CN110747190B

CN110747190B - Maleic acid hydratase mutant and application thereof

Info

Publication number: CN110747190B
Application number: CN201911183796.8A
Authority: CN
Inventors: 范文超; 高书良; 王金刚; 袁圣伦
Original assignee: Zhejiang Huarui Biotechnology Co ltd
Current assignee: Zhejiang Huarui Biotechnology Co ltd
Priority date: 2019-11-27
Filing date: 2019-11-27
Publication date: 2021-03-09
Anticipated expiration: 2039-11-27
Also published as: CN110747190A

Abstract

The invention discloses a maleic acid hydratase mutant, the amino acid sequence of which is SEQ ID NO. 3, and compared with wild maleic acid hydratase, the mutant obviously improves the enzyme activity for catalyzing one-step hydration reaction of maleic acid to generate D-malic acid. When the whole cell expressing the maleic acid hydratase mutant is adopted to catalyze 100g/L maleic acid substrate to react to generate D-malic acid, the optical purity of the product exceeds 99 percent, and the method has industrial development and application prospects.

Description

Maleic acid hydratase mutant and application thereof

Technical Field

The invention belongs to the technical field of enzyme catalysis, and particularly relates to a maleic acid hydratase mutant and application thereof in catalyzing maleic acid hydration reaction to produce D-malic acid by an enzyme method.

Background

D-malic acid CAS 636-61-3, molecular weight 134, also known as 2-malic acid, is a rare organic acid in nature, and has wide application in the pharmaceutical industry, and D-malic acid is used as a chiral precursor mainly for synthesizing chiral drugs, and can be used as a raw material for synthesizing antibiotics, antiviral drugs, antihistamine drugs, and the like. The synthesis method of the D-malic acid can be generally synthesized and prepared by an asymmetric synthesis method, a racemate physical resolution method and a biological method. The existing biological methods mainly comprise a natural microorganism resolution method and a whole cell transformation method, and the two methods have the problems that the used microorganisms are difficult to ferment at high density, the substrate transformation rate is low, the optical purity of products is low and the like, so that the industrial production cost is high, and the market demand cannot be met.

As is known, Fumaric acid (Fumaric acid) and Maleic acid (Maleic acid) are both butenedioic acids, which differ in their steric structure, Fumaric acid being Fumaric acid in trans structure; maleic acid is maleic acid and has a cis structure, and the acidity of the maleic acid and the maleic acid is different. Maleic acid is also known as malic acid anhydride.

It is inspired by research that some fumaric acid hydratase (fumC) can also catalyze maleic acid to perform hydration reaction to generate D-malic acid, and we screened and compared fumaric acid hydratase from various sources, and found that the fumaric acid hydratase fumC from photosynthetic bacteria Rhodopseudomonas capsulata (Rhodopseudomonas capsulata) has the catalytic function, but the catalytic efficiency is not high, and the enzyme activity is judged to be low, so that the enzyme needs to be modified to obtain a mutant with high enzyme activity.

Disclosure of Invention

In order to explore the industrial feasibility of preparing D-malic acid by an enzyme catalysis method, the invention utilizes a genetic engineering technology to carry out directed evolution on a fumaric acid hydratase fumC gene (amino acid sequence is shown in UniProtKB-A0A507ZEG8) derived from photosynthetic bacteria Rhodopseudomonas capsulata, and screens mutants with high enzyme activity, thereby being beneficial to realizing the industrialization of producing D-malic acid by an enzyme method.

Therefore, the wild-type fumarate hydratase fumC or wild-type maleic acid hydratase (SEQ ID NO:1) is modified by technologies such as random mutation, semi-rational design and the like to obtain the maleic acid hydratase mutant with high enzyme activity, so that maleic acid is catalyzed to generate D-malic acid efficiently.

Therefore, it is a first object of the present invention to provide a mutant maleate hydratase having high enzymatic activity.

The second object of the present invention is to provide a gene encoding the above maleic acid hydratase mutant.

The third object of the present invention is to provide a plasmid containing the above gene.

The fourth object of the present invention is to provide a microorganism transformed with the above plasmid.

A fifth object of the present invention is to provide the use of the above mutant or microorganism in production.

In order to achieve the purpose, the invention provides the following technical scheme:

a maleic acid hydratase mutant has an amino acid sequence of SEQ ID NO. 3, and is a mutant in which T at position 78 in SEQ ID NO. 1 is replaced by N, Q at position 138 is replaced by P, V at position 150 is replaced by A, and P at position 312 is replaced by S, and the amino acid sequence is as follows:

MTATRTETDSFGPLEVPADKYWGAQTQRSIQNFPIGWERQPKPIIRALGVIKKAAALVNKAQGDLDPALADAIAAAANEVIEGKFDDNFPLVVWQTGSGTQSNMNANEVISNRAIEMLGGVMGSKKPVHPNDHVNMGPSSNDTFPTAMHAAIACHARDVLIPGLEKLSKALWAKSEEFKDIIKIGRTHTQDATPLTLGQEFSGYATQVDRGIERVKLALPHIYELAQGGTAVGTGLNTRVGWDTRIAAQIAEITGLPFVTAPNKFEALAAHDAMVFFSGALKTIAASLFKIANDMRLLGSGPRSGLGELILSENEPGSSIMPGKVNPTQAEALTMVCAHVMGNDAAIGFAGSQGHFELNVYNPMMSYNVLQSMQLLGDSASAFTDNMVVGTQANTARIDKLMKESLMLVTALAPTIGYDAATKVAKTAHKNGTTLREEAIALGYVDGETFDRVVRPEDMISPKG(SEQ ID NO:3)；

a gene encoding the above maleic acid hydratase mutant.

Preferably, the gene encoding the above maleic acid hydratase mutant SEQ ID NO. 3 may be the following nucleotide sequence:

ATGACCGCGACCCGCACCGAAACCGACAGCTTTGGCCCGCTCGAAGTTCCAGCCGATAAATATTGGGGCGCGCAGACCCAGCGCAGCATTCAGAACTTCCCAATCGGTTGGGAGCGCCAGCCGAAACCAATCATCCGCGCGCTGGGCGTGATCAAAAAAGCCGCCGCGCTCGTGAATAAAGCGCAAGGCGATCTGGATCCAGCGCTGGCCGATGCCATTGCCGCCGCCGCGAACGAAGTTATCGAAGGCAAGTTCGACGACAACTTCCCGCTGGTGGTTTGGCAAACCGGCAGCGGCACCCAAAGCAACATGAACGCGAACGAAGTGATCAGCAACCGCGCCATCGAGATGCTCGGTGGTGTGATGGGCAGCAAGAAGCCGGTTCATCCGAATGATCACGTGAACATGGGCCCGAGCAGCAACGATACCTTTCCAACCGCCATGCATGCGGCGATCGCGTGCCATGCGCGCGATGTTCTGATCCCGGGTCTGGAGAAACTGAGCAAAGCGCTGTGGGCCAAAAGCGAAGAATTCAAAGATATCATCAAGATCGGCCGCACGCACACCCAAGATGCCACCCCACTGACGCTGGGCCAAGAATTCAGTGGCTATGCCACCCAAGTTGACCGCGGCATTGAACGCGTTAAACTGGCGCTGCCGCATATCTACGAACTGGCGCAAGGTGGCACCGCCGTTGGCACCGGTCTGAATACCCGCGTTGGTTGGGATACGCGCATCGCGGCGCAAATCGCGGAAATCACCGGTCTGCCGTTTGTTACCGCGCCGAACAAATTCGAAGCGCTGGCGGCCCATGATGCGATGGTTTTCTTCAGCGGTGCGCTGAAAACCATCGCCGCCAGCCTCTTCAAGATCGCCAACGATATGCGTCTGCTGGGTAGTGGTCCACGCAGCGGTCTGGGTGAGCTGATTCTGTCGGAGAATGAGCCGGGCAGCAGCATTATGCCGGGCAAAGTTAATCCGACGCAAGCCGAAGCGCTGACGATGGTTTGCGCCCACGTTATGGGCAATGATGCCGCCATTGGTTTCGCCGGTAGCCAAGGCCACTTCGAGCTGAACGTGTACAACCCGATGATGAGCTACAACGTGCTGCAAAGCATGCAGCTGCTGGGTGACAGCGCCAGCGCCTTCACCGATAACATGGTTGTTGGCACCCAAGCCAATACCGCGCGTATCGACAAGCTCATGAAGGAGAGTCTGATGCTGGTTACGGCGCTGGCCCCAACCATCGGTTACGATGCGGCCACGAAAGTGGCGAAAACGGCGCACAAAAACGGTACCACGCTGCGCGAAGAAGCGATCGCGCTGGGTTACGTTGATGGCGAGACCTTCGATCGCGTGGTGCGCCCAGAAGACATGATCAGCCCAAAAGGCTAA(SEQ ID NO:4)。

a plasmid containing the gene. The plasmid contains a vector for expressing the above gene, and preferably the vector is of the pSH series, but is not limited thereto.

A microorganism transformed with the above plasmid, which can be used as a host for expressing the above maleic acid hydratase mutant.

Preferably, the above microorganism is selected from the group consisting of Escherichia coli, Pichia pastoris, Bacillus subtilis, preferably Escherichia coli, more preferably Escherichia coli BL21(DE 3).

The above-mentioned maleic acid hydratase mutant or the above-mentioned microorganism can be used for the production of D-malic acid.

In the production, the maleic acid substrate raw material is used, and the maleic acid hydratase mutant or microorganism is used as a catalyst to catalyze hydration reaction to obtain the product D-malic acid.

As an alternative embodiment, the microorganism may be in the form of a bacterial cell or a disrupted cell thereof as a catalyst for hydration reaction.

The D-malic acid can be produced by conventional process conditions, for example, the reaction temperature is selected from 20-40 deg.C, for example 25-35 deg.C.

The reaction system may be at pH7.0-8.0, for example, pH 7.5.

Compared with the wild maleic acid hydratase SEQ ID NO. 1, the enzyme activity of the maleic acid hydratase mutant SEQ ID NO. 3 constructed by the invention for catalyzing the hydration reaction of maleic acid is obviously improved. When the whole cell expressing the maleic acid hydratase mutant is adopted to catalyze 100g/L maleic acid substrate for hydration reaction, the optical purity of the product D-malic acid exceeds 99 percent (ee value), and the method has industrial development and application prospect

Detailed Description

The maleic acid hydratase mutant SEQ ID NO 3 constructed by the invention is a wild type fumaric acid hydratase (abbreviated as fumC) SEQ ID NO 1 mutant derived from photosynthetic bacteria Rhodopseudomonas capsulata (Rhodopseudomonas capsulata), and is a new protein formed after a plurality of amino acids in the sequence of SEQ ID NO 1 are replaced (T78N, Q138P, V150A and P312S). Wherein the coding gene of SEQ ID NO. 1 is the sequence SEQ ID NO. 2 in the sequence table.

Since the fumarate hydratase SEQ ID NO:1 has a function of catalyzing maleic acid to produce D-malic acid through a one-step hydration reaction, the fumarate hydratase (fumC) may also be referred to as a maleic acid hydratase in the present invention. Accordingly, the mutant of the fumaric acid hydratase SEQ ID NO. 1 is also referred to as a maleic acid hydratase mutant. It will be readily understood by those skilled in the art that the terminology is used uniformly for the purpose of enzyme-catalyzed function and that it is not mistaken that all fumarate hydratases will be referred to as maleate hydratases.

Thus, in the present invention, the terms "wild-type enzyme", "wild-type maleate hydratase", "wild-type fumarate hydratase" are used in the same sense and refer to the wild-type fumarate hydratase fumC derived from the photosynthetic bacterium Rhodopseudomonas capsulata (Rhodopseudomonas capsulata), the amino acid sequence of which is SEQ ID NO: 1.

For convenience, the amino acid abbreviations for proteins may be used in either the three or single letter English, as is well known to those skilled in the art, and are listed in the following table:

TABLE 1 amino acids Chinese and English controls and abbreviations

In order to obtain maleic acid hydratase with higher enzyme performance, the gene sequence SEQ ID NO. 1 of the invention is subjected to point mutation or mutation, and the gene sequence SEQ ID NO. 2 of the invention is subjected to point mutation or mutation. A series of mutants are obtained by error-prone PCR technology, and the amino acid substitution or deletion of some sites is found to cause significant change of the enzyme activity of the mutants. These include Thr at position 78, Gln at position 138, Val at position 150, Leu at position 219, Pro at position 312, and Glu at position 357. Experiments show that the enzyme activity of the mutant SEQ ID NO. 3 formed by replacing Thr at the 78 th position with Asn (T78N), replacing Gln at the 138 th position with Pro (Q138P), replacing Val at the 150 th position with Ala (V150A) and replacing Pro at the 312 th position with Ser (P312S) is obviously improved and is improved by more than 120 times compared with that of the wild-type enzyme SEQ ID NO. 1. In addition, the enzyme activities of the Q138P, V150A, P312S and E357N mutants are obviously improved by nearly 80 times compared with that of the wild-type enzyme SEQ ID NO. 1.

The maleic acid hydratase mutant of the invention has the amino acid number of only 464 and the structure is clear, so the encoding gene, the expression cassette and the plasmid containing the gene, and the transformant containing the plasmid can be easily obtained by the technicians in the field.

These genes, expression cassettes, plasmids, and transformants can be obtained by genetic engineering construction means well known to those skilled in the art.

The above-mentioned transformant host may be any microorganism suitable for expressing the mutant, including bacteria and fungi. Preferred microorganisms are Escherichia coli, Pichia pastoris, Bacillus subtilis, etc., preferably Escherichia coli, more preferably Escherichia coli BL21(DE 3).

When used as a biocatalyst for production, the mutant of the present invention may be in the form of an isolated enzyme or in the form of a bacterial cell. The form of the separated enzyme comprises free enzyme and immobilized enzyme, including purified enzyme, crude enzyme, fermentation liquor, enzyme fixed by a carrier, cell disruption product and the like; the form of the thallus comprises a viable thallus cell and a dead thallus cell.

As another alternative, the microbial somatic cells expressing the above mutant SEQ ID NO. 3 can be used as a biocatalyst for the enzyme-catalyzed reaction. The form of the thallus comprises live thallus and dead thallus, when microorganisms such as bacillus subtilis, pichia pastoris or escherichia coli are not fermented and proliferated any more but used for an enzyme catalysis reaction, the thallus is a natural immobilized enzyme, and can be used for the catalysis reaction as an enzyme preparation without crushing treatment or even extraction and purification treatment. Since the reaction substrate and the reaction product are both small molecular compounds and can easily pass through the cell membrane, which is a biological barrier of the cells, it is not necessary to crush the cells, which is economically advantageous.

The present invention will be described in further detail with reference to specific examples. It should be understood that the following examples are illustrative only and are not intended to limit the scope of the present invention.

The addition amount, content and concentration of various substances are referred to herein, wherein the percentage refers to the mass percentage unless otherwise specified.

Examples

Materials and methods

The whole gene synthesis, primer synthesis and sequencing in the examples were performed by Jinzhi Biotechnology, Inc., Suzhou.

The molecular biological experiments in the examples include plasmid construction, digestion, ligation, competent cell preparation, transformation, culture medium preparation, and the like, and are mainly performed with reference to "molecular cloning experimental manual" (third edition), sambrook, d.w. rasel (american), translation of huang peitang et al, scientific press, beijing, 2002). The specific experimental conditions can be determined by simple experiments if necessary.

PCR amplification experiments were performed according to the reaction conditions or kit instructions provided by the supplier of the plasmid or DNA template. If necessary, it can be adjusted by simple experiments.

LB culture medium: 10g/L tryptone, 5g/L yeast extract, 10g/L sodium chloride, pH 7.2. (20 g/L agar powder was additionally added to LB solid medium.)

TB culture medium: 24g/L yeast extract, 12g/L tryptone, 16.43g/L K₂HPO₄.3H₂O、2.31g/L KH₂PO₄5g/L of glycerol, and the pH value is 7.0-7.5. (20 g/L agar powder was additionally added to TB solid medium.)

HPLC determination conditions for substrate maleic acid and product D-malic acid:

detecting by using an Agilent high performance liquid chromatograph 1260 definition II, wherein a chromatographic column is a chiral chromatographic column Chiralpak-ic (4.6X250mm, 5um), standard products of D-malic acid and L-malic acid are used as reference substances, and a mobile phase is n-hexane: isopropyl alcohol: trifluoroacetic acid 80: 20: 0.1, the flow rate is 0.5ml/min, the sample amount is 100ul, the detection wavelength is 210nm, and the column temperature is 35 ℃.

Polarimeters are of the type: rudolph Autopol V.

Example 1 construction of wild-type maleate hydratase expression Strain

1.1 for the Rhodopseudomonas capsulata-derived fumarate hydratase fumC, the sequence SEQ ID NO:1 was synthesized from the reported amino acid sequence (UniProtKB-A0A507ZEG8) by E.coli codon frequency optimization, and was assigned to Souzhou Jinweizhi Biotechnology Limited for the entire gene sequence synthesis, and subcloned into pSH plasmid (Zhejiang Rui Biotechnology Limited) to obtain an expression vector pSH-fumC expressing the wild-type enzyme SEQ ID NO: 1.

Forward primer FumC-F: 5' -CATATGACCGCGACCCGCACCGA-3’，

Reverse primer FumC-R: 5' -CTCGAGTTAGCCTTTTGGGCTGATCA-3’。

Amplifying the fragment of about 1.4kb by PCR, wherein the PCR reaction system comprises: 0.3. mu.M each of the forward primer and the reverse primer, 50ng of template, 1XKOD Neo plus buffer, 0.2mM dNTP,1.5mM MgSO₄KOD neo plus 1U, double distilled water was added to make 50. mu.l of the total system. PCR conditions were as follows: 94 ℃ for 2 min; repeating 30 cycles at 98 deg.C for 10s, 55 deg.C for 30s, and 68 deg.C for 30 s; 10min at 68 ℃.

After the PCR reaction is finished, agarose gel electrophoresis identification is carried out, and fragments are recovered by a gel recovery kit. The plasmid vector pSH or FumC fragment was subjected to double digestion with NdeI and XhoI, respectively, in a digestion system: plasmid 37ul (or fragment 37 ul), 10 XBuffer 5 ul, NdeI 1.5 ul, XhoI 1.5 ul. After the enzyme digestion, fragments were recovered by using a gel recovery kit. Wherein the enzyme KOD Neo plus for PCR is purchased from Toyobo (Shanghai) Biotech Co., Ltd., and the Gel recovery Kit OMEGA Gel Extraction Kit D2500 is purchased from Guangzhou Feiyang bioengineering Co., Ltd.

1.2 transformation of the recombinant plasmid pSH-fumC into expression hosts such as E.coli BL21(DE3) competent cells (Invitrogen corporation) by electrotransformation, yielded recombinant E.coli expressing wild-type maleate hydratase. The recombinant plasmid pSH-fumC can also be transformed into other hosts such as Pichia pastoris, Bacillus subtilis, and the like to express a wild-type maleate hydratase.

Example 2 construction of library of fumC random mutation points by error-prone PCR and screening

2.1 construction of FumC random mutation site library by error-prone PCR method

The random mutant library is constructed by using error-prone PCR technology and taking the sequence SEQ ID NO. 1 as a template. The forward primer fumC-Nde1-F is 5'-ATGACCGCGACCCGCACCGA-3', and the reverse primer fumC-Xho1-R is 5-CTCGAGTTAGCCTTTTGGGCTGATCA-3’。

The 50 μ L error-prone PCR reaction system included: 50ng of plasmid template pSH-fumC, 30pmol of a pair of primers fumC-Nde1-F and fumC-Xho1-R, 1 XTaq buffer, 0.2mM dGTP, 0.2mM dATP, 1mM dCTP, 1mM dTTP, 7mM MgCl₂，(0mM、0.05mM、0.1mM、0.15mM、0.2mM)MnCl₂2.5 units of Taq enzyme (Fermentas).

The PCR reaction conditions are as follows: 5min at 95 ℃; 94 ℃ for 30s, 55 ℃ for 30s, 72 ℃ for 2 min/kbp; 30 cycles; 10min at 72 ℃.

Gel 2.0kb random mutant fragment was recovered as a large primer, and Megaprimer PCR was performed using KOD-plus DNA polymerase: 5min at 94 ℃; 10s at 98 ℃, 30s at 60 ℃, 2min/kbp at 68 ℃ and 25 cycles; 10min at 68 ℃. DpnI digestion of plasmid template, electrotransformation of E.coli BL21(DE3) to yield more than 10⁴Random mutant pools of individual clones.

2.2 high throughput screening of mutant pools

Transformants in the mutant pool were selected, inoculated into a 96-well deep-well plate containing 700. mu.L of LB medium containing 100. mu.g/mL kanamycin, cultured at 37 ℃ for 6 hours, added with 0.1mM IPTG at the final concentration, cooled to 25 ℃ and cultured overnight. Centrifuging at 5000rpm for 10min, discarding supernatant, freezing at-70 deg.C for 1h, and thawing at room temperature for 30 min. 200. mu.L of 50mM Tris-HCl (pH7.5) was added thereto, and the cells were resuspended for determination of maleic acid hydratase activity.

The enzyme activity determination reaction system comprises: the whole cell or crude cell wall-broken enzyme solution with the cell concentration of 2% v/v, 100mM maleic acid and 50mM Tris-HCl, the pH value is adjusted to 7.5, and the reaction is carried out at the temperature of 25 ℃.

Definition of enzyme activity unit: the amount of enzyme required to catalyze the production of 1 micromole (. mu.mol) of D-malic acid per minute from the substrate maleic acid at pH7.5 at a temperature of 25 ℃ is defined as 1 unit (U).

2.3 determination and screening of high enzyme Activity mutants

Substrate reaction solution: the pH was adjusted by adding 100mM maleic acid, 50mM Tris-HCl.

Terminating the reaction solution: 1M NaOH solution.

mu.L of the enzyme solution obtained in step 2.2 was added to 80. mu.L of the substrate reaction solution, reacted at 25 ℃ for 2 hours, 40. mu.L of the reaction-terminating solution was added, and then centrifuged at 5000rpm for 10 min. Centrifuging to obtain supernatant, detecting the yield of D-malic acid by HPLC, and calculating enzyme activity.

From the random mutation library, through screening of about 1000 mutant clones, sequencing shows that the amino acid substitution of some sites can cause the enzyme activity of the mutant to change significantly, and the sites comprise Thr at the 78 th position, Gln at the 138 th position, Val at the 150 th position, Leu at the 219 th position, Pro at the 312 th position and Glu at the 357 th position. The results of sequencing the mutants partially mutated in the forward direction are shown in table 2.

TABLE 2 catalytic maleic acid invertase Activity of various fumC mutants

Specific activity of enzyme: the ratio of the fermentation activity (U/ml) of the wild enzyme to the OD (OD/ml) of the thallus concentration is 100%.

The experimental results in Table 2 show that the enzyme activity of the mutant fumC-1480 (i.e., SEQ ID NO:3) formed by the mutations T78N, Q138P, V150A and P312S is obviously improved by 120 times compared with that of the wild-type enzyme SEQ ID NO: 1. In addition, the enzyme activities of the Q138P, V150A, P312S and E357N mutant fumC-584 are also obviously improved by nearly 80 times compared with the wild enzyme SEQ ID NO 1.

Example 3 mutant Strain construction

We focused on mutant fumC-1480 to investigate its catalytic conversion of maleic acid to D-malic acid by a one-step hydration reaction. For this purpose, the mutant gene SEQ ID NO. 4 of fumC-1480 was cloned into pSH plasmid to obtain expression vector pSH-fumC-1480 expressing the maleic acid hydratase mutant SEQ ID NO. 3.

The plasmid pSH-fumC-1480 can be constructed into different expression systems, such as Escherichia coli, Pichia pastoris, Bacillus subtilis and the like. For example, BL21(DE3) competent cells transformed with plasmid pSH-fumC-1480 were plated on kan + LB plate, cultured overnight at 37 ℃, 10 single colonies were selected, inoculated into a test tube containing LB liquid medium, cultured overnight at 37 ℃, centrifuged to collect the cells, the plasmid was extracted, and gene sequencing was performed to confirm the correct mutation, thereby obtaining engineered bacterium fumC-1480.

EXAMPLE 4 Strain fermentation and reactions

4.1 selecting a single clone from an LB plate of the engineering bacterium fumC-1480, inoculating the single clone into 5ml of LB culture medium, and culturing at 37 ℃ to obtain a supernatant; inoculating into 1000ml shake flask containing 100ml TB medium at 1% v/v ratio, culturing at 37 deg.C and 220rpm for 4-6 hr, and adjusting OD₆₀₀When the value reaches 1.2-1.5, adding 0.2mM IPTG for induction; then the temperature is reduced to 25 ℃ for further culture for 10 to 16 hours, and the thalli are obtained by centrifugation and are frozen and stored for 24 hours at the temperature of minus 80 ℃ for standby.

4.2 adopting a reaction system of 200mL, the concentration of maleic acid as a substrate of 100g/L, the enzyme addition amount of 2%, 4%, 6% and 8% v/v bacteria concentration respectively, controlling the temperature of 25 ℃, 200rpm and the pH value of 7.5, reacting for 5h, measuring the generation amount of D-malic acid, and calculating the conversion rate of the substrate and the ee value of the product. The results are shown in Table 3.

TABLE 3 mutant enzyme with different enzyme amounts, fumC-1480, catalyzing maleic acid to obtain D-malic acid

In conclusion, compared with wild maleic acid hydratase, the maleic acid hydratase mutant SEQ ID NO 3 constructed by the invention has the advantages that the enzyme activity of catalyzing maleic acid hydration reaction to generate D-malic acid is obviously improved by more than 120 times, the optical purity (ee value) of the product can exceed 99 percent, and the industrial development and application prospects are realized.

Sequence listing

<110> Zhejiang HuaRui Biotechnology Ltd

<120> a maleate hydratase mutant and uses thereof

<130> SHPI1910726

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 464

<212> PRT

<213> Rhodopseudomonas capsulata

<400> 1

Met Thr Ala Thr Arg Thr Glu Thr Asp Ser Phe Gly Pro Leu Glu Val

1 5 10 15

Pro Ala Asp Lys Tyr Trp Gly Ala Gln Thr Gln Arg Ser Ile Gln Asn

20 25 30

Phe Pro Ile Gly Trp Glu Arg Gln Pro Lys Pro Ile Ile Arg Ala Leu

35 40 45

Gly Val Ile Lys Lys Ala Ala Ala Leu Val Asn Lys Ala Gln Gly Asp

50 55 60

Leu Asp Pro Ala Leu Ala Asp Ala Ile Ala Ala Ala Ala Thr Glu Val

65 70 75 80

Ile Glu Gly Lys Phe Asp Asp Asn Phe Pro Leu Val Val Trp Gln Thr

85 90 95

Gly Ser Gly Thr Gln Ser Asn Met Asn Ala Asn Glu Val Ile Ser Asn

100 105 110

Arg Ala Ile Glu Met Leu Gly Gly Val Met Gly Ser Lys Lys Pro Val

115 120 125

His Pro Asn Asp His Val Asn Met Gly Gln Ser Ser Asn Asp Thr Phe

130 135 140

Pro Thr Ala Met His Val Ala Ile Ala Cys His Ala Arg Asp Val Leu

145 150 155 160

Ile Pro Gly Leu Glu Lys Leu Ser Lys Ala Leu Trp Ala Lys Ser Glu

165 170 175

Glu Phe Lys Asp Ile Ile Lys Ile Gly Arg Thr His Thr Gln Asp Ala

180 185 190

Thr Pro Leu Thr Leu Gly Gln Glu Phe Ser Gly Tyr Ala Thr Gln Val

195 200 205

Asp Arg Gly Ile Glu Arg Val Lys Leu Ala Leu Pro His Ile Tyr Glu

210 215 220

Leu Ala Gln Gly Gly Thr Ala Val Gly Thr Gly Leu Asn Thr Arg Val

225 230 235 240

Gly Trp Asp Thr Arg Ile Ala Ala Gln Ile Ala Glu Ile Thr Gly Leu

245 250 255

Pro Phe Val Thr Ala Pro Asn Lys Phe Glu Ala Leu Ala Ala His Asp

260 265 270

Ala Met Val Phe Phe Ser Gly Ala Leu Lys Thr Ile Ala Ala Ser Leu

275 280 285

Phe Lys Ile Ala Asn Asp Met Arg Leu Leu Gly Ser Gly Pro Arg Ser

290 295 300

Gly Leu Gly Glu Leu Ile Leu Pro Glu Asn Glu Pro Gly Ser Ser Ile

305 310 315 320

Met Pro Gly Lys Val Asn Pro Thr Gln Ala Glu Ala Leu Thr Met Val

325 330 335

Cys Ala His Val Met Gly Asn Asp Ala Ala Ile Gly Phe Ala Gly Ser

340 345 350

Gln Gly His Phe Glu Leu Asn Val Tyr Asn Pro Met Met Ser Tyr Asn

355 360 365

Val Leu Gln Ser Met Gln Leu Leu Gly Asp Ser Ala Ser Ala Phe Thr

370 375 380

Asp Asn Met Val Val Gly Thr Gln Ala Asn Thr Ala Arg Ile Asp Lys

385 390 395 400

Leu Met Lys Glu Ser Leu Met Leu Val Thr Ala Leu Ala Pro Thr Ile

405 410 415

Gly Tyr Asp Ala Ala Thr Lys Val Ala Lys Thr Ala His Lys Asn Gly

420 425 430

Thr Thr Leu Arg Glu Glu Ala Ile Ala Leu Gly Tyr Val Asp Gly Glu

435 440 445

Thr Phe Asp Arg Val Val Arg Pro Glu Asp Met Ile Ser Pro Lys Gly

450 455 460

<210> 2

<211> 1395

<212> DNA

<213> Artificial sequence ()

<400> 2

atgaccgcga cccgcaccga aaccgacagc tttggcccgc tcgaagttcc agccgataaa 60

tattggggcg cgcagaccca gcgcagcatt cagaacttcc caatcggttg ggagcgccag 120

ccgaaaccaa tcatccgcgc gctgggcgtg atcaaaaaag ccgccgcgct cgtgaataaa 180

gcgcaaggcg atctggatcc agcgctggcc gatgccattg ccgccgccgc gaccgaagtt 240

atcgaaggca agttcgacga caacttcccg ctggtggttt ggcaaaccgg cagcggcacc 300

caaagcaaca tgaacgcgaa cgaagtgatc agcaaccgcg ccatcgagat gctcggtggt 360

gtgatgggca gcaagaagcc ggttcatccg aatgatcacg tgaacatggg ccagagcagc 420

aacgatacct ttccaaccgc catgcatgtg gcgatcgcgt gccatgcgcg cgatgttctg 480

atcccgggtc tggagaaact gagcaaagcg ctgtgggcca aaagcgaaga attcaaagat 540

atcatcaaga tcggccgcac gcacacccaa gatgccaccc cactgacgct gggccaagaa 600

ttcagtggct atgccaccca agttgaccgc ggcattgaac gcgttaaact ggcgctgccg 660

catatctacg aactggcgca aggtggcacc gccgttggca ccggtctgaa tacccgcgtt 720

ggttgggata cgcgcatcgc ggcgcaaatc gcggaaatca ccggtctgcc gtttgttacc 780

gcgccgaaca aattcgaagc gctggcggcc catgatgcga tggttttctt cagcggtgcg 840

ctgaaaacca tcgccgccag cctcttcaag atcgccaacg atatgcgtct gctgggtagt 900

ggtccacgca gcggtctggg tgagctgatt ctgccggaga atgagccggg cagcagcatt 960

atgccgggca aagttaatcc gacgcaagcc gaagcgctga cgatggtttg cgcccacgtt 1020

atgggcaatg atgccgccat tggtttcgcc ggtagccaag gccacttcga gctgaacgtg 1080

tacaacccga tgatgagcta caacgtgctg caaagcatgc agctgctggg tgacagcgcc 1140

agcgccttca ccgataacat ggttgttggc acccaagcca ataccgcgcg tatcgacaag 1200

ctcatgaagg agagtctgat gctggttacg gcgctggccc caaccatcgg ttacgatgcg 1260

gccacgaaag tggcgaaaac ggcgcacaaa aacggtacca cgctgcgcga agaagcgatc 1320

gcgctgggtt acgttgatgg cgagaccttc gatcgcgtgg tgcgcccaga agacatgatc 1380

agcccaaaag gctaa 1395

<210> 3

<211> 464

<212> PRT

<213> Artificial sequence ()

<400> 3

Met Thr Ala Thr Arg Thr Glu Thr Asp Ser Phe Gly Pro Leu Glu Val

1 5 10 15

Pro Ala Asp Lys Tyr Trp Gly Ala Gln Thr Gln Arg Ser Ile Gln Asn

20 25 30

Phe Pro Ile Gly Trp Glu Arg Gln Pro Lys Pro Ile Ile Arg Ala Leu

35 40 45

Gly Val Ile Lys Lys Ala Ala Ala Leu Val Asn Lys Ala Gln Gly Asp

50 55 60

Leu Asp Pro Ala Leu Ala Asp Ala Ile Ala Ala Ala Ala Asn Glu Val

65 70 75 80

Ile Glu Gly Lys Phe Asp Asp Asn Phe Pro Leu Val Val Trp Gln Thr

85 90 95

Gly Ser Gly Thr Gln Ser Asn Met Asn Ala Asn Glu Val Ile Ser Asn

100 105 110

Arg Ala Ile Glu Met Leu Gly Gly Val Met Gly Ser Lys Lys Pro Val

115 120 125

His Pro Asn Asp His Val Asn Met Gly Pro Ser Ser Asn Asp Thr Phe

130 135 140

Pro Thr Ala Met His Ala Ala Ile Ala Cys His Ala Arg Asp Val Leu

145 150 155 160

Ile Pro Gly Leu Glu Lys Leu Ser Lys Ala Leu Trp Ala Lys Ser Glu

165 170 175

Glu Phe Lys Asp Ile Ile Lys Ile Gly Arg Thr His Thr Gln Asp Ala

180 185 190

Thr Pro Leu Thr Leu Gly Gln Glu Phe Ser Gly Tyr Ala Thr Gln Val

195 200 205

Asp Arg Gly Ile Glu Arg Val Lys Leu Ala Leu Pro His Ile Tyr Glu

210 215 220

Leu Ala Gln Gly Gly Thr Ala Val Gly Thr Gly Leu Asn Thr Arg Val

225 230 235 240

Gly Trp Asp Thr Arg Ile Ala Ala Gln Ile Ala Glu Ile Thr Gly Leu

245 250 255

Pro Phe Val Thr Ala Pro Asn Lys Phe Glu Ala Leu Ala Ala His Asp

260 265 270

Ala Met Val Phe Phe Ser Gly Ala Leu Lys Thr Ile Ala Ala Ser Leu

275 280 285

Phe Lys Ile Ala Asn Asp Met Arg Leu Leu Gly Ser Gly Pro Arg Ser

290 295 300

Gly Leu Gly Glu Leu Ile Leu Ser Glu Asn Glu Pro Gly Ser Ser Ile

305 310 315 320

Met Pro Gly Lys Val Asn Pro Thr Gln Ala Glu Ala Leu Thr Met Val

325 330 335

Cys Ala His Val Met Gly Asn Asp Ala Ala Ile Gly Phe Ala Gly Ser

340 345 350

Gln Gly His Phe Glu Leu Asn Val Tyr Asn Pro Met Met Ser Tyr Asn

355 360 365

Val Leu Gln Ser Met Gln Leu Leu Gly Asp Ser Ala Ser Ala Phe Thr

370 375 380

Asp Asn Met Val Val Gly Thr Gln Ala Asn Thr Ala Arg Ile Asp Lys

385 390 395 400

Leu Met Lys Glu Ser Leu Met Leu Val Thr Ala Leu Ala Pro Thr Ile

405 410 415

Gly Tyr Asp Ala Ala Thr Lys Val Ala Lys Thr Ala His Lys Asn Gly

420 425 430

Thr Thr Leu Arg Glu Glu Ala Ile Ala Leu Gly Tyr Val Asp Gly Glu

435 440 445

Thr Phe Asp Arg Val Val Arg Pro Glu Asp Met Ile Ser Pro Lys Gly

450 455 460

<210> 4

<211> 1395

<212> DNA

<213> Artificial sequence ()

<400> 4

atgaccgcga cccgcaccga aaccgacagc tttggcccgc tcgaagttcc agccgataaa 60

tattggggcg cgcagaccca gcgcagcatt cagaacttcc caatcggttg ggagcgccag 120

ccgaaaccaa tcatccgcgc gctgggcgtg atcaaaaaag ccgccgcgct cgtgaataaa 180

gcgcaaggcg atctggatcc agcgctggcc gatgccattg ccgccgccgc gaacgaagtt 240

atcgaaggca agttcgacga caacttcccg ctggtggttt ggcaaaccgg cagcggcacc 300

caaagcaaca tgaacgcgaa cgaagtgatc agcaaccgcg ccatcgagat gctcggtggt 360

gtgatgggca gcaagaagcc ggttcatccg aatgatcacg tgaacatggg cccgagcagc 420

aacgatacct ttccaaccgc catgcatgcg gcgatcgcgt gccatgcgcg cgatgttctg 480

atcccgggtc tggagaaact gagcaaagcg ctgtgggcca aaagcgaaga attcaaagat 540

atcatcaaga tcggccgcac gcacacccaa gatgccaccc cactgacgct gggccaagaa 600

ttcagtggct atgccaccca agttgaccgc ggcattgaac gcgttaaact ggcgctgccg 660

catatctacg aactggcgca aggtggcacc gccgttggca ccggtctgaa tacccgcgtt 720

ggttgggata cgcgcatcgc ggcgcaaatc gcggaaatca ccggtctgcc gtttgttacc 780

gcgccgaaca aattcgaagc gctggcggcc catgatgcga tggttttctt cagcggtgcg 840

ctgaaaacca tcgccgccag cctcttcaag atcgccaacg atatgcgtct gctgggtagt 900

ggtccacgca gcggtctggg tgagctgatt ctgtcggaga atgagccggg cagcagcatt 960

atgccgggca aagttaatcc gacgcaagcc gaagcgctga cgatggtttg cgcccacgtt 1020

atgggcaatg atgccgccat tggtttcgcc ggtagccaag gccacttcga gctgaacgtg 1080

tacaacccga tgatgagcta caacgtgctg caaagcatgc agctgctggg tgacagcgcc 1140

agcgccttca ccgataacat ggttgttggc acccaagcca ataccgcgcg tatcgacaag 1200

ctcatgaagg agagtctgat gctggttacg gcgctggccc caaccatcgg ttacgatgcg 1260

gccacgaaag tggcgaaaac ggcgcacaaa aacggtacca cgctgcgcga agaagcgatc 1320

gcgctgggtt acgttgatgg cgagaccttc gatcgcgtgg tgcgcccaga agacatgatc 1380

agcccaaaag gctaa 1395

Claims

1. A maleic acid hydratase mutant has an amino acid sequence of SEQ ID NO. 3.

2. A gene encoding the mutant maleate hydratase of claim 1.

3. The gene of claim 2 wherein the nucleotide sequence is SEQ ID NO 4.

4. A plasmid comprising the gene of claim 3.

5. A microorganism transformed with the plasmid of claim 4.

6. The microorganism according to claim 5, wherein the microorganism is selected from the group consisting of Escherichia coli, Pichia pastoris and Bacillus subtilis.

7. The microorganism according to claim 6, wherein the microorganism is Escherichia coli BL21(DE 3).

8. Use of a mutant maleate hydratase according to claim 1 or a microorganism according to claim 6 for the production of D-malic acid.

9. Use according to claim 8, for the catalytic production of D-malic acid using maleic acid as a substrate for the reaction, using a mutant maleate hydratase according to claim 1, or using a microorganism according to claim 6.

10. The use according to claim 9, wherein the concentration of the substrate maleic acid in the reaction system is 100 g/L.