CN111575258A - Carbonyl reductase EbSDR8 mutant and construction method and application thereof - Google Patents
Carbonyl reductase EbSDR8 mutant and construction method and application thereof Download PDFInfo
- Publication number
- CN111575258A CN111575258A CN202010296172.3A CN202010296172A CN111575258A CN 111575258 A CN111575258 A CN 111575258A CN 202010296172 A CN202010296172 A CN 202010296172A CN 111575258 A CN111575258 A CN 111575258A
- Authority
- CN
- China
- Prior art keywords
- ebsdr8
- mutant
- carbonyl reductase
- seq
- mutation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01184—Carbonyl reductase (NADPH) (1.1.1.184)
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a carbonyl reductase EbSDR8 mutant and a construction method and application thereof, wherein two-point combined mutation of 70 th asparagine and 137 th serine exists on the basis of an amino acid sequence of the carbonyl reductase EbSDR8 shown in SEQ ID NO. 2; wherein, the 70 th asparagine is mutated into valine, the 137 th serine is mutated into phenylalanine, and the amino acid sequence of the mutant is shown in SEQ ID NO. 8. So that carbonyl reductase EbSDR8 obtains a mutation site with higher activity, and the carbonyl reductase EbSDR8 has better catalytic activity for catalytic synthesis of aliphatic chiral secondary ketone.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a carbonyl reductase EbSDR8 mutant and a construction method and application thereof.
Background
Chiral alcohol and its derivatives are important chiral intermediates, and are widely used in the synthesis of chiral drugs, chiral pesticides, liquid crystal materials and other chemical products. Asymmetric reduction of prochiral ketone is an important method for preparing chiral alcohol with optical activity, can theoretically convert 100% of substrate ketone into chiral alcohol with single enantiomer, and has high industrial application value. Enzymes and microbial cells have attracted extensive attention as biocatalysts for efficiently preparing chiral alcohols, and the synthesis of chiral alcohols by biologically catalyzing asymmetric reduction of chiral ketones becomes a green synthesis preferred approach of chiral alcohols due to the advantages of high theoretical yield, good selectivity, few byproducts, mild reaction conditions and the like.
Asymmetric reduction of latent chiral copper is one of the basic reactions for asymmetric synthesis and is also an important method for preparing optically active chiral alcohols. Among the biological enzymes for asymmetrically reducing prochiral ketones, short-chain dehydrogenases have attracted attention because of their broad catalytic substrate spectrum, good thermal stability, and strong organic solvent tolerance. The preparation of chiral alcohols with high optical purity by catalyzing the reduction of prochiral ketones by short-chain dehydrogenases has been reported in many ways. At present, a strain, namely Empedobacter brevis ZJUY-1401(Empedobacter brevis ZJUY-1401), which can catalyze the reduction of the prochiral ketone by anti-Prelog stereoselectivity is obtained through screening experiments; and a short-chain dehydrogenase EbSDR8 which is expressed and highly stereoselectively reduces prochiral ketone according to the anti-Prelog rule is excavated and cloned from the genome. However, the short-chain dehydrogenase has low activity in catalyzing aliphatic latent chiral secondary ketone (such as 2-hexanone, 2-heptanone, 2-octanone), so it is necessary to improve the efficiency of the enzyme in catalyzing aliphatic latent chiral secondary ketone by related technologies to fully exploit the application value.
Disclosure of Invention
In order to overcome the defects of the prior art, the invention aims to provide a carbonyl reductase EbSDR8 mutant, a construction method and application thereof, improve the catalytic activity of the carbonyl reductase EbSDR8 and better develop the value of industrial application thereof.
The invention provides a carbonyl reductase EbSDR8 mutant, wherein the carbonyl reductase EbSDR8 has an amino acid sequence shown as SEQ ID NO.2 and a nucleotide sequence shown as SEQ ID NO. 1. The carbonyl reductase EbSDR8 mutant is a single-point mutation or a multi-point combined mutation containing the following sites on the basis of the amino acid sequence of the carbonyl reductase EbSDR8 shown in SEQ ID NO. 2: asparagine at position 70, alanine at position 91, lysine at position 124, serine at position 137, but the mutants at alanine at position 91 and lysine at position 124 have poor catalytic effects.
Specifically, two-point combined mutation of asparagine at position 70 and serine at position 137 exists on the basis of the amino acid sequence of carbonyl reductase EbSDR8 shown in SEQ ID No. 2; wherein, the 70 th asparagine is mutated into valine, the 137 th serine is mutated into phenylalanine, and the amino acid sequence of the mutant is shown in SEQ ID NO. 8. The combined mutation has better catalytic activity compared with the single point mutation of asparagine at 70 or serine at 137.
The invention also provides a construction method of the carbonyl reductase EbSDR8 mutant, which comprises the following steps:
(1) determining that the mutation site of carbonyl reductase EbSDR8 is asparagine 70 and phenylalanine 169 of the amino acid sequence shown in SEQ ID NO.2, and designing a mutation primer; wherein, the mutation primer is:
N70V-F：CGAAGAGGTTGAAGCGTTGGTAAAAAAAG；
N70V-R：ACGCTTCAACCTCTTCGGGAGATGATGT；
S137F-F：GGAGGTTTTATTGTGAATATGGCCTCAAT；
S137F-R：CACAATAAAACCTCCACCATTTTTCTCCAT。
then carrying out mutation PCR, wherein the reaction conditions of the mutation PCR are as follows: pre-denaturation at 98 deg.C for 1 min; then the temperature is cycled for 20 times to be at 98 ℃, 10s, 55 ℃, 10s, 72 ℃ and 7min, and then the temperature is cooled to 4 ℃.
Specifically, in the coding gene of the carbonyl reductase EbSDR8 mutant, the mutant N70V nucleotide sequence is shown as SEQ ID NO.3 in a sequence table, and the coded amino acid sequence is shown as SEQ ID NO.6 in the sequence table; the nucleotide sequence of the mutant S137F is shown as SEQ ID NO.5 in the sequence table, and the coded amino acid sequence thereof is shown as SEQ ID NO.6 in the sequence table. The nucleotide sequence of the mutant N70V/S137F is shown as SEQ ID NO.7 in the sequence table, and the coded amino acid sequence thereof is shown as SEQ ID NO.8 in the sequence table.
Wherein, the gene of the carbonyl reductase mutant can be connected to various vectors by the conventional method in the field to complete the construction of the recombinant expression vector. The vector may be any vector conventionally used in the art, such as any plasmid, phage or viral vector, and pET-30a is preferred in the present invention.
(2) Carrying out DpnI enzyme digestion treatment on the recombinant expression vector after PCR and transforming the recombinant expression vector into host microorganisms to obtain genetically engineered bacteria;
(3) inoculating the genetic engineering bacteria obtained in the step (2) into a culture medium for culture, and expressing the recombinant carbonyl reductase mutant under the induction of isopropyl-beta-D-thiogalactopyranoside. Specifically, recombinant expression transformants are cultured and induced to obtain recombinant carbonyl reductase mutant proteins.
The carbonyl reductase mutant can catalyze and synthesize optically active chiral alcohol in the forms of free enzyme, immobilized enzyme and recombinant free cells.
Still further, the reaction conditions of the mutation PCR in the step (1) are as follows: pre-denaturation at 98 deg.C for 1 min; then the temperature is cycled for 20 times to be at 98 ℃, 10s, 55 ℃, 10s, 72 ℃ and 7min, and then the temperature is cooled to 4 ℃.
Further, the specific implementation steps of the step (3) are as follows:
(a) slant culture: inoculating the recombinant genetic engineering bacteria containing the coding gene of the carbonyl reductase EbSDR8 mutant to a slant culture medium containing 50 mu g/ml kanamycin, and culturing at 37 ℃ for 12-16 h to obtain slant bacteria;
(b) seed culture: inoculating the slant thalli to a seed culture medium, and culturing at 37 ℃ for 8-10 h to obtain a seed solution;
(c) fermentation culture: inoculating the seed solution into a sterile fermentation tank at the inoculation amount of 10% of the volume concentration, and performing fermentation culture at 37 ℃ to OD600When the concentration reaches 0.6-0.8, adding isopropyl- β -D-thiogalactopyranoside with the final concentration of 0.1-10 mM into the sterile fermentation tank for induction culture at 26 ℃.
The carbonyl reductase EbSDR8 mutant is applied to reduction of aliphatic latent chiral secondary ketone, the aliphatic latent chiral secondary ketone is used as a substrate, the EbSDR8 mutant is used as a catalyst, and the reaction is carried out in a conversion reaction system formed by a buffer solution with the pH value of 5.5-10.5 at the temperature of 20-50 ℃. After the reaction is completed, the reaction liquid is separated and purified to obtain the corresponding product.
Further, in the conversion reaction system, the initial concentration of the aliphatic latent chiral secondary ketone is 10-1000 mmol/L. The mass dosage of the carbonyl reductase EbSDR8 mutant thallus in the conversion reaction system is 10-500 g/L in terms of wet weight of the thallus.
And further, the concentration of the carbonyl reductase EbSDR8 mutant in the conversion reaction system is 10-500 g/L, and the carbonyl reductase EbSDR8 mutant is provided in the form of wet bacteria obtained by induction culture of genetically engineered bacteria containing the carbonyl reductase EbSDR8 mutant.
Further, the conversion reaction system also comprises one or more organic solvents of dimethyl sulfoxide, isopropanol and methanol. Preferred is isopropyl alcohol, and the concentration of isopropyl alcohol in the reaction system is 30%.
Compared with the prior art, the invention has the beneficial effects that:
according to the construction method of the carbonyl reductase EbSDR8 mutant and the carbonyl reductase EbSDR8 mutant provided by the invention, the carbonyl reductase EbSDR8 obtains a mutation site with higher activity, so that the carbonyl reductase EbSDR8 has better catalytic activity for catalytic synthesis of aliphatic chiral secondary ketone, the concentration of the aliphatic chiral secondary ketone catalytically synthesized by the carbonyl reductase EbSDR8 mutant is 100-300 g/L, the conversion rate is 70-99.9%, the yield is 75-98%, the optical purity is more than 99%, and the method has good application and development prospects.
Detailed Description
The present invention is further described below with reference to specific embodiments, and it should be noted that, without conflict, any combination between the embodiments or technical features described below may form a new embodiment.
The invention provides a carbonyl reductase EbSDR8 mutant, wherein the carbonyl reductase EbSDR8 has an amino acid sequence shown as SEQ ID NO.2 and a nucleotide sequence shown as SEQ ID NO. 1. The carbonyl reductase EbSDR8 mutant is a single-point mutation or a multi-point combined mutation containing the following sites on the basis of the amino acid sequence of the carbonyl reductase EbSDR8 shown in SEQ ID NO. 2: asparagine at position 70, alanine at position 91, lysine at position 124, serine at position 137, but the mutants at alanine at position 91 and lysine at position 124 have poor catalytic effects.
Specifically, two-point combined mutation of asparagine at position 70 and serine at position 137 exists on the basis of the amino acid sequence of carbonyl reductase EbSDR8 shown in SEQ ID No. 2; wherein, the 70 th asparagine is mutated into valine, the 137 th serine is mutated into phenylalanine, and the amino acid sequence of the mutant is shown in SEQ ID NO. 8. The combined mutation has better catalytic activity compared with the single point mutation of asparagine at 70 or serine at 137.
The invention also provides a construction method of the carbonyl reductase EbSDR8 mutant, which comprises the following steps:
(1) determining that the mutation site of carbonyl reductase EbSDR8 is asparagine 70 and phenylalanine 169 of the amino acid sequence shown in SEQ ID NO.2, and designing a mutation primer; wherein, the mutation primer is:
N70V-F：CGAAGAGGTTGAAGCGTTGGTAAAAAAAG；
N70V-R：ACGCTTCAACCTCTTCGGGAGATGATGT；
S137F-F：GGAGGTTTTATTGTGAATATGGCCTCAAT；
S137F-R：CACAATAAAACCTCCACCATTTTTCTCCAT。
then carrying out mutation PCR, wherein the reaction conditions of the mutation PCR are as follows: pre-denaturation at 98 deg.C for 1 min; then the temperature is cycled for 20 times to be at 98 ℃, 10s, 55 ℃, 10s, 72 ℃ and 7min, and then the temperature is cooled to 4 ℃.
Specifically, in the coding gene of the carbonyl reductase EbSDR8 mutant, the mutant N70V nucleotide sequence is shown as SEQ ID NO.3 in a sequence table, and the coded amino acid sequence is shown as SEQ ID NO.6 in the sequence table; the nucleotide sequence of the mutant S137F is shown as SEQ ID NO.5 in the sequence table, and the coded amino acid sequence thereof is shown as SEQ ID NO.6 in the sequence table. The nucleotide sequence of the mutant N70V/S137F is shown as SEQ ID NO.7 in the sequence table, and the coded amino acid sequence thereof is shown as SEQ ID NO.8 in the sequence table.
Wherein, the gene of the carbonyl reductase mutant can be connected to various vectors by the conventional method in the field to complete the construction of the recombinant expression vector. The vector may be any vector conventionally used in the art, such as any plasmid, phage or viral vector, and pET-30a is preferred in the present invention.
(2) Carrying out DpnI enzyme digestion treatment on the recombinant expression vector after PCR and transforming the recombinant expression vector into host microorganisms to obtain genetically engineered bacteria; it is to be understood that genetically engineered bacteria expressing recombinant carbonyl reductase mutants can be obtained by transforming the recombinant expression vectors of the present invention into host microorganisms. The host microorganism may be various host microorganisms that are conventional in the art, as long as the recombinant expression vector can stably self-replicate and the carried carbonyl reductase mutant gene can be efficiently expressed, and the present invention is not limited thereto. Coli BL21(DE3) is preferred in the present invention.
(3) Specifically, recombinant expression transformants are cultured and induced to obtain recombinant carbonyl reductase mutant protein, wherein the culture medium used for the recombinant expression of the transformants can be a culture medium which can grow the transformants and produce the carbonyl reductase mutant protein of the invention in the field, preferably LB culture medium, 10g/L of peptone, 5g/L of yeast powder, 10g/L of sodium chloride and pH 7.2600When the final concentration reaches 0.6-0.8, the recombinant carbonyl reductase mutant protein can be efficiently expressed under the induction of IPTG with the final concentration of 0.1-1.0 mM.
The carbonyl reductase mutant can catalyze and synthesize optically active chiral alcohol in the forms of free enzyme, immobilized enzyme and recombinant free cells.
Still further, the reaction conditions of the mutation PCR in the step (1) are as follows: pre-denaturation at 98 deg.C for 1 min; then the temperature is cycled for 20 times to be at 98 ℃, 10s, 55 ℃, 10s, 72 ℃ and 7min, and then the temperature is cooled to 4 ℃.
Further, the specific implementation steps of the step (3) are as follows:
(a) slant culture: inoculating the recombinant genetic engineering bacteria containing the coding gene of the carbonyl reductase EbSDR8 mutant to a slant culture medium containing 50 mu g/ml kanamycin, and culturing at 37 ℃ for 12-16 h to obtain slant bacteria; wherein the final concentration composition of the slant culture medium is as follows: 10g/L of peptone, 5g/L of yeast extract, 10g/L of sodium chloride, 1.5% agar powder and deionized water as a solvent, and the pH value is 7.0. Kanamycin (50. mu.g/ml) was added before use.
(b) Seed culture: inoculating the slant thalli to a seed culture medium, and culturing at 37 ℃ for 8-10 h to obtain a seed solution; wherein the final concentration composition of the seed culture medium is as follows: 10g/L of peptone, 5g/L of yeast extract, 10g/L of sodium chloride, 50 mu g/ml of kanamycin and deionized water as a solvent, wherein the pH value is 7.0.
(c) Fermentation culture: inoculating the seed solution into a sterile fermentation tank at the inoculation amount of 10% of the volume concentration, and performing fermentation culture at 37 ℃ to OD600When the concentration reaches 0.6-0.8, adding isopropyl- β -D-thiogalactopyranoside with the final concentration of 0.1-10 mM into the sterile fermentation tank for induction culture at 26 ℃, specifically, inoculating the seed solution into a sterile 30L mechanical stirring ventilation universal fermentation tank filled with 18L fermentation medium in an inoculation amount with the volume concentration of 10%, performing fermentation culture at 37 ℃ for 14h, adding sterilized lactose with the final concentration of 15g/L into the fermentation tank in batches for induction culture at 26 ℃, and performing OD culture for 12-24 h600100-150 steps are achieved, and wet thalli are collected in a tank. The final concentration of the fermentation medium is as follows: peptone 15g/L, yeast powder 12g/L, NaCl 10g/L, glycerin 15g/L, (NH)4)2SO45g/L，KH2PO41.36g/L， K2HPO4·3H2O2.28g/L，MgSO4·7H2O0.375 g/L and deionized water as solvent.
The application of carbonyl reductase EbSDR8 mutant in reduction of aliphatic latent chiral secondary ketone is characterized in that aliphatic latent chiral secondary ketone is used as a substrate, EbSDR8 mutant is used as a catalyst, and the reaction is carried out in a conversion reaction system which is formed by buffer solution with pH of 5.5-10.5 and contains 30% of isopropanol at 20-50 ℃, wherein the reaction formula is shown as a formula I. After the reaction is completed, the reaction liquid is separated and purified to obtain the corresponding product.
Specifically, the method for separating and purifying the conversion reaction liquid comprises the following steps: after the reaction is finished, extracting with ethyl acetate with the same volume, obtaining an organic layer which is a crude product containing the corresponding chiral alcohol, and purifying the crude product to obtain the corresponding chiral alcohol. The method for purifying the crude product is a well-known technology in the field, and is generally organic solvent extraction, chromatographic separation, adsorption separation and the like.
Further, in the conversion reaction system, the initial concentration of the aliphatic latent chiral secondary ketone is 10-1000 mmol/L. The mass dosage of the carbonyl reductase EbSDR8 mutant thallus in the conversion reaction system is 10-500 g/L in terms of wet weight of the thallus.
And further, the concentration of the carbonyl reductase EbSDR8 mutant in the conversion reaction system is 10-500 g/L, and the carbonyl reductase EbSDR8 mutant is provided in the form of wet bacteria obtained by induction culture of genetically engineered bacteria containing the carbonyl reductase EbSDR8 mutant.
Further, the conversion reaction system also comprises one or more organic solvents of dimethyl sulfoxide, isopropanol and methanol. Preferred is isopropyl alcohol, and the concentration of isopropyl alcohol in the reaction system is 30%.
Example 1
Construction of mutant cell N70V/S137F
Oligonucleotide fragment containing mutation points as primer
N70V-F：CGAAGAGGTTGAAGCGTTGGTAAAAAAAG；
N70V-R：ACGCTTCAACCTCTTCGGGAGATGATGT；
S137F-F：GGAGGTTTTATTGTGAATATGGCCTCAAT；
S137F-R: CACAATAAAACCTCCACCATTTTTCTCCAT are provided. ) PCR amplification reactions were performed separately. The pET-30a recombinant plasmid containing the carbonyl reductase gene was amplified using the QuickChange method (Stratagene, La Jolla, Calif.).
Wherein, the PCR program: (1) pre-denaturation at 98 ℃ for 1 min; (2) 10s at 98 ℃; 55 ℃ for 10 s; and (3) carrying out temperature circulation at 72 ℃ for 7min, and cooling to 4 ℃ after circulating for 20 times. After the PCR product is washed, the methylated template plasmid is degraded by digesting with restriction enzyme Dpn I which can specifically recognize the methylation site. And (3) enzyme digestion reaction system and conditions: mu.L of the washed PCR product, 2.0. mu.L of 10 Xbuffer, 1.0. mu.L of restriction enzyme Dpn I, incubated at 37 ℃ for 1 h.
And (3) transforming the PCR product subjected to enzyme digestion treatment into E.coli BL21(DE3) to obtain corresponding recombinant escherichia coli, coating the recombinant escherichia coli on a solid plate containing kanamycin, culturing overnight at 37 ℃, randomly selecting a single colony to perform colony PCR identification and sequencing verification, wherein the result shows that the recombinant expression vector containing the carbonyl reductase mutant gene is successfully transformed into an expression host E.coli BL21(DE 3). Finally, mutants N70V, S137F and N70V/S137F were obtained. The sequencing results of the nucleotide sequences are respectively shown as SEQ ID NO.3, SEQ ID NO.5 and SEQ ID NO.7 in the sequence table, and the amino acid sequences of the corresponding encoded proteins are shown as SEQ ID NO.4, SEQ ID NO.6 and SEQ ID NO.8 in the sequence table.
Example 2
Inducible expression of carbonyl reductase mutants
The engineered bacterium constructed in example 1 was inoculated into LB medium containing 50. mu.g/mL kanamycin, cultured overnight at 37 ℃ at 200rpm, further inoculated into LB medium containing 50. mu.g/mL kanamycin at 1% inoculum size (v/v), cultured at 37 ℃ at 200rpm until the cell density OD600 is about 0.6, added to 0.1mM IPTG at the final concentration, induced at 26 ℃ for 6 hours, centrifuged at 4 ℃ at 8000rpm for 10min, and stored at-80 ℃ for further use.
Example 3
Fermentation tank culture of carbonyl reductase mutant
The engineered bacterium constructed in example 1 was inoculated into LB medium containing 50. mu.g/mL kanamycin, cultured overnight at 37 ℃ at 200rpm, further inoculated into a medium containing 50. mu.g/mL kanamycin at 2% inoculum size (v/v), cultured at 37 ℃ at 200rpm, inoculated into a 15L fermentor containing 50. mu.g/mL kanamycin at 10% inoculum size (v/v) in the middle logarithmic phase, cultured at 37 ℃ for about 14 hours (middle and late logarithmic phase), induced with lactose for 20 hours, and then centrifuged by a tubular centrifuge to collect the cells for use.
Example 4
Carbonyl reductase EbSDR8 and mutant N70V/S137F for catalyzing high-concentration aliphatic latent chiral secondary ketone
Reaction system (10.0 mL): 2g of the wet cells of example 3, the substrates were 2-hexanone, 2-heptanone, 2-octanone, 3mL of isopropanol, 5.0mL of Na2HPO4-NaH2PO4Buffer (100mM, pH 7.5). The reaction was carried out at 37 ℃ and 200 rpm. The catalytic effect of the wild recombinant whole cell is obviously lower than that of the mutant N70V/S137F, the conversion rates of the EbSDR8 recombinant cell after reaction for 20 hours with the substrate concentration of 200mM are respectively 2%, 10% and 4%, and the e.e. value is not high; the yield of the mutant N70V/S137F recombinant cells is 80%, 99% and 85% respectively, and the e.e. value is as high as 99%; when the substrate concentration reaches 500mM, the whole cells of the mutant still can effectively catalyze the reaction, and after 24 hours of reaction, the conversion rates are 70%, 96% and 73% respectively.
Example 5
Carbonyl reductase EbSDR8 and mutant N70V/S137F for catalyzing high-concentration 2-octanone
Reaction system (10.0 mL): 2g of wet cells of genetically engineered bacteria containing genes encoding carbonyl reductase EbSDR8 mutants, 100mM of 2-octanone, 3.0mL of isopropanol, Na2HPO4-NaH2PO4 buffer (100mM, pH 7.0) were added to 10mL, and the reaction was carried out at 37 ℃ and 200rpm, whereby the conversion rate was 89% or more, and when the substrate concentration was 1500mM, the conversion rate was 79% at 16 hours.
Example 6
Amplification of carbonyl reductase EbSDR8 and mutant N70V/S137F catalyzing high-concentration 2-octanone reaction system
Reaction system (70L): 14kg of the wet cells of example 1, 1500mM 2-octanone, 21L isopropanol, Na were added2HPO4-NaH2PO4Buffer (100mM, pH 7.0) was made up to 70L. Reacting at 35 deg.C and 400rpm for 24h to obtain 75% conversion rate and optical purity>99 percent and is suitable for industrial production.
The above embodiments are only preferred embodiments of the present invention, and the protection scope of the present invention is not limited thereby, and any insubstantial changes and substitutions made by those skilled in the art based on the present invention are within the protection scope of the present invention.
Appendix
Short chain dehydrogenase EbSDR8 coding gene and protein sequence (NCBI accession No. KT003817)
SEQ ID NO.1
1 atgtcaatat taaaagataa ggtagctatt gtgacaggag caagttccgg aataggtaaa
61 gctgttgcag aattgtatgc aaaagaaggt gcaaaagttg ttgtttctga tatcgatgaa
121 gaaagaggaa aagaagttgt agaacagatt aaaaaaaatg gaggagaagc catctttttc
181 aaagcggata catcatctcc cgaagagaat gaagcgttgg taaaaaaagc agttgaagtg
241 tatggaaaat tggatattgc atgtaataat gccggaatag gaggtccggc tgaattgaca
301 gaagattatc ctttagacgg ttggaaaaaa gtgattgata tcaacttcaa tggtgttttt
361 tatggatgta aatatcaatt gcaggcaatg gagaaaaatg gtggaggttc tattgtgaat
421 atggcctcaa tacacggtac agtagcggct cctatgagtt ctgcttatac ttctgcgaaa
481 catggtgttg tgggacttac aaaaaatatt ggagcagagt acggttcaaa aaatatccga
541 tgcaatgctg tgggacctgg ttatatcatg acaccattgt tgtcgaataa tttgagcgca
601 gattatctag aattattggt aacgaagcat ccaataggtc gtttaggaca gcctgaggaa
661 gttgcagaat tagttttatt tctaagttct gataaagcgt cttttatgac aggaggttac
721 tatcttgtag atggaggata tacagcagtt taa
SEQ ID NO.2
1 msilkdkvai vtgassgigk avaelyakeg akvvvsdide ergkevveqi kknggeaiff
61 kadtsspeen ealvkkavev ygkldiacnn agiggpaelt edypldgwkk vidinfngvf
121 ygckyqlqam ekngggsivn masihgtvaa pmssaytsak hgvvgltkni gaeygsknir
181 cnavgpgyim tpllsnnlsa dylellvtkh pigrlgqpee vaelvlflss dkasfmtggy
241 ylvdggytav
SEQ ID NO.3
1 atgtcaatat taaaagataa ggtagctatt gtgacaggag caagttccgg aataggtaaa
61 gctgttgcag aattgtatgc aaaagaaggt gcaaaagttg ttgtttctga tatcgatgaa
121 gaaagaggaa aagaagttgt agaacagatt aaaaaaaatg gaggagaagc catctttttc
181 aaagcggata catcatctcc cgaagaggtt gaagcgttgg taaaaaaagc agttgaagtg
241 tatggaaaat tggatattgc atgtaataat gccggaatag gaggtccggc tgaattgaca
301 gaagattatc ctttagacgg ttggaaaaaa gtgattgata tcaacttcaa tggtgttttt
361 tatggatgta aatatcaatt gcaggcaatg gagaaaaatg gtggaggttc tattgtgaat
421 atggcctcaa tacacggtac agtagcggct cctatgagtt ctgcttatac ttctgcgaaa
481 catggtgttg tgggacttac aaaaaatatt ggagcagagt acggttcaaa aaatatccga
541 tgcaatgctg tgggacctgg ttatatcatg acaccattgt tgtcgaataa tttgagcgca
601 gattatctag aattattggt aacgaagcat ccaataggtc gtttaggaca gcctgaggaa
661 gttgcagaat tagttttatt tctaagttct gataaagcgt cttttatgac aggaggttac
721 tatcttgtag atggaggata tacagcagtt taa
SEQ ID NO.4
1 msilkdkvai vtgassgigk avaelyakeg akvvvsdide ergkevveqi kknggeaiff
61 kadtsspeev ealvkkavev ygkldiacnn agiggpaelt edypldgwkk vidinfngvf
121 ygckyqlqam ekngggsivn masihgtvaa pmssaytsak hgvvgltkni gaeygsknir
181 cnavgpgyim tpllsnnlsa dylellvtkh pigrlgqpee vaelvlflss dkasfmtggy
241 ylvdggytav
SEQ ID NO.5
1 atgtcaatat taaaagataa ggtagctatt gtgacaggag caagttccgg aataggtaaa
61 gctgttgcag aattgtatgc aaaagaaggt gcaaaagttg ttgtttctga tatcgatgaa
121 gaaagaggaa aagaagttgt agaacagatt aaaaaaaatg gaggagaagc catctttttc
181 aaagcggata catcatctcc cgaagagaat gaagcgttgg taaaaaaagc agttgaagtg
241 tatggaaaat tggatattgc atgtaataat gccggaatag gaggtccggc tgaattgaca
301 gaagattatc ctttagacgg ttggaaaaaa gtgattgata tcaacttcaa tggtgttttt
361 tatggatgta aatatcaatt gcaggcaatg gagaaaaatg gtggaggttt tattgtgaat
421 atggcctcaa tacacggtac agtagcggct cctatgagtt ctgcttatac ttctgcgaaa
481 catggtgttg tgggacttac aaaaaatatt ggagcagagt acggttcaaa aaatatccga
541 tgcaatgctg tgggacctgg ttatatcatg acaccattgt tgtcgaataa tttgagcgca
601 gattatctag aattattggt aacgaagcat ccaataggtc gtttaggaca gcctgaggaa
661 gttgcagaat tagttttatt tctaagttct gataaagcgt cttttatgac aggaggttac
721 tatcttgtag atggaggata tacagcagtt taa
SEQ ID NO.6
1 msilkdkvai vtgassgigk avaelyakeg akvvvsdide ergkevveqi kknggeaiff
61 kadtsspeen ealvkkavev ygkldiacnn agiggpaelt edypldgwkk vidinfngvf
121 ygckyqlqam ekngggfivn masihgtvaa pmssaytsak hgvvgltkni gaeygsknir
181 cnavgpgyim tpllsnnlsa dylellvtkh pigrlgqpee vaelvlflss dkasfmtggy
241 ylvdggytav
SEQ ID NO.7
1 atgtcaatat taaaagataa ggtagctatt gtgacaggag caagttccgg aataggtaaa
61 gctgttgcag aattgtatgc aaaagaaggt gcaaaagttg ttgtttctga tatcgatgaa
121 gaaagaggaa aagaagttgt agaacagatt aaaaaaaatg gaggagaagc catctttttc
181 aaagcggata catcatctcc cgaagaggtt gaagcgttgg taaaaaaagc agttgaagtg
241 tatggaaaat tggatattgc atgtaataat gccggaatag gaggtccggc tgaattgaca
301 gaagattatc ctttagacgg ttggaaaaaa gtgattgata tcaacttcaa tggtgttttt
361 tatggatgta aatatcaatt gcaggcaatg gagaaaaatg gtggaggttt tattgtgaat
421 atggcctcaa tacacggtac agtagcggct cctatgagtt ctgcttatac ttctgcgaaa
481 catggtgttg tgggacttac aaaaaatatt ggagcagagt acggttcaaa aaatatccga
541 tgcaatgctg tgggacctgg ttatatcatg acaccattgt tgtcgaataa tttgagcgca
601 gattatctag aattattggt aacgaagcat ccaataggtc gtttaggaca gcctgaggaa
661 gttgcagaat tagttttatt tctaagttct gataaagcgt cttttatgac aggaggttac
721 tatcttgtag atggaggata tacagcagtt taa
SEQID NO.8
1 msilkdkvai vtgassgigk avaelyakeg akvvvsdide ergkevveqi kknggeaiff
61 kadtsspeev ealvkkavev ygkldiacnn agiggpaelt edypldgwkk vidinfngvf
121 ygckyqlqam ekngggfivn masihgtvaa pmssaytsak hgvvgltkni gaeygsknir
181 cnavgpgyim tpllsnnlsa dylellvtkh pigrlgqpee vaelvlflss dkasfmtggy
241 ylvdggytav
Claims (10)
1. A carbonyl reductase EbSDR8 mutant, which is characterized in that two-point combined mutation of asparagine at position 70 and serine at position 137 exists on the basis of an amino acid sequence shown as SEQ ID NO.2 of carbonyl reductase EbSDR 8; wherein, the 70 th asparagine is mutated into valine, the 137 th serine is mutated into phenylalanine, and the amino acid sequence of the mutant is shown in SEQ ID NO. 8.
2. The method for constructing the carbonyl reductase EbSDR8 mutant according to claim 1, which comprises the following steps:
(1) determining that the mutation site of carbonyl reductase EbSDR8 is asparagine 70 and phenylalanine 169 of the amino acid sequence shown in SEQ ID NO.2, designing a mutation primer, and performing mutation PCR;
(2) carrying out DpnI enzyme digestion treatment on the recombinant expression vector after PCR and transforming the recombinant expression vector into host microorganisms to obtain genetically engineered bacteria;
(3) inoculating the genetic engineering bacteria obtained in the step (2) into a culture medium for culture, and expressing the recombinant carbonyl reductase mutant under the induction of isopropyl-beta-D-thiogalactopyranoside.
3. The method for constructing carbonyl reductase EbSDR8 mutant according to claim 2, wherein the mutation primer of step (1) is:
N70V-F：CGAAGAGGTTGAAGCGTTGGTAAAAAAAG；
N70V-R：ACGCTTCAACCTCTTCGGGAGATGATGT；
S137F-F：GGAGGTTTTATTGTGAATATGGCCTCAAT；
S137F-R：CACAATAAAACCTCCACCATTTTTCTCCAT。
4. the method for constructing carbonyl reductase EbSDR8 mutant according to claim 2 or 3, wherein the reaction conditions of mutation PCR in the step (1) are as follows: pre-denaturation at 98 deg.C for 1 min; then the temperature is cycled for 20 times to be at 98 ℃, 10s, 55 ℃, 10s, 72 ℃ and 7min, and then the temperature is cooled to 4 ℃.
5. The method for constructing carbonyl reductase EbSDR8 mutant according to claim 2, wherein the step (3) is implemented by the following steps:
(a) the method comprises the following steps Inoculating the recombinant genetic engineering bacteria containing the coding gene of the carbonyl reductase EbSDR8 mutant to a slant culture medium containing 50 mu g/ml kanamycin, and culturing at 37 ℃ for 12-16 h to obtain slant bacteria;
(b) the method comprises the following steps Inoculating the slant thalli to a seed culture medium, and culturing at 37 ℃ for 8-10 h to obtain a seed solution;
(c) the method comprises the following steps Inoculating the seed solution into a sterile fermentation tank at the inoculation amount of 10% of the volume concentration, and performing fermentation culture at 37 ℃ to OD600When the concentration reaches 0.6-0.8, adding isopropyl- β -D-thiogalactopyranoside with the final concentration of 0.1-10 mM into the sterile fermentation tank for induction culture at 26 ℃.
6. The application of the carbonyl reductase EbSDR8 mutant in reduction of aliphatic latent chiral secondary ketone according to claim 1, characterized in that the aliphatic latent chiral secondary ketone is used as a substrate, the reaction is carried out in a conversion reaction system composed of a buffer solution with pH 5.5-10.5 at 20-50 ℃, and after the reaction is completed, the reaction solution is separated and purified to obtain a corresponding product.
7. The application of carbonyl reductase EbSDR8 mutant in reduction of aliphatic latent chiral secondary ketone as claimed in claim 6, wherein the initial concentration of aliphatic latent chiral secondary ketone in the conversion reaction system is 10-1000 mmol/L.
8. The application of the carbonyl reductase EbSDR8 mutant in reduction of aliphatic latent chiral secondary ketone in the claim 6 or 7, wherein the concentration of the carbonyl reductase EbSDR8 mutant in the conversion reaction system is 10-500 g/L, and the carbonyl reductase EbSDR8 mutant is provided in the form of wet thallus obtained by induction culture of genetically engineered bacteria containing the carbonyl reductase EbSDR8 mutant.
9. The use of carbonyl reductase EbSDR8 mutant in the reduction of aliphatic latent chiral secondary ketone as claimed in claim 8, wherein the conversion reaction system further comprises one or more organic solvents selected from dimethyl sulfoxide, isopropanol and methanol.
10. The use of carbonyl reductase EbSDR8 mutant in the reduction of aliphatic latent chiral secondary ketone as claimed in claim 8, wherein the organic solvent is isopropanol with a concentration of 30%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010296172.3A CN111575258B (en) | 2020-04-15 | 2020-04-15 | Carbonyl reductase EbSDR8 mutant and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010296172.3A CN111575258B (en) | 2020-04-15 | 2020-04-15 | Carbonyl reductase EbSDR8 mutant and construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111575258A true CN111575258A (en) | 2020-08-25 |
| CN111575258B CN111575258B (en) | 2023-07-04 |
Family
ID=72121196
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010296172.3A Active CN111575258B (en) | 2020-04-15 | 2020-04-15 | Carbonyl reductase EbSDR8 mutant and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111575258B (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105602913A (en) * | 2016-03-09 | 2016-05-25 | 浙江工业大学 | Restructuring carbonyl reductase mutant ReCR-Mut, encoding gene, engineering bacteria and application |
| CN108486075A (en) * | 2018-02-14 | 2018-09-04 | 浙江工业大学 | A kind of recombination carbonyl reduction enzyme mutant, gene, engineering bacteria and its application |
| CN109468291A (en) * | 2018-06-01 | 2019-03-15 | 杭州馨海生物科技有限公司 | A kind of carbonyl reductase EbSDR8 mutant and its construction method and application |
| CN109468346A (en) * | 2018-06-01 | 2019-03-15 | 杭州馨海生物科技有限公司 | The biological preparation method of one kind (S) -1- (the iodo- 5- fluorophenyl of 2-) ethyl alcohol |
| CN109468290A (en) * | 2018-06-01 | 2019-03-15 | 杭州馨海生物科技有限公司 | A kind of carbonyl reduction enzyme mutant, expression vector, engineering bacteria and its application |
| CN110592035A (en) * | 2019-08-29 | 2019-12-20 | 浙江大学 | Carbonyl reductase mutant, recombinant expression vector and application of carbonyl reductase mutant in production of chiral alcohol |
-
2020
- 2020-04-15 CN CN202010296172.3A patent/CN111575258B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105602913A (en) * | 2016-03-09 | 2016-05-25 | 浙江工业大学 | Restructuring carbonyl reductase mutant ReCR-Mut, encoding gene, engineering bacteria and application |
| CN108486075A (en) * | 2018-02-14 | 2018-09-04 | 浙江工业大学 | A kind of recombination carbonyl reduction enzyme mutant, gene, engineering bacteria and its application |
| CN109468291A (en) * | 2018-06-01 | 2019-03-15 | 杭州馨海生物科技有限公司 | A kind of carbonyl reductase EbSDR8 mutant and its construction method and application |
| CN109468346A (en) * | 2018-06-01 | 2019-03-15 | 杭州馨海生物科技有限公司 | The biological preparation method of one kind (S) -1- (the iodo- 5- fluorophenyl of 2-) ethyl alcohol |
| CN109468290A (en) * | 2018-06-01 | 2019-03-15 | 杭州馨海生物科技有限公司 | A kind of carbonyl reduction enzyme mutant, expression vector, engineering bacteria and its application |
| CN110592035A (en) * | 2019-08-29 | 2019-12-20 | 浙江大学 | Carbonyl reductase mutant, recombinant expression vector and application of carbonyl reductase mutant in production of chiral alcohol |
Non-Patent Citations (3)
| Title |
|---|
| AIPENG LI,等: "Structure-guided stereoselectivity inversion of a short-chain dehydrogenase/reductase towards halogenated acetophenones", 《CHEM COMMUN (CAMB)》 * |
| ZE-HUI SHAO 等: "Rational design of the carbonyl reductase EbSDR8 for efficient", 《APPLIED MICROBIOLOGY AND BIOTECHNOLOGY》 * |
| 李爱朋: "羰基还原酶的挖掘", 《中国博士学位论文全文数据库》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111575258B (en) | 2023-07-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107586763B (en) | Carbonyl reductase mutant, vector, engineering bacterium and application thereof | |
| CN109468291B (en) | Carbonyl reductase EbSDR8 mutant and construction method and application thereof | |
| CN108728421B (en) | Carbonyl reductase mutant and application thereof | |
| CN108048416B (en) | Improved ketoreductase mutant and preparation method and application thereof | |
| CN112877307B (en) | Amino acid dehydrogenase mutant and application thereof | |
| CN109055324B (en) | Improved ketoreductase and application thereof | |
| CN110396507B (en) | L-pantolactone dehydrogenase from Cneubacter physcomitrella | |
| CN109777788B (en) | Leucine dehydrogenase mutant and application thereof | |
| CN110592035B (en) | Carbonyl reductase mutant, recombinant expression vector and application of carbonyl reductase mutant in production of chiral alcohol | |
| CN111454918B (en) | Enol reductase mutant and application thereof in preparation of (R) -citronellal | |
| CN113817693B (en) | Short-chain carbonyl reductase PpYSDR mutant, encoding gene, recombinant expression vector, genetic engineering bacterium and application | |
| CN115433721B (en) | Carbonyl reductase mutant and application thereof | |
| CN108103049B (en) | Thermophilic L-asparaginase mutant and screening and fermenting method thereof | |
| CN114908129B (en) | Dehydrogenase for the preparation of (R) -4-chloro-3-hydroxybutyric acid ethyl ester | |
| CN111575258B (en) | Carbonyl reductase EbSDR8 mutant and construction method and application thereof | |
| CN115896081A (en) | Aspartase mutant and application thereof | |
| CN110396506B (en) | L-pantolactone dehydrogenase derived from Nocardia asteroids and use thereof | |
| KR101694582B1 (en) | A novel formaldehyde dehydrogenase and a method for formaldehyde production using the same | |
| CN113913399A (en) | Ketopantolactone reductase derived from Candida maltosa Xu316 | |
| CN109762801B (en) | Halogen alcohol dehalogenase mutant and application thereof in synthesizing chiral drug intermediate | |
| CN111019915B (en) | Application of carbonyl reductase mutant in synthesis of chiral ortho-halogenated-alpha-phenylethyl alcohol | |
| WO2005123921A1 (en) | Novel glycerol dehydrogenase, gene therefor, and method of utilizing the same | |
| CN113528475B (en) | Carbonyl reductase mutant and application thereof in preparation of steroid hormone testosterone | |
| CN110747190B (en) | Maleic acid hydratase mutant and application thereof | |
| CN110527671B (en) | L-pantolactone dehydrogenase derived from Nocardia farcina and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |