH of the PBS buffer was controlled by adjusting the ratio of the two buffers. In pH tests, it was found that the pH of the buffer had a significant effect on the conversion, with the highest conversion being at pH 7.5.

In the specific implementation process of the invention, the step 1.2 is as follows:

and (3) carrying out ultrasonic disruption on the resuspended thallus cells under the power of 500W in a manner of 5s intermittent 5s per disruption time for 20min, and carrying out ice operation in the whole process to obtain a cell lysate of the recombinant strain.

Preferably, step 2 is:

adding substrates 9 beta, 11 beta-epoxy-17 alpha, 21-dihydroxy-16 beta-methyl pregn-4-ene-3, 20-dione-21-acetate, PMS (phenazine methyl sulfate) and cosolvent (such as ethanol, N-dimethylformamide, Tween 80 or Tween 20) into the cell lysate in the step 1, and reacting on a shaking table to obtain beta, 11 beta-epoxy-17 alpha, 21-dihydroxy-16 beta-methyl pregn-1, 4-diene-3, 20-dione.

In the specific implementation process of the invention, the step 2 is as follows:

adding a substrate 9 beta, 11 beta-epoxy-17 alpha, 21-dihydroxy-16 beta-methylpregn-4-ene-3, 20-dione-21-acetate with a final concentration of 1g/L, 2.5mM PMS and 7% ethanol into the cell lysate in the step 1, and carrying out reaction on a shaker at 30 ℃ and 200r/min to obtain beta, 11 beta-epoxy-17 alpha, 21-dihydroxy-16 beta-methylpregn-1, 4-diene-3, 20-dione.

In addition, the present invention also determines for the first time the reaction mechanism of the conversion from the substrate I to the product IV by experimentation (the contents of the present application are not common knowledge and prior art), and the present invention speculates that the following two reaction pathways may exist for the conversion from the substrate I to the product IV before the correct reaction mechanism is confirmed:

experiments prove that the substrate I is firstly converted into II and then converted into the product IV during biotransformation.

As can be seen from the above technical scheme, the invention introduces exogenous genes kstD, kstD3 and kstD_MThe recombinant mycobacterium or escherichia coli is constructed, the recombinant strain cell lysate is used for producing steroid precursor, the obtained 9 β,11 β -epoxy-17 α, 21-dihydroxy-16 β -methyl pregna-1, 4-diene-3, 20-diketone has extremely high conversion rate, the reaction mechanism of biotransformation is clarified, and a theoretical basis is provided for future industrial production.

Biological material preservation information description

MS136, classified and named as Mycobacterium sp, is preserved in China general microbiological culture Collection center at 1 month and 5 days in 2017, and is deposited at the microbial research institute of China academy of sciences, No. 3 West Lu 1 of the North Chen of the south-oriented region of Beijing city, and the preservation number is CGMCC No. 13532.

Drawings

FIG. 1 is a schematic diagram showing the construction of recombinant plasmid pMV 261-kstD;

FIG. 2 shows kstD, kstD3 and kstD_MThe result is verified by agarose gel electrophoresis; wherein lanes 1-3 correspond sequentially to kstD, kstD3, and kstD_M；

FIG. 3 is a graph showing a comparison of the conversion rates of an emerging strain and a recombinant strain of Mycobacterium;

FIG. 4 is a graph showing a comparison of transformation rates of recombinant Escherichia coli;

FIG. 5 shows the effect of pH on the conversion of product IV;

FIG. 6 is a graph showing the product formation of the Mycobacterium derived feeder cell lysate transformation IV;

FIG. 7 is a graph showing the production of transformed cells of a cell lysate of a Mycobacterium starting strain;

FIG. 8 is a graph showing the formation of the product of phosphate buffer conversion I;

FIG. 9 shows the product generation curves for transformation I and II of Mycobacterium cell lysates.

Detailed Description

The invention discloses a recombinant strain, application thereof and a method for preparing a 9-fluorine steroid hormone precursor, and a person skilled in the art can realize the preparation by properly improving process parameters by referring to the content. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. The strains, methods and uses of the present invention have been described in terms of preferred embodiments, and it will be apparent to those of ordinary skill in the art that variations or modifications, and appropriate variations and combinations of the strains, methods and uses described herein can be made to practice and use the techniques of the present invention without departing from the spirit and scope of the invention.

The invention is further illustrated by the following examples.

Example 1: construction of recombinant plasmid

1、kstD、kstD3、kstD_MSynthesis of genes

The three genes were synthesized by Genewiz, and the vectors were named pUC57-kstD, pUC57-kstD3, pUC57-kstD, respectively, using commercial plasmid pUC57 as a carrier vector_M。

2. Recombinant plasmids pMV261-kstD, pMV261-kstD3 and pMV261-kstD_MConstruction of

As shown in FIG. 1, each target gene fragment was amplified, purified and recovered using the primers shown in Table 1, using pMV261-kstD as an example and the synthetic plasmid pUC57-kstD as a template. The resulting PCR product kstD gene fragments were assembled separately with linearized pMV261 vector (HindIII and BamHI restriction enzymes) by Gibson assembly seamless method to construct recombinant plasmid pMV261-kstD, placing the gene fragments under the control of hsp60 promoter. Recombinant plasmids pMV261-kstD3 and pMV261-kstD_MThe construction method is the same.

TABLE 1 PCR primer Table

Primers	Sequences(5’-3’)
		kstD-F	CCCGATCCGGAGGAATCACGGATCCATGACCACCGAAACCGCTGG
kstD-R	AACTACGTCGACATCGATAAGCTTTTAAGACGGCTGAGCAGATTC
		kstD3-F	CCCGATCCGGAGGAATCACGGATCCATGTCTGACTCTGACCTGGAATTC
kstD3-R	TAACTACGTCGACATCGATAAGCTTTTATTCAGCAGAAGACTGGGTAGC
		kstDM-F	CCCGATCCGGAGGAATCACGGATCCATGTTCTACATGACCGCTCAGG
kstDM-R	TAACTACGTCGACATCGATAAGCTTTTAAGCTTTACCAGCCAGGTGC
		pMV261-F	CAGCGAGGACAACTTGAGCCGT
pMV261-R	ACATCAGAGATTTTGAGACACA

3. Verification of recombinant plasmids

kstD, kstD3 and kstD_MThe gene lengths of the two genes are 1200bp, 1560bp and 1713bp respectively, the synthesized plasmid is used as a template to carry out amplification PCR, the product is detected by 1 percent agarose electrophoresis, three obvious specific bands (figure 2) can be seen below 2000bp and are consistent with the size and the position of a target fragment, the target gene is connected to a carrier pMV261 and is transferred into E.coli DH5 α, and recombinant plasmids pMV261-kstD, pMV261-kstD3 and pMV261-kstD are extracted_MPlasmid sequencing primers pMV261-F and pMV261-R are adopted to carry out PCR verification and sequencing verification, and the result shows that each recombinant plasmid is successfully constructed.

Example 2: construction of recombinant strains

1. Construction of recombinant Mycobacteria

The thalli is washed with sterile water for 2 times, centrifuged at 5000r/min and finally resuspended in sterile water. The recombinant plasmids pMV261-kstD, pMV261-kstD3 and pMV261-kstD were separately transformed by the electrotransformation method_MIntroducing a host strain Mycobacterium sp.MS136 with the preservation number of CGMCC No.13532, and performing electrotransformation conditions: the voltage is 1.8kV, the aperture of the electric shock cup is 1mm, and electric shock is carried out twice; confirming shock frequency (4-5ms)^-1Scope, competence after electric shock treatment was placed on ice for 5min, transformants were selected using kanamycin-resistant plates at a final concentration of 50. mu.g/ml, to obtain three recombinant Mycobacteria MS136-kstD, MS136-kstD3, MS136-kstD_M。

2. Construction of recombinant Escherichia coli

The method is the same as 1, and the host strain is replaced by Escherichia coli BL21(DE3) to obtain three recombinant Escherichia coli BL21(DE3) -kstD, BL21(DE3) -kstD3, BL21(DE3) -kstD_M。

Example 3: preparation of cell lysate of recombinant Strain

Each of the recombinant strains obtained in example 2 was inoculated into 5mL of a liquid medium (10 g/L of glycerol, 10g/L of yeast extract, 1.5g/L of diammonium hydrogen phosphate, 0.5g/L of dipotassium hydrogen phosphate, 0.5g/L of potassium dihydrogen phosphate, 802.5 g/L of Tween, 10g/L of anhydrous magnesium sulfate, 0.5g/L of ferrous sulfate, 0.2g/L of zinc sulfate, pH 7.2 to 7.3; 15g/L of agar powder was added to a solid medium) and cultured overnight at 30 ℃ and then transferred to 50mL of a fresh liquidCulturing in culture medium at 30 deg.C and 200r/min to OD₆₀₀0.5-0.6, adding hydrocortisone with final concentration of 0.1g/L, inducing at 30 deg.C and 200r/min for 24 hr, collecting thallus, and culturing with PBS buffer (KH) with pH of 6-8₂PO₄/K₂HPO₄) Washed and resuspended to OD₆₀₀Is 2.0.

And (3) ultrasonically crushing the resuspended thallus cells under the power of 500W, performing the ultrasonic crushing in a manner of intermittent 5s every 5s, performing operation on ice for 20min in the whole process, and repeating the ultrasonic operation if the crushed cells are turbid to obtain a cell lysate of the recombinant strain.

Example 4: biotransformation assay of recombinant Strain cell lysates

1. Reaction process

To each cell lysate of example 3, 9 β,11 β -epoxy-17 α, 21-dihydroxy-16 β -methylpregn-4-ene-3, 20-dione-21-acetate as a substrate at a final concentration of 1g/L, 2.5mM PMS and 7% ethanol were added, and the reaction was carried out on a shaker at 30 ℃ and 200r/min to obtain β,11 β -epoxy-17 α, 21-dihydroxy-16 β -methylpregn-1, 4-diene-3, 20-dione.

2. Detection of substrate I, transition products II/III and product IV

After the reaction solution is mixed evenly, a proper amount of the reaction solution is quickly absorbed, diluted by a diluent (acetonitrile: water is 5: 5) by 10 times, filtered by a filter membrane with the diameter of 0.25 mu m, and the filtrate is taken to be detected by an ultraviolet liquid phase. Chromatographic conditions are as follows: a chromatographic column: BDSHYPERSIL C18 column (150 mm. times.4.6 mm, 5 μm); a detector: waters 2489 UV/Vis; a pump: waters e 2695; mobile phase: 3: 7 of acetonitrile and water; column temperature: 40 ℃; the detection wavelength is 240 nm; the flow rate was 1.2 ml/min. The quantitative method comprises the following steps: and (3) measuring a standard solution of the standard substance by using the same chromatographic conditions, drawing a concentration-peak area standard curve, and quantifying the target substance in the reaction solution. The conversion rate of the product is obtained by dividing the number of moles of the product by the number of moles of the substrate.

3. Results

For the Mycobacterium recombinant strains MS136-kstD, MS136-kstD3, MS136-kstD_MThe transformation characteristics of the cell lysate were studied, and the transformation efficiency of the lysate to I was examined and determined by HPLCThe production of product IV was also controlled by the cell lysate of the starting strain (i.e.MS 136) into which the pMV261 blank vector was introduced. As shown in FIG. 3, after 1g/L of substrate I was reacted in a lysate of Mycobacterium cells at pH 7.0(PBS pH) for 45 hours, recombinant strains MS136-kstD, MS136-kstD3 and MS136-kstD were obtained_MThe conversion rates of IV are respectively 60.6%, 69.5% and 78.4%, and the conversion rate of the starting strain IV is 56.8%, and is increased by 38.9% at most. The above data indicate overexpression of the kstD gene (especially kstD)_M) And then, a large amount of IV can be accumulated, and the conversion rate is obviously improved.

For Escherichia coli recombinant strains BL21(DE3) -kstD, BL21(DE3) -kstD3, BL21(DE3) -kstD_MThe transformation characteristics of the cell lysate were studied, the transformation efficiency of the lysate to I was examined, and the production of product IV was determined by HPLC. As shown in FIG. 4, after 1g/L of substrate I had been reacted for 45 hours in E.coli cell lysates at pH7.5(PBSpH value), recombinant strains BL21(DE3) -kstD, BL21(DE3) -kstD3, BL21(DE3) -kstD_MThe conversions of IV were 48.7%, 71.6% and 79.5%, respectively. Coli BL21(DE3) does not convert substrate I into product IV by itself, whereas the recombinant E.coli of the present invention can achieve biotransformation with high conversion rate.

Example 5: effect of the pH value of the recombinant Strain cell lysate

The conversion of substrate I is effected by the different pH of the buffer used in the preparation of the cell lysate of the recombinant strain. This example compares recombinant strain MS136-kstD_MIV conversion rates at cell lysates pH 6, 6.5, 7, 7.5, and 8, respectively, under reaction conditions of 1g/L substrate charge for 45h (see example 4). As can be seen from FIG. 5, the optimum pH is 7.5, at which point the IV conversion reaches 92.8%.

Example 6: mechanism study of substrate I conversion to product IV

1. Comparing the Whole cell transformation method with the cell lysate transformation method

(1) Whole cell transformation method:

mycobacterium sp.MS136 (non-recombinant) cells were inoculated into 5ml of liquid medium and cultured overnight at 30 ℃. Transfer to another 250ml conical flask containing 50ml liquid mediumCulturing in a bottle at 30 deg.C and 200r/min for 5h (OD)₆₀₀Reaching 0.5-0.6), adding inducer hydrocortisone with final concentration of 0.1g/L, and culturing at 30 deg.C for 24h at 200 r/min. Centrifuging at 10000 rpm for 5min to collect thallus, washing with 0.2M Phosphate Buffer Solution (PBS) with pH 7.0 twice, and resuspending thallus to OD₆₀₀Up to 2.0. 50ml of the cell suspension was transferred to a 250ml Erlenmeyer flask, and 1g/L of I, 2.5mM PMS and 7% ethanol were added thereto, followed by reaction at 30 ℃ and 200 r/min.

(2) Cell lysate transformation method:

reference is made to the procedures of examples 3 and 4, with the difference that the starting strain, Mycobacteriumsp.MS136, is used without recombination.

(3) Results

In Table 2, 1g/L of substrate I is transformed by using a whole cell of mycobacterium MS136 and reacted for 45 hours, the amount of the substrate I is only 5 percent, the transformation rate of a product II is 60.3 percent, and the accumulation of a product IV cannot be detected in a reaction system; it was shown that the M.tuberculosis MS136 strain could hydrolyze the substrate I and then metabolize it further, resulting in the accumulation of the product IV. And the cell lysate is converted into 1g/L of substrate I for reaction for 45 hours, the residual amount of the substrate I is 20 percent, and the conversion rate of a product IV in the reaction system is 56.8 percent. As can be seen from FIG. 6, after 1g/L of substrate IV reacted in the cell lysate for 45 hours, 0.94g/L of IV remained, indicating that when IV was used as the substrate, the cell lysate could not degrade it further.

TABLE 2 transformation of Whole cells with cell lysates using I as substrate

Transformation for 45h	Whole cell transformation method	Cell lysate transformation method
			Ⅰ(g/L)	0.052	0.204
Ⅱ(g/L)	0.519	0.054
			Ⅲ(g/L)	NT	NT
Ⅳ(g/L)	NT	0.485

2. Study of the reaction mechanism of conversion of substrate I by Mycobacterium cell lysate

(1)1g/L of substrate I is reacted in a mycobacterial cell lysate with the pH value of 7.0, and samples are taken at 2h, 5h, 10h, 21h, 33h, 45h and 76h respectively to detect the generation condition of the product. As shown in FIG. 7, the product IV increased with time, the conversion reached a maximum of 56.8% for 45h IV and the conversion for II was always lower. No III was detected in the product, indicating that the reaction sequence for transforming I from the Mycobacterium cell lysate is I, II, IV.

(2)1g/L of substrate I was reacted in PBS at pH 7.0, with only formation of product II, and after 45h, the conversion of II was 6.7% (see FIG. 8). It is shown that the conversion of I to II (C-21 deacetylation) proceeds spontaneously and that the conversion of II to IV (C)_1,2Dehydrogenation) is a catalytic action that requires mycobacteria or recombinant bacteria of the invention.

(3) The mycobacterial cell lysates were bioconverted with I and II as substrates, respectively, and as shown in FIG. 9, the 45h IV conversion rates were almost identical (56.8% and 57.3%, respectively).

The above data show that in the reaction of transforming I in the lysate of Mycobacterium cells: 1) the reaction sequence is that the I is spontaneously hydrolyzed to form II, and the II is catalyzed to be IV; 2) the catalytic reaction of C1,2 from II to IV is the key step.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

SEQUENCE LISTING

<110> Tianjin university

<120> a recombinant strain, application thereof and method for preparing 9-fluorine steroid hormone precursor

<130>MP1708696

<160>3

<170>PatentIn version 3.3

<210>1

<211>1200

<212>DNA

<213> Artificial sequence

<400>1

catatgatga ccaccgaaac cgctggtatc cgtgaaatcg acaccggtga cctgccggac 60

cgttacgctc gtggttggca ctgcctgggt ccggttaaag actacctgga cggtaaacca 120

cacggtgttg aaatcttcga cactatgctg gttgtgttcg cagactctga aggtgaactg 180

aaagttctgg acggttactg ccgtcacatg ggtggtaacc tggctcaggg taccatcaaa 240

ggtgacaccg ttgcttgccc gttccacgac tggcgttggg gtggtgacgg taaatgcaaa 300

ctggttccgt acgctaaacg taccccgcgt ctggctcgta cccgtgcttg gcacaccgac 360

gttcgtggtg gtctgctgtt cgtttggcac gaccacgaag gtaacccgcc gcagccggaa 420

gttcgtatcc cggaaatccc ggaattcgct tctgacgact ggaccgactg gcgttggaac 480

accatgctga tcgaaggttc taactgccgt gaaatcatcg acaacgttac cgacatggct 540

cacttcttct acatccacta cggtctgccg acctacttca aaaacgtttt cgaaggtcac 600

atcgcttctc agtacctgca caacgttggt cgtccggacg ttaacgacct gggtaccacc 660

tacggtgaag ctcacctgga ctctgaagct agttacttcg gtccgtcttt catgatcaac 720

tggctgcaca acaactacgg tggtttcaaa gctgaatcta tcctgatcaa ccgtcactac 780

ccggtttcgc aggacagctt cgttctgcag tggggtgtta tcgttgaaaa accgaaaggt 840

ctggacgaaa aaaccaccga caaactggct cgtgttttca cagagggtgt aagcaaaggt 900

ttcctgcagg acgttgaaat ctggaaacac aaaacccgta tcgacaaacc gctgctggtt 960

gaagaagacg gtgctgttta ccagatgcgt cgttggtacc agcagttcta cgttgacgtt 1020

gctgacgtta ccccggacac caccgaccgt ttcgaaatgg aagttgacac caccatcgct 1080

aacgaaaaat ggcacgttga agttgaagaa aacctgaaac tgcagcagga cgctgctgaa 1140

caggacgctg ctgaacaggg tgaaccgcag aaagaatctg ctcagccgtc ttaaggatcc 1200

<210>2

<211>1560

<212>DNA

<213> Artificial sequence

<400>2

catatgatgt ctgactctga cctggaattc gacgttatcg ttgctggttc tggtggtggt 60

ctggctggtg cttacaccgc tgctcgtgaa aacctgtctg ttctgctggt tgaagctacc 120

gacctgttcg gcggcaccac cagcttctct ggtggtggcg gtatgtggtt cccgtgcaac 180

ccggttctgc agcgtgctgg taccgacgac accatcgaca aagctctgac ctacttccac 240

gctgttgttg gtgaacgtac cccgcgtgaa ctgcaggacg cttacgttcg tggtggtgct 300

aaactgatcg aatacctgga acaggacccg gctttcgaat tcaccgctct gccgtggccg 360

gactactacg gtaccgctcc ggaagctcgt accgacggtt accgtcacac catcccgctg 420

ccggttccgg acgctgctct gggtaaatac gctggtctgg ttcgtggtcc gctggacacc 480

gaacgtctgg gtgctgaagc tccggacctg ctggttggtg gtcgtgctct ggttggtcgt 540

ttcctggctg ctctggacaa actgccgacc gttacctgct ggctgaacgc tccgctggtt 600

gacctgatca ccgaaaacgg tcgtgttgtt ggtgctgtta tcgaacgtga cggtgctccg 660

gttcgtgtta ccacccgtcg tggtgttctg ctggcttctg gtggtttcga acagaacgct 720

gaaatgcgtg ctgaatacgg tgttccgggt cacgctaccg actctatggg tggtccgggt 780

tctaccggtc gtgctcaccg tgctgctatc gctgttggtg ctgacgttga cctgatggac 840

caggcttggt ggtctccggg tatgacccac ccggacggtc gttctgcttt cgctctgtgg 900

ttcaccggtg gtatcttcgt taaccagcag ggtcgtcgtt tcgttaacga atctgctccg 960

tacgaccgta tcggtcgtga catcatcgac cagatgcaga acggttctac ccgtctgccg 1020

ttctggatga tctacgacaa ccgtgacggt gacatcccgc cggttaaagc taccaacgtt 1080

tctatggttg aaccggaaaa ataccgtacc gctggtctgt ggcactctgc tgacaccctg 1140

gctgaactgg ctggtgctat cggtgttccg gctgctgaac tggaagctac cgttgctcgt 1200

tacaacgaac tggctgctac cggtatcgac gacgacttcg gtcgtggtgg tgaagcgtat 1260

gaccgtgcgt tctctggtgg tgagtctccg atggttccgc tggacacccc gccgtaccac 1320

gctgctgttt tcggtctgtc tgacctgggt accaaaggtg gtctgcgtac cgacacccac 1380

gctcgtgttc tggacgctga cggtgctgct atcccgggtc tgtacgctgc tggtaacacc 1440

atggctgctg tttctggtac cacctacccg ggtggtggta acccgatcgg tgcttctatg 1500

ctgttctctc acctggctgc tctggacatg gctacccagt cttctgctga ataaggatcc 1560

<210>3

<211>1713

<212>DNA

<213> Artificial sequence

<400>3

catatgatgt tctacatgac cgctcaggac tactctgttt tcgacgttgt tgttgttggt 60

tctggtgctg ctggtatggt tgctgctctg accgctgctc accagggtct gtctaccgtt 120

gttgttgaaa aagctccgca ctacggtggt tctaccgctc gttctggtgg tggtgtttgg 180

ataccgaaca acgaagttct gcagcgtgac ggtgttaaag acaccccggc tgaagctcgt 240

aaatacctgc acgctatcat cggtgacgtt gttccggctg aaaaaatcga cacctacctg 300

gaccgttctc cggaaatgct gtctttcgtt ctgaaaaact ctccgctgaa actgtgctgg 360

gttccgggtt actctgacta ctacccggaa accccgggtg gtaaagctac cggtcgttct 420

gttgaaccga aaccgttcaa cgctaaaaaa ctgggtccgg acgaaaaagg tctggaaccg 480

ccgtacggta aagttccgct gaacatggtt gttctgcagc aggactacgt tcgtctgaac 540

cagctgaaac gtcacccgcg tggtgttctg cgttctatca aagctggtgt tcgttctgtt 600

tgggctaacg ctaccggtaa aaacctggtt ggtatgggtc gtgctctgat cgctccgctg 660

cgtatcggtc tgcagaaagc tggtgttccg gttctgctga acaccgctct gaccgacctg 720

tacctggaag acggtgttgt tcgtggtatc tacgttcgtg aagctggtgc tccggaatct 780

gctgaaccga aactgatccg tgctcgtaaa ggtgttatcc tgggttctgg tggtttcgaa 840

cacaaccagg aaatgcgtac caaataccag cgtcagccga tcaccaccga atggaccgtt 900

ggtgctgttg ctaacaccgg tgacggtatc gttgctgctg aaaaactggg tgctgctctg 960

gaactgatgg aagacgcttg gtggggtccg accgttccgc tggttggtgc tccgtggttc 1020

gctctgtctg aacgtaactc tccgggttct atcatcgtta acatgaacgg taaacgtttc 1080

atgaacgaat ctatgccgta cgttgaagcg tgccaccaca tgtacggtgg tcagtacggt 1140

cagggtgctg gtccgggtga aaacgttccg gcttggatgg ttttcgacca gcagtaccgt 1200

gaccgttaca tcttcgctgg tctgcagccg ggtcagcgta tcccgaaaaa atggatggaa 1260

tctggtgtta tcgttaaagc tgactctgtt gctgaactgg ctgaaaaaac cggtctggct 1320

ccggacgctc tgaccgctac catcgaacgt ttcaacggtt tcgctcgttc tggtgttgac 1380

gaagacttcc accgtggtga atctgcttac gaccgttact acggtgaccc gaccaacaaa 1440

ccgaacccga acctgggtga aatcaaaaac ggtccgttct acgctgctaa aatggttccg 1500

ggtgacctgg gtaccaaagg tggtatccgt accgacgttc acggtcgtgc tctgcgtgac 1560

gacaactctg ttatcgaagg tctgtacgct gctggtaacg tttcttctcc ggttatgggt 1620

cacacctacc cgggtccggg tggtaccatc ggtccggcta tgaccttcgg ttacctggct 1680

gctctgcacc tggctggtaa agcttaagga tcc 1713

Claims (15)

1. A recombinant strain comprising kstD, kstD3, kstD transformed in a Mycobacterium or Escherichia coli strain_MA plasmid containing one or more than two genes; or kstD, kstD3, kstD integrated into the genome of Mycobacterium or Escherichia coli_MOne or more than two genes;

kstD sequence is shown as SEQ ID NO.1, kstD3 sequence is shown as SEQ ID NO. 2, kstD_MThe sequence is shown as SEQ ID NO. 3.

2. The recombinant strain of claim 1, wherein kstD, kstD3, kstD are present_MAll are derived from Mycobacterium neoaurum.

3. The recombinant strain of claim 2, wherein kstD and kstD3 are both derived from Mycobacterium neoformans neoaurum ATCC 25795.

4. The recombinant strain of claim 2, wherein kstD is as defined in claim 2_MIs derived from Mycobacterium neoaurum NwIB-01.

5. The recombinant strain of claim 1, wherein the plasmid is the pMV261 plasmid.

6. The recombinant strain of claim 1, wherein the mycobacterium is a mycobacterium with a collection number of cgmccno.13532.

7. The recombinant strain of claim 1, wherein the escherichia coli is escherichia coli BL21 (DE).

8. Use of a recombinant strain according to any one of claims 1 to 7 or/and a cell lysate thereof for the preparation of 9 β,11 β -epoxy-17 α, 21-dihydroxy-16 β -methylpregn-4-ene-3, 20-dione-21-acetate as a substrate for the synthesis of 9 β,11 β -epoxy-17 α, 21-dihydroxy-16 β -methylpregn-1, 4-diene-3, 20-dione.

9. A process for preparing a 9-fluoro steroid hormone precursor comprising:

step 1, preparing a cell lysate of the recombinant strain of any one of claims 1 to 7;

and 2, adding a substrate 9 beta, 11 beta-epoxy-17 alpha, 21-dihydroxy-16 beta-methyl pregn-4-ene-3, 20-diketone-21-acetate into the cell lysate in the step 1 to react to obtain beta, 11 beta-epoxy-17 alpha, 21-dihydroxy-16 beta-methyl pregn-1, 4-diene-3, 20-diketone.

10. The method of claim 9, wherein step 1 comprises:

step 1.1, carrying out propagation on the recombinant strain of any one of claims 1-7, then adding hydrocortisone for induction culture, collecting thalli, washing with a buffer solution and carrying out heavy suspension;

and 1.2, ultrasonically crushing the resuspended thallus cells to obtain cell lysate of the recombinant strain.

11. The method according to claim 10, wherein step 1.1 is:

the recombinant strain of any one of claims 1 to 7 inoculated in 5mL of liquid medium for 30 ℃ overnight culture, then transferred to 50mL of fresh liquid medium, at 30 ℃, 200r/min to OD₆₀₀0.5-0.6, adding hydrocortisone with final concentration of 0.1g/L, inducing at 30 deg.C and 200r/min for 24 hr, collecting thallus, washing with PBS buffer, and resuspending to OD₆₀₀Is 2.0.

12. The method of claim 10 or 11, wherein the buffer has a pH of 6, 6.5, 7, 7.5 or 8.

13. The method according to claim 10, wherein step 1.2 is:

and (3) carrying out ultrasonic disruption on the resuspended thallus cells under the power of 500W in a manner of 5s intermittent 5s per disruption time for 20min, and carrying out ice operation in the whole process to obtain a cell lysate of the recombinant strain.

14. The method of claim 9, wherein step 2 is:

adding a substrate 9 beta, 11 beta-epoxy-17 alpha, 21-dihydroxy-16 beta-methyl pregn-4-ene-3, 20-dione-21-acetic ester, PMS and a cosolvent into the cell lysate in the step 1, and reacting on a shaking table to obtain beta, 11 beta-epoxy-17 alpha, 21-dihydroxy-16 beta-methyl pregn-1, 4-diene-3, 20-dione.

15. The method of claim 14, wherein the substrate 9 β,11 β -epoxy-17 α, 21-dihydroxy-16 β -methylpregen-4-ene-3, 20-dione-21-acetate, 2.5mM PMS and 7% ethanol are added to the cell lysate in step 1 to a final concentration of 1g/L, and the reaction is performed on a shaker at 30 ℃ and 200r/min to obtain β,11 β -epoxy-17 α, 21-dihydroxy-16 β -methylpregen-1, 4-diene-3, 20-dione.

Images