CN111575258B - Carbonyl reductase EbSDR8 mutant and construction method and application thereof - Google Patents
Carbonyl reductase EbSDR8 mutant and construction method and application thereof Download PDFInfo
- Publication number
- CN111575258B CN111575258B CN202010296172.3A CN202010296172A CN111575258B CN 111575258 B CN111575258 B CN 111575258B CN 202010296172 A CN202010296172 A CN 202010296172A CN 111575258 B CN111575258 B CN 111575258B
- Authority
- CN
- China
- Prior art keywords
- mutant
- ebsdr8
- carbonyl reductase
- seq
- aliphatic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01184—Carbonyl reductase (NADPH) (1.1.1.184)
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a carbonyl reductase EbSDR8 mutant, a construction method and application thereof, wherein the carbonyl reductase EbSDR8 has two-point combined mutation of 70 th asparagine and 137 th serine on the basis of an amino acid sequence shown as SEQ ID NO. 2; wherein, the 70 th asparagine is mutated into valine, the 137 th serine is mutated into phenylalanine, and the amino acid sequence of the mutant is shown in SEQ ID NO. 8. So that the carbonyl reductase EbSDR8 obtains mutation sites with higher activity, and the carbonyl reductase EbSDR8 has better catalytic activity for catalyzing and synthesizing aliphatic chiral secondary ketone.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a carbonyl reductase EbSDR8 mutant and a construction method and application thereof.
Background
Chiral alcohol and its derivative are important chiral intermediates and are widely used in synthesizing chiral medicine, chiral pesticide, liquid crystal material and other chemical products. The asymmetric reduction of the prochiral ketone is an important method for preparing optically active chiral alcohol, can theoretically convert 100% of substrate ketone into single enantiomer chiral alcohol, and has high industrial application value. Enzymes and microbial cells are widely focused as biocatalysts for efficiently preparing chiral alcohols, and biocatalysis of potential chiral ketones for asymmetric reduction synthesis of chiral alcohols is a preferred way for green synthesis of chiral alcohols due to the advantages of high theoretical yield, good selectivity, few byproducts, mild reaction conditions and the like.
Asymmetric reduction of prochiral copper is one of the basic reactions of asymmetric synthesis and is also an important method for preparing optically active chiral alcohols. Among the biological enzymes for asymmetrically reducing the prochiral ketone, short-chain dehydrogenases are attracting attention because of their broad catalytic substrate spectrum, good thermal stability, strong tolerance to organic solvents, etc. The preparation of chiral alcohols of high optical purity by short-chain dehydrogenase-catalyzed reduction of latent chiral ketones has been reported in many cases. At present, a strain capable of catalyzing reduction of potential chiral ketone by anti-Prelog stereoselectivity, namely, a Equilibrium brevifolium ZJUY-1401 (Empedobacter brecis ZJUY-1401) is obtained through experimental screening; and the short-chain dehydrogenase EbSDR8 which reduces the potential chiral ketone with high stereoselectivity following the anti-Prelog rule is mined and cloned from the genome. However, the short-chain dehydrogenase has low activity in catalyzing aliphatic latent chiral secondary ketone (such as 2-hexanone, 2-heptanone and 2-octanone), so that the efficiency of the enzyme in catalyzing aliphatic latent chiral secondary ketone needs to be improved by related technology to fully find the application value.
Disclosure of Invention
In order to overcome the defects of the prior art, the invention aims to provide a carbonyl reductase EbSDR8 mutant, a construction method and application thereof, improve the catalytic activity of the carbonyl reductase EbSDR8 and better mine the value of industrial application.
The invention provides a carbonyl reductase EbSDR8 mutant, wherein the carbonyl reductase EbSDR8 has an amino acid sequence shown as SEQ ID NO.2 and a nucleotide sequence shown as SEQ ID NO. 1. The carbonyl reductase EbSDR8 mutant is single-point mutation or multi-point combination mutation containing the following sites on the basis of the amino acid sequence of the carbonyl reductase EbSDR8 shown in SEQ ID NO. 2: asparagine 70, alanine 91, lysine 124, serine 137, but mutants of alanine 91 and lysine 124 are less catalytic.
Specifically, two-point combined mutation of 70 th asparagine and 137 th serine exists on the basis of the amino acid sequence shown in SEQ ID NO.2 of carbonyl reductase EbSDR 8; wherein, the 70 th asparagine is mutated into valine, the 137 th serine is mutated into phenylalanine, and the amino acid sequence of the mutant is shown in SEQ ID NO. 8. The combination mutation has better catalytic activity compared with the single point mutation of 70 th asparagine or 137 th serine.
The invention also provides a construction method of the carbonyl reductase EbSDR8 mutant, which comprises the following steps:
(1) Determining that the mutation site of carbonyl reductase EbSDR8 is asparagine 70 and phenylalanine 137 with the amino acid sequence shown in SEQ ID NO.2, and designing a mutation primer; wherein, the mutation primer is:
N70V-F：CGAAGAGGTTGAAGCGTTGGTAAAAAAAG；
N70V-R：ACGCTTCAACCTCTTCGGGAGATGATGT；
S137F-F：GGAGGTTTTATTGTGAATATGGCCTCAAT；
S137F-R：CACAATAAAACCTCCACCATTTTTCTCCAT。
then, mutation PCR is carried out, wherein the reaction conditions of the mutation PCR are as follows: pre-denaturing at 98deg.C for 1min; then the mixture enters into a temperature circulation for 98 ℃,10s,55 ℃,10s,72 ℃ and 7min, and is cooled to 4 ℃ after 20 times of circulation.
Specifically, in the coding gene of the carbonyl reductase EbSDR8 mutant, the nucleotide sequence of the mutant N70V is shown as SEQ ID NO.3 in a sequence table, and the coded amino acid sequence is shown as SEQ ID NO.6 in the sequence table; the nucleotide sequence of the mutant S137F is shown as SEQ ID NO.5 in the sequence table, and the encoded amino acid sequence is shown as SEQ ID NO.6 in the sequence table. The nucleotide sequence of the mutant N70V/S137F is shown as SEQ ID NO.7 in a sequence table, and the encoded amino acid sequence is shown as SEQ ID NO.8 in the sequence table.
Wherein, the gene of the carbonyl reductase mutant can be connected to various vectors by a conventional method in the field to complete the construction of the recombinant expression vector. The vector may be any of a variety of vectors conventional in the art, such as various plasmids, phage or viral vectors, etc., and pET-30a is preferred in the present invention.
(2) Performing DpnI enzyme digestion on the recombinant expression vector after PCR and converting the recombinant expression vector into host microorganisms to obtain genetically engineered bacteria;
(3) Inoculating the genetically engineered bacterium obtained in the step (2) into a culture medium for culturing, and expressing the recombinant carbonyl reductase mutant under the induction of isopropyl-beta-D-thiopyran galactoside. Specifically, the recombinant expression transformant is cultured and induced to obtain the recombinant carbonyl reductase mutant protein.
Wherein, the carbonyl reductase mutant can catalyze and synthesize optically active chiral alcohol in the form of free enzyme, immobilized enzyme and recombinant free cells.
Still further, the reaction conditions of the mutant PCR in the step (1) are: pre-denaturing at 98deg.C for 1min; then the mixture enters into a temperature circulation for 98 ℃,10s,55 ℃,10s,72 ℃ and 7min, and is cooled to 4 ℃ after 20 times of circulation.
Further, the specific implementation steps of the step (3) are as follows:
(a) Slant culture: inoculating the recombinant genetic engineering bacteria containing the gene encoding the carbonyl reductase EbSDR8 mutant into a slant culture medium containing 50 mug/ml kanamycin, and culturing for 12-16 h at 37 ℃ to obtain slant thalli;
(b) Seed culture: inoculating the inclined plane thallus to a seed culture medium, and culturing for 8-10 h at 37 ℃ to obtain seed liquid;
(c) Fermentation culture: inoculating the seed solution into a sterile fermentation tank at an inoculum size of 10% by volume, and fermenting and culturing at 37deg.C to OD 600 When the concentration reaches 0.6-0.8, isopropyl-beta-D-thiopyran galactose glycoside with the final concentration of 0.1-10 mM is added into the sterile fermentation tank to be induced and cultured at 26 ℃.
The application of carbonyl reductase EbSDR8 mutant in reducing aliphatic latent chiral secondary ketone, which takes aliphatic latent chiral secondary ketone as substrate, ebSDR8 mutant as catalyst, reacts in a conversion reaction system composed of buffer solution with PH of 5.5-10.5 at 20-50 ℃. After the reaction is completed, the reaction liquid is separated and purified to obtain the corresponding product.
Further, in the conversion reaction system, the initial concentration of the aliphatic potentially chiral secondary ketone is 10-1000 mmol/L. The mass dosage of carbonyl reductase EbSDR8 mutant thalli in the conversion reaction system is 10-500 g/L based on the thallus wet weight.
Still further, the concentration of the carbonyl reductase EbSDR8 mutant in the conversion reaction system is 10-500 g/L, and the carbonyl reductase EbSDR8 mutant is provided in a form of wet bacteria obtained by induced culture of genetically engineered bacteria containing the carbonyl reductase EbSDR8 mutant.
Further, the conversion reaction system also comprises one or more organic solvents selected from dimethyl sulfoxide, isopropanol and methanol. Isopropyl alcohol is preferable, and the concentration of isopropyl alcohol in the reaction system is 30%.
Compared with the prior art, the invention has the beneficial effects that:
in the carbonyl reductase EbSDR8 mutant and the construction method of the carbonyl reductase EbSDR8 mutant, provided by the invention, the carbonyl reductase EbSDR8 obtains mutation sites with higher activity, so that the carbonyl reductase EbSDR8 has better catalytic activity on the catalytic synthesis of aliphatic chiral secondary ketone, the concentration of the aliphatic chiral secondary ketone is 100-300 g/L, the conversion rate is 70% -99.9%, the yield is 75% -98%, the optical purity is more than 99%, and the method has good application and development prospects.
Detailed Description
The present invention will be further described with reference to the accompanying drawings and detailed description, wherein it is to be understood that, on the premise of no conflict, the following embodiments or technical features may be arbitrarily combined to form new embodiments.
The invention provides a carbonyl reductase EbSDR8 mutant, wherein the carbonyl reductase EbSDR8 has an amino acid sequence shown as SEQ ID NO.2 and a nucleotide sequence shown as SEQ ID NO. 1. The carbonyl reductase EbSDR8 mutant is single-point mutation or multi-point combination mutation containing the following sites on the basis of the amino acid sequence of the carbonyl reductase EbSDR8 shown in SEQ ID NO. 2: asparagine 70, alanine 91, lysine 124, serine 137, but mutants of alanine 91 and lysine 124 are less catalytic.
Specifically, two-point combined mutation of 70 th asparagine and 137 th serine exists on the basis of the amino acid sequence shown in SEQ ID NO.2 of carbonyl reductase EbSDR 8; wherein, the 70 th asparagine is mutated into valine, the 137 th serine is mutated into phenylalanine, and the amino acid sequence of the mutant is shown in SEQ ID NO. 8. The combination mutation has better catalytic activity compared with the single point mutation of 70 th asparagine or 137 th serine.
The invention also provides a construction method of the carbonyl reductase EbSDR8 mutant, which comprises the following steps:
(1) Determining that the mutation site of carbonyl reductase EbSDR8 is asparagine 70 and phenylalanine 137 with the amino acid sequence shown in SEQ ID NO.2, and designing a mutation primer; wherein, the mutation primer is:
N70V-F：CGAAGAGGTTGAAGCGTTGGTAAAAAAAG；
N70V-R：ACGCTTCAACCTCTTCGGGAGATGATGT；
S137F-F：GGAGGTTTTATTGTGAATATGGCCTCAAT；
S137F-R：CACAATAAAACCTCCACCATTTTTCTCCAT。
then, mutation PCR is carried out, wherein the reaction conditions of the mutation PCR are as follows: pre-denaturing at 98deg.C for 1min; then the mixture enters into a temperature circulation for 98 ℃,10s,55 ℃,10s,72 ℃ and 7min, and is cooled to 4 ℃ after 20 times of circulation.
Specifically, in the coding gene of the carbonyl reductase EbSDR8 mutant, the nucleotide sequence of the mutant N70V is shown as SEQ ID NO.3 in a sequence table, and the coded amino acid sequence is shown as SEQ ID NO.6 in the sequence table; the nucleotide sequence of the mutant S137F is shown as SEQ ID NO.5 in the sequence table, and the encoded amino acid sequence is shown as SEQ ID NO.6 in the sequence table. The nucleotide sequence of the mutant N70V/S137F is shown as SEQ ID NO.7 in a sequence table, and the encoded amino acid sequence is shown as SEQ ID NO.8 in the sequence table.
Wherein, the gene of the carbonyl reductase mutant can be connected to various vectors by a conventional method in the field to complete the construction of the recombinant expression vector. The vector may be any of a variety of vectors conventional in the art, such as various plasmids, phage or viral vectors, etc., and pET-30a is preferred in the present invention.
(2) Performing DpnI enzyme digestion on the recombinant expression vector after PCR and converting the recombinant expression vector into host microorganisms to obtain genetically engineered bacteria; it will be appreciated that genetically engineered bacteria expressing recombinant carbonyl reductase mutants can be obtained by transforming the recombinant expression vectors of the invention into host microorganisms. The host microorganism may be any of various host microorganisms conventional in the art, so long as the recombinant expression vector can stably self-replicate and the carbonyl reductase mutant gene carried can be efficiently expressed, and the present invention is not limited thereto. The invention is preferably E.coli, more preferably E.coli BL21 (DE 3).
(3) Inoculating the genetically engineered bacterium obtained in the step (2) into a culture medium for culturing, and expressing the recombinant carbonyl reductase mutant under the induction of isopropyl-beta-D-thiopyran galactoside. Specifically, the recombinant expression transformant is cultured and induced to obtain the recombinant carbonyl reductase mutant protein. Wherein the medium used for recombinant expression of the transformant may be a medium which is known in the art for growing the transformant and producing the carbonyl reductase mutant protein of the present invention, preferably LB medium: 10g/L peptone, 5g/L yeast powder, 10g/L sodium chloride and pH 7.2. It should be understood that the culture method and culture conditions are not limited thereto as long as the transformant can grow and produce the carbonyl reductase mutant protein. The following method is preferred: inoculating recombinant Escherichia coli into LB culture medium containing kanamycin, and culturing when the optical density OD of the culture solution is equal to that of the strain 600 When the concentration reaches 0.6-0.8, the recombinant carbonyl reductase mutant protein can be efficiently expressed under the induction of IPTG with the final concentration of 0.1-1.0 mM.
Wherein, the carbonyl reductase mutant can catalyze and synthesize optically active chiral alcohol in the form of free enzyme, immobilized enzyme and recombinant free cells.
Still further, the reaction conditions of the mutant PCR in the step (1) are: pre-denaturing at 98deg.C for 1min; then the mixture enters into a temperature circulation for 98 ℃,10s,55 ℃,10s,72 ℃ and 7min, and is cooled to 4 ℃ after 20 times of circulation.
Further, the specific implementation steps of the step (3) are as follows:
(a) Slant culture: inoculating the recombinant genetic engineering bacteria containing the gene encoding the carbonyl reductase EbSDR8 mutant into a slant culture medium containing 50 mug/ml kanamycin, and culturing for 12-16 h at 37 ℃ to obtain slant thalli; wherein, the final concentration composition of the slant culture medium is as follows: 10g/L peptone, 5g/L yeast extract, 10g/L sodium chloride, 1.5% agar powder, deionized water as solvent, and pH 7.0. Prior to use 50. Mu.g/ml kanamycin was added.
(b) Seed culture: inoculating the inclined plane thallus to a seed culture medium, and culturing for 8-10 h at 37 ℃ to obtain seed liquid; wherein, the final concentration composition of the seed culture medium is as follows: 10g/L peptone, 5g/L yeast extract, 10g/L sodium chloride, 50. Mu.g/ml kanamycin, deionized water as solvent, pH 7.0.
(c) Fermentation culture: inoculating the seed solution into a sterile fermentation tank at an inoculum size of 10% by volume, and fermenting and culturing at 37deg.C to OD 600 When the concentration reaches 0.6-0.8, isopropyl-beta-D-thiopyran galactose glycoside with the final concentration of 0.1-10 mM is added into the sterile fermentation tank to be induced and cultured at 26 ℃. Specifically, the seed solution was inoculated into a sterile 30L mechanically stirred and ventilated general-purpose fermenter containing 18L of fermentation medium at an inoculum size of 10% by volume, and after fermentation culture at 37℃for 14 hours, lactose at a final concentration of 15g/L which had been sterilized was added to the fermenter in portions and induced culture at 26 ℃. OD after culturing for 12-24 h 600 And (5) placing the mixture into a tank for 100-150 days to collect wet thalli. The final concentration composition of the fermentation medium is as follows: 15g/L peptone, 12g/L yeast powder, 10g/L NaCl, 15g/L glycerol, (NH) 4 ) 2 SO 4 5g/L，KH 2 PO 4 1.36g/L，K 2 HPO 4 ·3H 2 O 2.28g/L，MgSO 4 ·7H 2 O0.375 g/L, and deionized water as solvent.
The application of carbonyl reductase EbSDR8 mutant in reduction of aliphatic latent chiral secondary ketone, wherein aliphatic latent chiral secondary ketone is used as a substrate, ebSDR8 mutant is used as a catalyst, and the reaction is carried out in a conversion reaction system which is composed of buffer solution with pH of 5.5-10.5 and 30% isopropanol at 20-50 ℃ and has a reaction formula shown in formula I. After the reaction is completed, the reaction liquid is separated and purified to obtain the corresponding product.
Specifically, the method for separating and purifying the conversion reaction liquid comprises the following steps: after the reaction is finished, extracting by using ethyl acetate with the same volume, obtaining a crude product containing the corresponding chiral alcohol by using an organic layer, and purifying the crude product to obtain the corresponding chiral alcohol. The method for purifying the crude product is a well known technology in the field, and is usually organic solvent extraction, chromatographic separation, adsorption separation and the like.
Further, in the conversion reaction system, the initial concentration of the aliphatic potentially chiral secondary ketone is 10-1000 mmol/L. The mass dosage of carbonyl reductase EbSDR8 mutant thalli in the conversion reaction system is 10-500 g/L based on the thallus wet weight.
Still further, the concentration of the carbonyl reductase EbSDR8 mutant in the conversion reaction system is 10-500 g/L, and the carbonyl reductase EbSDR8 mutant is provided in a form of wet bacteria obtained by induced culture of genetically engineered bacteria containing the carbonyl reductase EbSDR8 mutant.
Further, the conversion reaction system also comprises one or more organic solvents selected from dimethyl sulfoxide, isopropanol and methanol. Isopropyl alcohol is preferable, and the concentration of isopropyl alcohol in the reaction system is 30%.
Example 1
Construction of mutant cell N70V/S137F
Oligonucleotide fragment containing mutation point is used as primer
N70V-F：CGAAGAGGTTGAAGCGTTGGTAAAAAAAG；
N70V-R：ACGCTTCAACCTCTTCGGGAGATGATGT；
S137F-F：GGAGGTTTTATTGTGAATATGGCCTCAAT；
S137F-R: CACAATAAAACCTCCACCATTTTTCTCCAT. ) PCR amplification reactions were performed separately. pET-30a recombinant plasmid containing the carbonyl reductase gene was amplified using the QuickChangeTM method (Stratagene, la Jolla, calif.).
Wherein, the PCR procedure: (1) pre-denaturing at 98℃for 1min; (2) 98℃for 10s;55 ℃ for 10s; the temperature was cycled at 72℃for 7min and cooled to 4℃after 20 cycles. After washing the PCR product, digestion was performed with restriction enzyme DpnI, which specifically recognizes the methylation site, to degrade the methylated template plasmid. Enzyme digestion reaction system and conditions: mu.L of the washed PCR product, 2.0. Mu.L of 10 Xbuffer, 1.0. Mu.L of restriction enzyme DpnI, and incubated at 37℃for 1h.
The PCR product subjected to the enzyme digestion treatment is transformed into E.coli BL21 (DE 3) to obtain corresponding recombinant escherichia coli, the corresponding recombinant escherichia coli is coated on a kanamycin-containing solid plate, the recombinant escherichia coli is cultured overnight at 37 ℃, single bacterial colonies are randomly picked for colony PCR identification and sequencing verification, and the result shows that the recombinant expression vector containing the carbonyl reductase mutant gene is successfully transformed into an expression host E.coli BL21 (DE 3). Mutants N70V, S F and N70V/S137F were finally obtained. The nucleotide sequence sequencing results are respectively shown as SEQ ID NO.3, SEQ ID NO.5 and SEQ ID NO.7 in the sequence table, and the amino acid sequences of the corresponding coded proteins are shown as SEQ ID NO.4, SEQ ID NO.6 and SEQ ID NO.8 in the sequence table.
Example 2
Inducible expression of carbonyl reductase mutants
The engineering bacteria constructed in example 1 were inoculated into LB medium containing 50. Mu.g/mL kanamycin, cultured overnight at 37℃at 200rpm, inoculated into LB medium containing 50. Mu.g/mL kanamycin at 1% inoculum size (v/v), cultured at 37℃at 200rpm until the cell concentration OD600 became about 0.6, added with 0.1mM IPTG at a final concentration, and after 6h of induction culture at 26℃the cells were collected by centrifugation at 8000rpm at 4℃for 10min and stored at-80 ℃.
Example 3
Fermenter culture of carbonyl reductase mutants
The engineering bacteria constructed in example 1 were inoculated into LB medium containing 50. Mu.g/mL kanamycin, cultured at 37℃for 200rpm overnight, inoculated into medium containing 50. Mu.g/mL kanamycin at 2% inoculum size (v/v), cultured at 200rpm, inoculated into 15L fermentor containing 50. Mu.g/mL kanamycin at 10% inoculum size (v/v) in mid-log phase, cultured at 37℃for about 14 hours (mid-log phase), and after lactose was added for induction for 20 hours, the cells were collected by centrifugation using a tube centrifuge for use.
Example 4
Carbonyl reductase EbSDR8 and mutant N70V/S137F catalytic high-concentration aliphatic potential chiral secondary ketone
Reaction system (10.0 mL): 2g of the wet cell of example 3, the substrates were 2-hexanone, 2-heptanone, 2-octanone, 3mL of isopropanol, 5.0mL of Na 2 HPO 4 -NaH 2 PO 4 Buffer (100 mM, pH 7.5). The reaction was carried out at 37℃and 200 rpm. The catalytic effect of the wild type recombinant whole cell is obviously lower than that of the mutant N70V/S137F, the conversion rate of EbSDR8 recombinant cells after the substrate concentration is 200mM and the reaction is 20 hours is respectively 2%, 10% and 4%, and the e.e. value is not high; the productivity of the mutant N70V/S137F recombinant cells is 80%, 99% and 85% respectively, and the e.e. value is as high as 99%; when the substrate concentration reaches 500mM, the whole cell of the mutant can still effectively catalyze the reaction, and after 24 hours of reaction, the conversion rates are 70%, 96% and 73% respectively.
Example 5
Carbonyl reductase EbSDR8 and mutant N70V/S137F catalytic high-concentration 2-octanone
Reaction system (10.0 mL): wet cell 2g of genetically engineered bacterium containing gene encoding carbonyl reductase EbSDR8 mutant, 100mM 2-octanone, 3.0mL isopropyl alcohol, na2HPO4-NaH2PO4 buffer (100 mM, pH 7.0) added to 10mL, reacted at 37 ℃ under 200rpm, the conversion rate was more than 89%, when the substrate concentration was 1500mM, the conversion rate was 79% at 16 h.
Example 6
Amplification of carbonyl reductase EbSDR8 and mutant N70V/S137F catalytic high-concentration 2-octanone reaction system
Reaction system (70L): 14kg of wet cell in example 1, 1500mM 2-octanone, 21L of isopropanol, na were added 2 HPO 4 -NaH 2 PO 4 The buffer (100 mM, pH 7.0) was fixed to a volume of 70L. Reacting at 35 deg.C and 400rpm for 24 hr until the conversion rate reaches 75% and the optical purity>99%, is suitable for industrializationAnd (3) production.
The above embodiments are only preferred embodiments of the present invention, and the scope of the present invention is not limited thereto, but any insubstantial changes and substitutions made by those skilled in the art on the basis of the present invention are intended to be within the scope of the present invention as claimed.
Appendix
Short chain dehydrogenase EbSDR8 coding gene and protein sequence (NCBI accession number KT 003817)
SEQ ID NO.1
1 atgtcaatat taaaagataa ggtagctatt gtgacaggag caagttccgg aataggtaaa
61 gctgttgcag aattgtatgc aaaagaaggt gcaaaagttg ttgtttctga tatcgatgaa
121 gaaagaggaa aagaagttgt agaacagatt aaaaaaaatg gaggagaagc catctttttc
181 aaagcggata catcatctcc cgaagagaat gaagcgttgg taaaaaaagc agttgaagtg
241 tatggaaaat tggatattgc atgtaataat gccggaatag gaggtccggc tgaattgaca
301 gaagattatc ctttagacgg ttggaaaaaa gtgattgata tcaacttcaa tggtgttttt
361 tatggatgta aatatcaatt gcaggcaatg gagaaaaatg gtggaggttc tattgtgaat
421 atggcctcaa tacacggtac agtagcggct cctatgagtt ctgcttatac ttctgcgaaa
481 catggtgttg tgggacttac aaaaaatatt ggagcagagt acggttcaaa aaatatccga
541 tgcaatgctg tgggacctgg ttatatcatg acaccattgt tgtcgaataa tttgagcgca
601 gattatctag aattattggt aacgaagcat ccaataggtc gtttaggaca gcctgaggaa
661 gttgcagaat tagttttatt tctaagttct gataaagcgt cttttatgac aggaggttac
721 tatcttgtag atggaggata tacagcagtt taa
SEQ ID NO.2
1 msilkdkvai vtgassgigk avaelyakeg akvvvsdide ergkevveqi kknggeaiff
61 kadtsspeen ealvkkavev ygkldiacnn agiggpaelt edypldgwkk vidinfngvf
121 ygckyqlqam ekngggsivn masihgtvaa pmssaytsak hgvvgltkni gaeygsknir
181 cnavgpgyim tpllsnnlsa dylellvtkh pigrlgqpee vaelvlflss dkasfmtggy
241 ylvdggytav
SEQ ID NO.3
1 atgtcaatat taaaagataa ggtagctatt gtgacaggag caagttccgg aataggtaaa
61 gctgttgcag aattgtatgc aaaagaaggt gcaaaagttg ttgtttctga tatcgatgaa
121 gaaagaggaa aagaagttgt agaacagatt aaaaaaaatg gaggagaagc catctttttc
181 aaagcggata catcatctcc cgaagaggtt gaagcgttgg taaaaaaagc agttgaagtg
241 tatggaaaat tggatattgc atgtaataat gccggaatag gaggtccggc tgaattgaca
301 gaagattatc ctttagacgg ttggaaaaaa gtgattgata tcaacttcaa tggtgttttt
361 tatggatgta aatatcaatt gcaggcaatg gagaaaaatg gtggaggttc tattgtgaat
421 atggcctcaa tacacggtac agtagcggct cctatgagtt ctgcttatac ttctgcgaaa
481 catggtgttg tgggacttac aaaaaatatt ggagcagagt acggttcaaa aaatatccga
541 tgcaatgctg tgggacctgg ttatatcatg acaccattgt tgtcgaataa tttgagcgca
601 gattatctag aattattggt aacgaagcat ccaataggtc gtttaggaca gcctgaggaa
661 gttgcagaat tagttttatt tctaagttct gataaagcgt cttttatgac aggaggttac
721 tatcttgtag atggaggata tacagcagtt taa
SEQ ID NO.4
1 msilkdkvai vtgassgigk avaelyakeg akvvvsdide ergkevveqi kknggeaiff
61 kadtsspeev ealvkkavev ygkldiacnn agiggpaelt edypldgwkk vidinfngvf
121 ygckyqlqam ekngggsivn masihgtvaa pmssaytsak hgvvgltkni gaeygsknir
181 cnavgpgyim tpllsnnlsa dylellvtkh pigrlgqpee vaelvlflss dkasfmtggy
241 ylvdggytav
SEQ ID NO.5
1 atgtcaatat taaaagataa ggtagctatt gtgacaggag caagttccgg aataggtaaa
61 gctgttgcag aattgtatgc aaaagaaggt gcaaaagttg ttgtttctga tatcgatgaa
121 gaaagaggaa aagaagttgt agaacagatt aaaaaaaatg gaggagaagc catctttttc
181 aaagcggata catcatctcc cgaagagaat gaagcgttgg taaaaaaagc agttgaagtg
241 tatggaaaat tggatattgc atgtaataat gccggaatag gaggtccggc tgaattgaca
301 gaagattatc ctttagacgg ttggaaaaaa gtgattgata tcaacttcaa tggtgttttt
361 tatggatgta aatatcaatt gcaggcaatg gagaaaaatg gtggaggttt tattgtgaat
421 atggcctcaa tacacggtac agtagcggct cctatgagtt ctgcttatac ttctgcgaaa
481 catggtgttg tgggacttac aaaaaatatt ggagcagagt acggttcaaa aaatatccga
541 tgcaatgctg tgggacctgg ttatatcatg acaccattgt tgtcgaataa tttgagcgca
601 gattatctag aattattggt aacgaagcat ccaataggtc gtttaggaca gcctgaggaa
661 gttgcagaat tagttttatt tctaagttct gataaagcgt cttttatgac aggaggttac
721 tatcttgtag atggaggata tacagcagtt taa
SEQ ID NO.6
1 msilkdkvai vtgassgigk avaelyakeg akvvvsdide ergkevveqi kknggeaiff
61 kadtsspeen ealvkkavev ygkldiacnn agiggpaelt edypldgwkk vidinfngvf
121 ygckyqlqam ekngggfivn masihgtvaa pmssaytsak hgvvgltkni gaeygsknir
181 cnavgpgyim tpllsnnlsa dylellvtkh pigrlgqpee vaelvlflss dkasfmtggy
241 ylvdggytav
SEQ ID NO.7
1 atgtcaatat taaaagataa ggtagctatt gtgacaggag caagttccgg aataggtaaa
61 gctgttgcag aattgtatgc aaaagaaggt gcaaaagttg ttgtttctga tatcgatgaa
121 gaaagaggaa aagaagttgt agaacagatt aaaaaaaatg gaggagaagc catctttttc
181 aaagcggata catcatctcc cgaagaggtt gaagcgttgg taaaaaaagc agttgaagtg
241 tatggaaaat tggatattgc atgtaataat gccggaatag gaggtccggc tgaattgaca
301 gaagattatc ctttagacgg ttggaaaaaa gtgattgata tcaacttcaa tggtgttttt
361 tatggatgta aatatcaatt gcaggcaatg gagaaaaatg gtggaggttt tattgtgaat
421 atggcctcaa tacacggtac agtagcggct cctatgagtt ctgcttatac ttctgcgaaa
481 catggtgttg tgggacttac aaaaaatatt ggagcagagt acggttcaaa aaatatccga
541 tgcaatgctg tgggacctgg ttatatcatg acaccattgt tgtcgaataa tttgagcgca
601 gattatctag aattattggt aacgaagcat ccaataggtc gtttaggaca gcctgaggaa
661 gttgcagaat tagttttatt tctaagttct gataaagcgt cttttatgac aggaggttac
721 tatcttgtag atggaggata tacagcagtt taa
SEQ ID NO.8
1 msilkdkvai vtgassgigk avaelyakeg akvvvsdide ergkevveqi kknggeaiff
61 kadtsspeev ealvkkavev ygkldiacnn agiggpaelt edypldgwkk vidinfngvf
121 ygckyqlqam ekngggfivn masihgtvaa pmssaytsak hgvvgltkni gaeygsknir
181 cnavgpgyim tpllsnnlsa dylellvtkh pigrlgqpee vaelvlflss dkasfmtggy
241 ylvdggytav
Claims (10)
1. A carbonyl reductase EbSDR8 mutant, which is characterized in that two-point combined mutation of 70 th asparagine and 137 th serine exists on the basis of the amino acid sequence shown in SEQ ID NO.2 of the carbonyl reductase EbSDR 8; wherein, the 70 th asparagine is mutated into valine, the 137 th serine is mutated into phenylalanine, and the amino acid sequence of the mutant is shown in SEQ ID NO. 8.
2. A method of constructing a carbonyl reductase EbSDR8 mutant according to claim 1, comprising the steps of:
(1) Determining that the mutation site of carbonyl reductase EbSDR8 is an amino acid sequence shown as SEQ ID NO.2, mutating 70 th asparagine to valine, mutating 137 th serine to phenylalanine, designing a mutation primer, and performing mutation PCR;
(2) Performing DpnI enzyme digestion on the recombinant expression vector after PCR and converting the recombinant expression vector into host microorganisms to obtain genetically engineered bacteria;
(3) Inoculating the genetically engineered bacterium obtained in the step (2) into a culture medium for culturing, and expressing the recombinant carbonyl reductase mutant under the induction of isopropyl-beta-D-thiopyran galactoside.
3. The method for constructing a mutant carbonyl reductase EbSDR8 of claim 2, wherein the mutation primer of step (1) is:
N70V-F：CGAAGAGGTTGAAGCGTTGGTAAAAAAAG；
N70V-R：ACGCTTCAACCTCTTCGGGAGATGATGT；
S137F-F：GGAGGTTTTATTGTGAATATGGCCTCAAT；
S137F-R：CACAATAAAACCTCCACCATTTTTCTCCAT。
4. a method of constructing a mutant carbonyl reductase EbSDR8 according to claim 2 or 3, wherein the reaction conditions of the mutant PCR in step (1) are: pre-denaturing at 98deg.C for 1min; then the mixture enters into a temperature circulation for 98 ℃,10s,55 ℃,10s,72 ℃ and 7min, and is cooled to 4 ℃ after 20 times of circulation.
5. The method for constructing a carbonyl reductase EbSDR8 mutant according to claim 2, wherein the specific implementation step of the step (3) is as follows:
(a) The method comprises the following steps Inoculating the recombinant genetic engineering bacteria containing the gene encoding the carbonyl reductase EbSDR8 mutant into a slant culture medium containing 50 mug/ml kanamycin, and culturing for 12-16 hours at 37 ℃ to obtain slant thalli;
(b) The method comprises the following steps Inoculating the inclined plane thallus to a seed culture medium, and culturing for 8-10 hours at 37 ℃ to obtain seed liquid;
(c) The method comprises the following steps Inoculating the seed liquid into a sterile fermentation tank according to an inoculum size with the volume concentration of 10%, fermenting and culturing at 37 ℃ until the OD600 reaches 0.6-0.8, adding isopropyl-beta-D-thiopyran galactose glycoside with the final concentration of 0.1-10 mM into the sterile fermentation tank, and performing induced culture at 26 ℃.
6. The use of the carbonyl reductase EbSDR8 mutant in the reduction of aliphatic potential chiral secondary ketone according to claim 1, wherein the aliphatic potential chiral secondary ketone is used as a substrate, and the reaction is carried out in a conversion reaction system formed by buffer solution with pH of 5.5-10.5 at 20-50 ℃, and after the reaction is completed, the reaction solution is separated and purified to obtain the corresponding product.
7. The use of the carbonyl reductase EbSDR8 mutant in the reduction of aliphatic prochiral secondary ketone according to claim 6, wherein the initial concentration of the aliphatic prochiral secondary ketone in the conversion reaction system is 10-1000 mmol/L.
8. The use of the carbonyl reductase EbSDR8 mutant according to claim 6 or 7 in aliphatic prochiral secondary ketone reduction, wherein the concentration of the carbonyl reductase EbSDR8 mutant in the conversion reaction system is 10-500 g/L, and the carbonyl reductase EbSDR8 mutant is provided in a form of wet bacteria obtained by induction culture of genetically engineered bacteria containing the carbonyl reductase EbSDR8 mutant.
9. The use of the carbonyl reductase EbSDR8 mutant in the reduction of aliphatic prochiral secondary ketone according to claim 8, wherein the conversion reaction system further comprises one or more organic solvents selected from dimethyl sulfoxide, isopropanol and methanol.
10. The use of the carbonyl reductase EbSDR8 mutant in aliphatic prochiral secondary ketone reduction according to claim 9, wherein the organic solvent is isopropanol with a concentration of 30%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010296172.3A CN111575258B (en) | 2020-04-15 | 2020-04-15 | Carbonyl reductase EbSDR8 mutant and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010296172.3A CN111575258B (en) | 2020-04-15 | 2020-04-15 | Carbonyl reductase EbSDR8 mutant and construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111575258A CN111575258A (en) | 2020-08-25 |
| CN111575258B true CN111575258B (en) | 2023-07-04 |
Family
ID=72121196
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010296172.3A Active CN111575258B (en) | 2020-04-15 | 2020-04-15 | Carbonyl reductase EbSDR8 mutant and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111575258B (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105602913A (en) * | 2016-03-09 | 2016-05-25 | 浙江工业大学 | Restructuring carbonyl reductase mutant ReCR-Mut, encoding gene, engineering bacteria and application |
| CN108486075A (en) * | 2018-02-14 | 2018-09-04 | 浙江工业大学 | A kind of recombination carbonyl reduction enzyme mutant, gene, engineering bacteria and its application |
| CN109468346A (en) * | 2018-06-01 | 2019-03-15 | 杭州馨海生物科技有限公司 | The biological preparation method of one kind (S) -1- (the iodo- 5- fluorophenyl of 2-) ethyl alcohol |
| CN109468290A (en) * | 2018-06-01 | 2019-03-15 | 杭州馨海生物科技有限公司 | A kind of carbonyl reduction enzyme mutant, expression vector, engineering bacteria and its application |
| CN109468291A (en) * | 2018-06-01 | 2019-03-15 | 杭州馨海生物科技有限公司 | A kind of carbonyl reductase EbSDR8 mutant and its construction method and application |
| CN110592035A (en) * | 2019-08-29 | 2019-12-20 | 浙江大学 | Carbonyl reductase mutant, recombinant expression vector and application of carbonyl reductase mutant in production of chiral alcohol |
-
2020
- 2020-04-15 CN CN202010296172.3A patent/CN111575258B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105602913A (en) * | 2016-03-09 | 2016-05-25 | 浙江工业大学 | Restructuring carbonyl reductase mutant ReCR-Mut, encoding gene, engineering bacteria and application |
| CN108486075A (en) * | 2018-02-14 | 2018-09-04 | 浙江工业大学 | A kind of recombination carbonyl reduction enzyme mutant, gene, engineering bacteria and its application |
| CN109468346A (en) * | 2018-06-01 | 2019-03-15 | 杭州馨海生物科技有限公司 | The biological preparation method of one kind (S) -1- (the iodo- 5- fluorophenyl of 2-) ethyl alcohol |
| CN109468290A (en) * | 2018-06-01 | 2019-03-15 | 杭州馨海生物科技有限公司 | A kind of carbonyl reduction enzyme mutant, expression vector, engineering bacteria and its application |
| CN109468291A (en) * | 2018-06-01 | 2019-03-15 | 杭州馨海生物科技有限公司 | A kind of carbonyl reductase EbSDR8 mutant and its construction method and application |
| CN110592035A (en) * | 2019-08-29 | 2019-12-20 | 浙江大学 | Carbonyl reductase mutant, recombinant expression vector and application of carbonyl reductase mutant in production of chiral alcohol |
Non-Patent Citations (3)
| Title |
|---|
| Rational design of the carbonyl reductase EbSDR8 for efficient;Ze-Hui Shao 等;《Applied Microbiology and Biotechnology》;20200921;1-10 * |
| Structure-guided stereoselectivity inversion of a short-chain dehydrogenase/reductase towards halogenated acetophenones;Aipeng Li,等;《Chem Commun (Camb)》;20160507;第52卷;6284-6287 * |
| 羰基还原酶的挖掘;李爱朋;《中国博士学位论文全文数据库》;20170215;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111575258A (en) | 2020-08-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107586763B (en) | Carbonyl reductase mutant, vector, engineering bacterium and application thereof | |
| CN109468291B (en) | Carbonyl reductase EbSDR8 mutant and construction method and application thereof | |
| CN112359036B (en) | Nitrilase mutant with improved catalytic activity and reaction specificity and application thereof | |
| CN113817693B (en) | Short-chain carbonyl reductase PpYSDR mutant, encoding gene, recombinant expression vector, genetic engineering bacterium and application | |
| CN109777788B (en) | Leucine dehydrogenase mutant and application thereof | |
| CN109055324B (en) | Improved ketoreductase and application thereof | |
| CN111454918B (en) | Enol reductase mutant and application thereof in preparation of (R) -citronellal | |
| CN110592035B (en) | Carbonyl reductase mutant, recombinant expression vector and application of carbonyl reductase mutant in production of chiral alcohol | |
| CN111826332B (en) | Method for producing piperonal by using recombinant engineering bacteria for co-expressing trans-anethole monooxygenase and formate dehydrogenase and engineering bacteria thereof | |
| CN111411128A (en) | Whole cell biocatalysis method for producing α omega-dicarboxylic acid and application thereof | |
| CN111575258B (en) | Carbonyl reductase EbSDR8 mutant and construction method and application thereof | |
| CN115433721B (en) | Carbonyl reductase mutant and application thereof | |
| CN108103049B (en) | Thermophilic L-asparaginase mutant and screening and fermenting method thereof | |
| CN114908129B (en) | Dehydrogenase for the preparation of (R) -4-chloro-3-hydroxybutyric acid ethyl ester | |
| CN115896081A (en) | Aspartase mutant and application thereof | |
| CN109762801B (en) | Halogen alcohol dehalogenase mutant and application thereof in synthesizing chiral drug intermediate | |
| CN111019915B (en) | Application of carbonyl reductase mutant in synthesis of chiral ortho-halogenated-alpha-phenylethyl alcohol | |
| CN113528475B (en) | Carbonyl reductase mutant and application thereof in preparation of steroid hormone testosterone | |
| CN113755477B (en) | Nitrilase mutant and application thereof in preparation of acetophenone acid compounds | |
| CN109897836A (en) | A kind of monoamine oxidase from aspergillus oryzae is used for the preparation of chiral amine intermediates | |
| CN117402839A (en) | Ketoreductase and application thereof in preparation of (R) -4-chloro-3-hydroxybutyrate | |
| CN108866017B (en) | Method for preparing β -hydroxy- β -methylbutyric acid by enzyme method | |
| CN116622534A (en) | Engineering strain for high yield of 2' -fucosyllactose, construction method and application thereof | |
| CN117402920A (en) | Ketoreductase BsSDR10 mutant and application thereof in asymmetric reduction of alpha-oxazolidinyl substituted acetophenone derivatives | |
| CN117802069A (en) | Du Bangshi thermomyces lipase mutant, coding gene, engineering bacterium and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |