CN109971817B - Preparation of Boldenone by Sequential Transformation of Arthrobacter simplex and Genetically Engineered Yeast Strains - Google Patents

Abstract

The invention relates to a production method of steroidal drugs, in particular to a method for sequentially fermenting and preparing boldenone steroidal compounds using Arthrobacter simplex and genetically engineered yeast strains. The present invention firstly provides a Pichia genetically engineered strain capable of efficiently expressing 17β carbonyl reductase, and secondly utilizes the above-mentioned Pichia genetically engineered bacteria to provide a method for sequentially transforming fermentation compound AD to prepare compound BD by microorganisms. After AD is first fermented by Arthrobacter simplex, the reaction system is inactivated, and then the compound Boldenone is prepared by sequential fermentation with Pichia pastoris genetically engineered strains.

Description

Preparation of Boldenone by Sequential Transformation of Arthrobacter simplex and Genetically Engineered Yeast Strains

Technical field:

The invention relates to a production method of steroidal drugs, in particular to a method for sequentially fermenting and preparing boldenone steroidal compounds using Arthrobacter simplex and genetically engineered yeast strains.

Background technique:

Boldenone (BD), also known as Boldenone, is a white or off-white crystalline powder with a molecular formula of C ₁₉ H ₂₆ O ₂ . Boldenone is a derivative of testosterone, so it inherits most of the properties of testosterone, and has male hormone ability and protein synthesis ability. Boldenone can keep the nitrogen balance of muscle fiber cells positive at any time, accelerate the synthesis of protein in muscle fiber cells, and expand the muscle fiber cells, which has a great effect on strengthening muscles and endurance of physical exercisers. For a long time, there are not many raw material manufacturers of Boldenone in China, and most of them are synthesized by chemical methods. The chemical method is not conducive to large-scale industrial production because of its cumbersome production steps, the use of toxic and harmful reagents, and high pollution. Therefore, how to replace chemical synthesis methods with biosynthetic pathways and establish efficient biosynthetic strategies are key issues to be solved urgently.

In recent years, most of the researchers' research on the synthesis of boldenone by microbial transformation has focused on the use of a single bacterial strain for catalysis, and the catalytic process still has problems such as low substrate concentration and insufficient conversion efficiency. Although Mucorracemosus, Nostocmuscorum, Arihrobacteroxydans and other microorganisms can use androst-1,4-diene-3,17-dione (ADD) as a substrate to produce BD through 17β carbonyl reduction, few of them BD can be synthesized directly using relatively cheap androst-4-ene-3,17-dione (AD) as a substrate. AD is the precursor substance for the synthesis of ADD. AD can be synthesized by the dehydrogenation of C1 and 2 positions of 3-sterone-△1-dehydrogenase (KsdD), and ADD can be converted into the target product BD by 17β carbonyl reduction. Although exogenous expression of fungal-derived KsdD protein in Pichia pastoris has been studied to obtain the product BD, but the 17β carbonyl reduction effect of Pichia pastoris itself is not strong enough, so its substrate dosage and BD production are not high.

So far, no microorganism has been found to have strong C1,2 dehydrogenation and strong 17β carbonyl reduction at the same time. Arthrobacter simplex has become a steroid C1,2 dehydrogenation reaction strain widely used in industrial production because of its high transformation efficiency and fast reaction rate; and the 17β carbonyl reductase derived from yeast has a strong 17β carbonyl Reduction. At present, there is no related research on the joint fermentation of BD produced by Arthrobacter simplex and yeast strains.

Invention content:

In order to solve the above problems, save costs and improve product yield, the present invention firstly provides a Pichia genetically engineered strain capable of efficiently expressing 17β carbonyl reductase, and secondly uses the above-mentioned Pichia genetically engineered bacteria to provide a microbial sequence transformation A method for preparing compound BD from compound AD, the method is to firstly ferment AD with Arthrobacter simplex, inactivate the reaction system, and then sequentially ferment the compound Boldenone through Pichia pastoris genetically engineered strains.

The Pichia genetically engineered strain is described in the overexpression of the gene encoding 17β carbonyl reductase in the Pichia host cell;

Preferably, the Pichia host cell is Pichia GS115;

Preferably, the 17β carbonyl reductase (GenBank number: KZV10489.1) encoding gene is ayr1 gene, Gene ID: 854682;

Preferably, the Pichia genetically engineered strain is Pichia pastoris (P.pastoris) GS115AYR1 _Sc , obtained by expressing the ayr1 gene shown in Gene ID: 854682 in Pichia pastoris GS115 through plasmid pPIC3.5K;

The method for the preparation of compound BD by the sequential conversion of the microorganisms from the fermented compound AD is as follows:

In the biotransformation system containing the substrate AD concentration of 3g/L-10g/L, add Arthrobacter simplex with C1,2 dehydrogenation ability with a biomass of 4-6g/L (wet weight), and the intermediate product After the amount of ADD reached the highest level, the reaction system was inactivated, and the compound Boldenone was prepared by sequential fermentation with 25-200g/L (wet weight) Pichia pastoris genetically engineered strain (Pichia pastoris) GS115AYR1 _Sc ;

Further, the biotransformation system is 50mM PBS buffer solution (pH 7.2);

Further, the fermentation time of Arthrobacter simplex is 25-50h, and the fermentation conditions are: 20-40°C, 150-250r/min;

Further, the inactivation condition of the reaction system is: 121°C, 20min;

Further, while adding Pichia pastoris, add glucose at a final concentration of 0-100g/L to the system;

Preferably, the glucose concentration is 75g/L;

Further, the fermentation time of the genetically engineered strain of Pichia pastoris is 2-4 hours, and the fermentation conditions are: 20-40°C, 150-250r/min;

Preferably, the Arthrobacter simplex is Arthrobacter simplex TCCC 11037;

Preferably, hydroxypropyl-β-cyclodextrin (HP-β-CD) is used as a substrate co-solvent in the biotransformation system, and its molar ratio to the substrate AD is 0-2:1;

Preferably, HP-β-CD is used as a substrate co-solvent, and its molar ratio to the substrate AD is 1:1;

After the above reaction is completed, the yield of BD in the fermentation system can reach 1.68-7.7g/L, and the yield can reach 56%-83%.

Beneficial effect:

(1) The present invention realizes for the first time the method for preparing compound BD by transforming AD with microbial co-fermentation, and makes the final yield of BD reach 83%, which achieves the purpose of improving the yield of compound BD, and has good application value and promotion prospect.

(2) The present invention can improve the coenzyme utilization rate in the reaction system, reduce the oxidation in the system, and improve the final conversion rate of BD.

(3) The microbial joint fermentation described in the present invention is simple and convenient, easy to realize, and has remarkable effect.

Description of drawings:

Figure 1 PCR analysis of recombinant plasmid pPIC3.5K-ayr1

Wherein, M: DL5000DNA Marker; 1, 2: pPIC3.5K-ayr1 _Sc PCR product;

Figure 2 Analysis of recombinant plasmid pPIC3.5K-ayr1 by BamHI and EcoRI double enzyme digestion

Among them, M: 1kbDNA Marker; 1, 2: pPIC3.5K-ayr1 _Sc double digestion product;

Figure 3 PCR verification of the P. pastoris GS115 genetically engineered strain containing the recombinant expression vector pPIC3.5K-ayr1

Among them, M: DL5000 DNA Marker; 1, 2: pPIC3.5K-ayr1 _Sc recombinant P. pastoris GS115 genome PCR product;

Figure 4 Simultaneous transformation of AD by Arthrobacter simplex and recombinant Pichia pastoris;

Figure 5 Transformation of recombinant Pichia pastoris to AD and ADD;

Figure 6 Effect of inactivation of Arthrobacter simplex on BD production.

Detailed ways:

The following examples will further describe the present invention, the following examples are only descriptive, not limiting, and can not limit the protection scope of the present invention.

Arthrobacter simplex (Arthrobacter simplex) TCCC 11037 of the present invention and Pichia pastoris genetically engineered bacterial strain (P.pastoris) GS115AYR1 _Sc are cultivated by conventional slant culture, seed culture and fermentation culture, obtain the wet thallus for biotransformation, the present invention is implemented as follows For example, if there is no special description, the method for obtaining the wet bacteria used is as follows:

Arthrobacter simplex TCCC 11037:

(1) Incline cultivation:

Incline medium: 1% glucose, 1% yeast extract, 2% agar, adjust the pH to 7.2;

Culture conditions: 32°C, 3-5 days;

(2) Seed cultivation:

Seed medium: 1% glucose, 1% corn steep liquor (supernatant), 0.5% peptone, 0.25% potassium dihydrogen phosphate, adjust the pH to 7.2;

Culture conditions: 32°C, 160r/min, 18 hours;

(3) Fermentation culture:

Fermentation medium: 1% glucose, 1% corn steep liquor (supernatant), 0.5% peptone, 0.25% potassium dihydrogen phosphate, adjust the inoculum size to 7.2, insert the seed liquid into the fermentation medium, 32°C, 200r/ At 16 hours, add ethanol-dissolved substrate AD to make the final concentration of the substrate in the fermentation broth 0.1%, induce Arthrobacter simplex cells to produce dehydrogenase, continue culturing for 8 hours, and the fermentation ends.

After the fermentation culture was finished, the fermentation culture liquid was centrifuged at 4°C at 5000×g for 10 min, the supernatant was discarded, and the centrifuged bacterial cells were washed twice with 0.05 mol/L PBS buffer (pH 7.2), 5000 Centrifuge at × g for 10 min, and collect the cells to obtain wet cells.

Pichia genetic engineering strain (P.pastoris) GS115AYR1 _Sc :

(1) Incline cultivation:

Slant medium: 1% yeast extract, 2% tryptone, 2% glucose, 2% agar powder;

Culture conditions: 30°C, 3-5 days;

(2) Seed cultivation:

Seed medium: 1% yeast extract, 2% tryptone, 2% glucose;

Culture conditions: 30°C, 200r/min, 20 hours;

(3) Fermentation culture

Fermentation medium: 1% yeast extract, 2% tryptone, 100mmol/L potassium phosphate (pH 6.0), 1.34% YNB (filter sterilized), 4×10 ^-5 biotin (filter sterilized), 0.5% methanol (sterilized by filtration);

Culture conditions: 30°C, 200r/min, culture for 4 days, add 0.5% methanol every 24h, induce Pichia pastoris to produce carbonyl reductase. After the fermentation culture was completed, the fermentation culture liquid was centrifuged at 4°C and 6000r/min for 10min, the supernatant was discarded, and the bacteria cells obtained by centrifugation were washed twice with 0.05mol/L PBS buffer (pH 7.2), centrifuged After 10 min, the cells were collected to obtain wet cells.

Preliminary research in the laboratory has shown that Arthrobacter simplex contains a powerful 17-hydroxy dehydrogenase, which will seriously affect the production of the final product BD. Therefore, the technical difficulty and key point of combined conversion lies in how to determine the appropriate catalytic sequence and catalytic method to obtain the maximum yield of the product BD. Compared with the dehydrogenation and hydroxylation reactions using the above two strains alone or at the same time, the present invention prepares the steroid compound BD through the sequential fermentation of the two strains, which greatly increases the total yield of the product, reduces energy consumption and production cycle, The production cost and labor force are reduced, and the requirements of scientific production are met.

The present invention will be further explained through specific embodiments below.

Example 1 Acquisition of 17β carbonyl reductase gene and construction of Pichia pastoris genetic engineering strain

(1) Acquisition of 17β carbonyl reductase gene ayr1

Using the Saccharomyces cerevisiae W303 genome as a template, amplify the 17β carbonyl reductase (GenBank number: KZV10489.1) encoding gene ayr1 (GeneID: 854682), design the primer pair as follows, and recover the PCR product with GelExtraction Kit (Omega, USA) , the recovered fragment was connected to the vector pPIC3.5K, the recombinant plasmid pPIC3.5K-ayr1 was constructed, and transformed into E.coli JM109 to obtain a genetically engineered strain containing the target gene. The bacterial liquid PCR verification and double enzyme digestion verification showed that the recombinant plasmid pPIC3.5K-ayr1 was successfully constructed (as shown in Figure 1 and Figure 2). By sequencing the above clones and comparing them with the obtained ayr1 sequence, the sequencing results were completely consistent with the target gene sequence.

Upstream primer: CGCGGATCCATGTCGGAGTTACAGTCACAACCTAA;

Downstream primer: CCGGAATTCCTAATCGTCCTTATTTCTTCTGTTTCG.

(2) Construction and screening of genetically engineered strains of 17β carbonyl reductase Pichia pastoris

(1) Preparation of Pichia Competent Cells:

① Cultivate Pichia pastoris GS115 in a 50mL centrifuge tube containing 5mL YPD overnight at 30°C;

②Take 0.1-0.5mL overnight culture, inoculate a 2L shake flask containing 500mL fresh medium, and grow overnight until OD600=1.3-1.5;

③Collect the cells by centrifugation at 1500g for 5min at 4°C, and suspend the cells with 500mL pre-cooled sterilized water;

④ Centrifuge as above, suspend the cells with 250mL pre-cooled sterile water;

⑤ Centrifuge as above, and suspend the cells with 20 mL of pre-cooled 1mol/L sorbitol;

⑥ Centrifuge as above, and suspend the cells with 1 mL of pre-cooled 1 mol/L sorbitol to a final volume of about 1.5 mL.

(2) Electrotransformation of Pichia pastoris competent cells:

After the extracted recombinant expression plasmid pPIC3.5K-ayr1 was linearized by SacI, the linearized product was purified by phenol:chloroform extraction and ethanol precipitation.

① Mix 80 μL of the above cells with 5-20 μg of linearized DNA, and transfer to a pre-cooled 0.2 cm electroporation cuvette;

② Place on ice for 5 minutes;

③Electric shock is performed according to the parameters of Saccharomyces cerevisiae recommended by the device used;

④ Immediately add 1 mL of pre-cooled 1mol/L sorbitol to the cup, and transfer the contents to a sterilized centrifuge tube;

⑤ Divide into 200-600μL aliquots and apply on the MD plate;

⑥Incubate the plate at 30°C until clones are produced.

Through genomic PCR identification of Pichia pastoris containing the recombinant expression vector pPIC3.5K-ayr1, it was confirmed that a Pichia pastoris genetically engineered strain (P. pastoris) GS115AYR1 _Sc expressing the ayr1 gene had been constructed. (As shown in Figure 3)

The establishment of embodiment 2 double bacterium sequence catalytic system

In the following examples, the effects of Pichia genetically engineered strains on AD or ADD, the simultaneous transformation and sequential transformation of Arthrobacter simplex and Pichia genetically engineered strains on the synthesis of BD, and the effects of simple Arthrobacter reaction systems were investigated respectively in the following examples. Effect of inactivation on BD synthesis.

Example 2-1

Pick a single clone of P. pastoris GS115AYR1 _Sc , a genetically engineered strain of Pichia pastoris, inoculate it into 30 mL of BMGY, shake at 30°C and 200 r/min until OD ₆₀₀ = 5-6; 30mL BMMY was used to resuspend the cells to induce expression; every 24h, add methanol to a final concentration of 0.5% to continue induction for 4d; add 5g/L substrate AD (or ADD) to the fermentation broth after induction 4d ) and HP-β-CD with a molar ratio of 1:1 to the substrate, 30°C, 200r/min to continue the transformation for 4 days, sample 1mL, ultrasonically extract an equal volume of ethyl acetate, and analyze by HPLC. As shown in FIG. 5 , after the Pichia genetically engineered strain P. pastoris GS115AYR1 _Sc growth cells transformed the substrates AD and ADD, the yields of the corresponding products TS (testosterone) and BD were 59% and 69%, respectively. This indicated that ADD was more suitable as a substrate for the reduction of 17β carbonyl in recombinant Pichia pastoris.

Example 2-2

Add the wet thallus of Arthrobacter simplex and Pichia genetically engineered strain P.pastoris GS115AYR1 _Sc to the 50mM PBS buffer solution (pH 7.2) reaction system simultaneously, so that the final concentration of Arthrobacter simplex is 5g/L (wet weight), The final concentration of Pichia pastoris genetically engineered strains was 175g/L (wet weight), and substrate AD with a final concentration of 5g/L and HP-β-CD with a molar ratio of 1:1 to the substrate were added to the reaction system, 30 °C, 200r/min continuous conversion for 30h. Samples were taken every 6 hours during the conversion process, ultrasonically extracted with an equal volume of ethyl acetate, and analyzed by HPLC. As shown in Figure 4, the yield of BD can reach 36%. But the formed BD could not exist in the system stably, and then the generation rate of BD decreased obviously; on the contrary, the accumulation of ADD continued to rise to more than 80% of the total system. Analyzing the reason, this may be due to the action of the endogenous 17β hydroxyl oxidase in Arthrobacter simplex in the dual-bacteria catalytic system, so the newly formed BD is further oxidized into ADD.

Example 2-3

Resuspend the prepared Arthrobacter simplex wet bacteria with 30mL 50mM PBS (pH7.2) buffer solution to a concentration of 5g/L, and add 5g/L of substrate AD and HP-β-CD at a molar ratio of 1:1 , after transforming at 34°C and 200r/min for 30h, directly add Pichia pastoris genetically engineered strain GS115AYR1 _Sc wet cells at a final concentration of 175g/L to the reaction system, and continue transforming at 30°C and 200r/min for 12h. Sampling was performed regularly during the conversion process, ultrasonic extraction with equal volume of ethyl acetate, and HPLC analysis showed that the yield of BD could reach 62.4%.

Example 2-4

Resuspend the prepared Arthrobacter simplex wet bacteria with 30mL PBS (pH7.2) buffer solution to a concentration of 5g/L, and add 5g/L of substrate AD and HP-β-CD at a molar ratio of 1:1 at the same time, After transformation at 34°C and 200r/min for 30h, the transformation system was deactivated at 121°C for 20min. Then, wet cells of Pichia genetically engineered strain GS115AYR1 _Sc at a final concentration of 175 g/L were added to the inactivated reaction system, and the transformation was continued at 30° C. and 200 r/min for 12 hours. During the conversion process, samples were taken regularly, an equal volume of ethyl acetate was ultrasonically extracted, and HPLC analysis showed that the yield of BD could reach 73%.

In Fig. 6, "control" is the transformation process of Example 2-3, and "inactivation" is the transformation process of Example 2-4. It can be seen from the comparison that the inactivation of Arthrobacter simplex helps to increase the yield of BD.

Example 2-5

Resuspend the prepared Arthrobacter simplex wet bacteria with 30mL PBS (pH7.2) buffer to a concentration of 5g/L, and add 5g/L of substrate AD and HP-β with a molar ratio of 1:1 to the substrate at the same time -CD, after transformation at 34°C and 200r/min for 30h, the transformation system was deactivated at 121°C for 20min. Then, Pichia pastoris genetically engineered strain GS115AYR1 _Sc wet thallus and 75 g/L glucose were added to the inactivated reaction system at a final concentration of 175 g/L (wet weight), and the transformation was continued at 30° C. and 200 r/min for 12 h. During the conversion process, samples were taken regularly, an equal volume of ethyl acetate was ultrasonically extracted, and HPLC analysis showed that the yield of BD could reach 83%.

Example 2 illustrates that the effect of sequential transformation of Arthrobacter simplex and Pichia genetically engineered strains to synthesize BD is better than simultaneous transformation of double bacteria and single bacterial transformation; during sequential transformation, the effect of increasing the sterilization procedure after completion of transformation of Arthrobacter simplex is better than indestructible Bacteria were directly transformed into Pichia pastoris; the effect of adding glucose in the reaction system was better than that without adding it.

Example 3 Microbial Sequential Conversion of Fermentation Compound AD to the Method for Preparation of Compound BD

In the biotransformation system containing 50mM PBS buffer solution (pH 7.2) with a substrate AD concentration of 3g/L, HP-β-CD was added with a molar ratio of 1:1 to the substrate, and a simple biomass of 5g/L was added. Arthrobacter TCCC 11037 wet cells, 20°C, 150r/min reaction for 30h, after the intermediate product ADD reached the highest amount, the reaction system was inactivated at 121°C for 20min, and then passed through the genetically engineered strain of Pichia pastoris with a wet weight of 25g/L (Pichia pastoris) GS115AYR1 _Sc was sequentially fermented for 2 hours at 25°C and 150r/min to prepare compound Boldenone;

After the above reaction, the yield of BD in the fermentation system can reach 1.68g/L, and the yield can reach 56%.

Example 4 Microbial Sequential Conversion of Fermentation Compound AD to the Method for Preparation of Compound BD

In the biotransformation system containing 50mM PBS buffer solution (pH 7.2) with a substrate AD concentration of 10g/L, HP-β-CD was added with a molar ratio of 1:1 to the substrate, and a simple biomass of 5g/L was added. Arthrobacter TCCC 11037 wet thalline, 35 ℃, 250r/min reaction 50h after the amount of intermediate product ADD reaches the highest, with reaction system 121 ℃, 20min inactivation, then add the Pichia genetically engineered bacterial strain of final concentration 200g/L ( Pichia pastoris) GS115AYR1 _Sc wet cells were sequentially fermented for 4 hours at 37°C and 250r/min to prepare the compound Boldenone, and at the same time adding yeast, glucose with a final concentration of 100g/L was added to the system;

After the above reaction, the yield of BD in the fermentation system can reach 7.7g/L, and the yield can reach 77%.

Claims (1)

1. A method for sequentially transforming the fermentation compound androst-4-ene-3,17-dione (AD) by microorganisms to prepare the compound Boldenone (BD), characterized in that the method is to first pass AD through Arthrobacter simplex After fermentation, the reaction system is inactivated, and then the compound Boldenone is prepared by sequential fermentation with Pichia pastoris genetically engineered strains; The genetic engineering strain of Pichia pastoris is obtained by overexpressing a gene encoding 17β carbonyl reductase in a Pichia pastoris host cell; The method is specifically as follows: In the biotransformation system containing the substrate AD concentration of 3g/L-10g/L, Arthrobacter simplex with a biomass of 5g/L and C1,2 dehydrogenation ability is added, and the intermediate product androsteroid After the amount of -1,4-diene-3,17-dione (ADD) reaches the highest level, inactivate the reaction system, and then add 175-200 g/L of Pichia pastoris genetically engineered strain ( Pichia pastoris ) GS115 AYR1 _Sc sequential fermentation to prepare compound Boldenone; The 17β carbonyl reductase GenBank number is: KZV10489.1; the host cell is Pichia GS115, and the Pichia pastoris genetically engineered strain ( Pichia pastoris ) is GS115 AYR1 _Sc ; The Arthrobacter simplex is Arthrobacter simplex TCCC 11037; Pichia pastoris was added to the transformation system while glucose 75 g/L was added; In the biotransformation system, hydroxypropyl-β-cyclodextrin is used as the substrate co-solvent, and the molar ratio of it to the substrate AD is 1:1-2:1.

Images