CN115925853A - Tobacco axillary bud initiation-controlling NtDA1 protein and related biological material and application thereof - Google Patents
Tobacco axillary bud initiation-controlling NtDA1 protein and related biological material and application thereof Download PDFInfo
- Publication number
- CN115925853A CN115925853A CN202211537032.6A CN202211537032A CN115925853A CN 115925853 A CN115925853 A CN 115925853A CN 202211537032 A CN202211537032 A CN 202211537032A CN 115925853 A CN115925853 A CN 115925853A
- Authority
- CN
- China
- Prior art keywords
- ntda1
- protein
- tobacco
- gene
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of plant genetic engineering, and discloses NtDA1 protein for controlling axillary bud initiation by tobacco, a related biological material and application thereof, wherein the NtDA1 protein comprises NtDA1-1 with a sequence shown as SEQ ID NO.1 and NtDA1-2 with a sequence shown as SEQ ID NO.2, and gene sequences for coding the protein are respectively shown as SEQ ID NO.3 and SEQ ID NO. 4. Experiments prove that the NtDA1 protein plays an important role in the initial development of the axillary buds of the tobacco, and the gene editing vector is used for constructing a transgenic mutant strain with NtDA1/2 double-gene deletion, so that the number of the axillary buds of the tobacco is reduced relative to that of a wild type after topping. Therefore, the NtDA1 protein and the gene provided by the invention have important significance for constructing tobacco varieties for inhibiting the growth of axillary buds.
Description
Technical Field
The invention belongs to the technical field of plant genetic engineering, and particularly relates to a protein for controlling axillary buds by tobacco, a related biological material and application thereof.
Background
At present, the formation of plant lateral branches not only affects the plant type of plants, but also affects the yield of crops. As an important economic crop, in order to ensure the yield and quality of tobacco leaves, the tobacco leaves are topped in production during the reproductive growth period, and medicines are coated on axillary buds to inhibit the growth of the axillary buds, so that a large amount of manpower and material resources are consumed. At present, no reports related to tobacco varieties capable of inhibiting the growth of axillary buds exist.
The DA1 gene is widely distributed in plants, and the Arabidopsis DA1 and DAR1 genes play an important role in the process of regulating and controlling the initial development of plant axillary buds. In Arabidopsis, when DA1 and DAR1 genes were knocked out simultaneously, the number of axillary buds of the mutant was less than that of the wild type. Therefore, it is of great significance to create DA1 mutants in tobacco.
Disclosure of Invention
In view of the above, the present invention aims to discover a DA1 gene associated with tobacco axillary buds and create a new tobacco variety capable of inhibiting the growth of the axillary buds.
In order to achieve the above purpose, the technical scheme of the invention is as follows:
in a first aspect, the present invention provides an NtDA1 protein associated with tobacco control of axillary bud initiation, the protein being a protein of A1), A2) or A3) as follows:
a1 NtDA1-1 protein and the amino acid sequence thereof is shown in SEQ ID NO. 1;
a2 NtDA1-2 protein and the amino acid sequence thereof is shown as SEQ ID NO. 2;
a3 A fusion protein obtained by attaching a protein tag to the N-terminus or/and C-terminus of A1) or A2).
The tobacco axillary bud initiation controlling NtDA1 protein provided by the invention controls the tobacco axillary bud initiation development, wherein NtDA1-1 and NtDA1-2 are both expressed in high amount in corolla, ntDA1-1 is highly expressed in veins, and NtDA1-2 is highly expressed in stamens.
The second aspect of the present invention provides a biomaterial related to the above protein, specifically including any one of B1) to B4):
b1 Nucleic acid molecules encoding the above proteins;
b2 A recombinant vector or a recombinant microorganism containing the nucleic acid molecule according to B1);
b3 Substances for silencing or suppressing the expression of genes encoding the NtDA1-1 protein and the NtDA1-2 protein in tobacco or knocking out the genes encoding the NtDA1-1 protein and the NtDA1-2 protein;
b4 Substances for reducing or inhibiting the activity and/or content of the NtDA1-1 protein and the NtDA1-2 protein in the plant of interest.
Further, in the biological material, the nucleic acid molecule of B1) is an NtDA1-1 gene with a sequence shown in SEQ ID NO.3 and/or an NtDA1-2 gene with a sequence shown in SEQ ID NO. 4.
Further, in the above-mentioned biomaterial, B3) the substance in which the genes encoding the NtDA1-1 protein and the NtDA1-2 protein are knocked out is a gene editing vector or a recombinant microorganism containing the vector; wherein the gene editing vector comprises a target site knockout sequence designed according to the NtDA1-1 gene and the NtDA1-2 gene.
Further, in the above-mentioned biological material, the knockout primer sequence designed based on the knockout sequence of the target site is as follows:
Nt sgRNA 1-F：5’-GAGGATCACCAATCTACACC-3’(SEQ ID NO.9)，
Nt sgRNA 1-R：5’-GGTGTAGATTGGTGATCCTC-3’(SEQ ID NO.10)；
Nt sgRNA 2-F：5’-AGGATCACCAATCTACACCT-3’(SEQ ID NO.11)，
Nt sgRNA 2-R：5’-AGGTGTAGATTGGTGATCCT-3’(SEQ ID NO.12)；
Nt sgRNA 3-F：5’-ACAACTTGCCAGAGCTCTGC-3’(SEQ ID NO.13)，
Nt sgRNA 3-R：5’-GCAGAGCTCTGGCAAGTTGT3’(SEQ ID NO.14)。
the third aspect of the invention provides an application of the protein or the biological material in breeding new varieties of tobacco, which comprises the following specific steps: tobacco varieties with more or less axillary buds controlled are obtained by highly expressing or inhibiting the expression of NtDA1-1 and NtDA1-2 in tobacco.
The fourth aspect of the invention provides a preparation method of tobacco low axillary bud plants, in particular to a method A or a method B;
the method A comprises the following steps: reducing or inhibiting the activity and/or content of NtDA1-1 protein and NtDA1-2 protein in tobacco;
the method B comprises the following steps: silence or inhibit the expression of the gene coding the NtDA1-1 protein and the NtDA1-2 protein in the tobacco or knock out the gene coding the NtDA1-1 protein and the NtDA1-2 protein.
Further, in the above preparation method, method B specifically is: mutating the gene encoding the NtDA1-1 protein or the NtDA1-2 protein in the target plant reduces the expression level of the gene encoding the protein in tobacco or causes the function of the gene encoding the NtDA1-1 protein or the NtDA1-2 protein in tobacco to be lost.
Furthermore, in the preparation method, the gene editing vector is introduced into the tobacco to obtain the tobacco mutant with double gene knockout of NtDA1-1 and NtDA1-2, so that the reduction of the leaf axillary buds after topping of the tobacco is realized; wherein the gene editing vector comprises a target site knockout sequence designed according to the NtDA1-1 gene and the NtDA1-2 gene.
In one embodiment of the present invention, the sequence of the knockout primer designed according to the knockout sequence of the target site is shown as SEQ ID No. 9-14.
The beneficial effects of the invention are as follows: the invention explores the tobacco NtDA1-1/2 protein for controlling the initiation of tobacco axillary buds and the coding gene thereof, and RT-PCR analysis shows that the NtDA1-1 and the NtDA1-2 are highly expressed in corolla, the NtDA1-1 is highly expressed in veins, and the NtDA1-2 is highly expressed in stamens; further adopting CRISPR/Cas9 technology to obtain the NtDA1-1 and NtDA1-2 double-gene knockout mutant strain, the number of axillary buds after topping is less than that of a wild type, which indicates that the NtDA1 plays an important role in the axillary bud development of tobacco, so that the plant can be subjected to variety breeding by utilizing the NtDA1 gene. In addition, the knockout primer sequence provided by the invention has high knockout efficiency.
Drawings
FIG. 1 is a diagram showing the analysis of the expression levels of the genes NtDA1-1 and NtDA1-2 in different tissues of tobacco;
FIG. 2 is a schematic diagram of target site design for NtDA1-1 and NtDA1-2 gene knockout;
FIG. 3 is a phenotype map of the T1 generation transgenic line NtDA1 mutant prepared in example 4.
Detailed Description
In order to make the technical problems, technical solutions and advantageous effects of the present invention more clearly understood, the present invention is further described in detail below with reference to the accompanying drawings and embodiments. It should be apparent that the described embodiments are only some embodiments of the present invention, and not all embodiments.
In the following examples, unless otherwise specified, all the methods are conventional; the reagents and materials are commercially available unless otherwise specified.
The following examples relate to the following biological materials, assay reagents and consumables:
(1) Biological material:
tobacco variety: the seeds of Honghuadajinyuan are provided by national key laboratories of silkworm genome biology at southwest university.
Carrier: the CRISPR/Cas9 basic knockout vector is provided by national emphasis laboratories of Bombyx mori genome biology at the university of southwest.
Zero Cloning Kit vector from Beijing Quanji Biotech Ltd.
The strain is as follows: trans1-T1 chemically competent cells, LBA4404 Agrobacterium chemically competent cells, were purchased from Beijing Quanjin Biotechnology, inc.
(2) Primers and sequencing: primer synthesis and DNA sequencing are completed by Beijing Hua Dagen.
(3) Experimental reagent: plant DNA extraction Kit Easypure Plant Genomic DNA Kit (containing RNase A) and DNA purification Kit
PCR Purification Kit PCRs were purchased from Beijing Quanji corporation; RNA extraction->
reagent (Invitrogen, USA); kit for reverse transcription>
One-Step gDNA Removal and cDNA Synthesis SuperMix, purchased from Kyoto Kogyo gold, inc.; t4 ligase, restriction enzyme BsaI (NEB), DNA Amplifier enzyme, primeSTAR Max DNA polymerase from Takara.
(4) Experimental equipment: PCR amplification apparatus Veriti (Gene Co., ltd.); gel imaging system ultraviolet gel imager (BIO-RAD); quantitative PCR instrument, ABI 7500fast real-time PCR system (Saimeri fly).
EXAMPLE 1 cloning of NtDA1 Gene
Through a large amount of sequence analysis and function analysis, the invention discovers two NtDA1 genes for controlling axillary bud initiation from tobacco and marks the two NtDA1 genes as an NtDA1-1 gene and an NtDA1-2 gene; wherein the nucleotide sequence of the NtDA1-1 gene is shown in SEQ ID NO.3, and the amino acid sequence of the encoded NtDA1-1 protein is shown in SEQ ID NO. 1; the nucleotide sequence of the NtDA1-2 gene is shown as SEQ ID NO.4, and the amino acid sequence of the encoded NtDA1-2 protein is shown as SEQ ID NO. 2.
The procedure for cloning the NtDA1 gene described above in this example was as follows:
(1) And (3) preparing a cDNA template.
Total RNA was extracted using the Beijing Quantum gold organism EasyPure Plant RNA Kit extraction Kit. And using BeijingFull-type gold reverse transcription kit
The One-Step gDNA Removal and cDNA Synthesis SuperMix kit reverses RNA and is operated according to the kit steps.
(2) And amplifying and recovering PCR products.
Primers were designed using Primer5, and the sequences of the primers were as follows:
CDS-NtDA1-1-F：5’-ATGACTGGCAGCTCAAATCC-3’(SEQ ID NO.5)，
CDS-NtDA1-1-R：5’-TCAAAAAGGAAATGTTCCTGTC-3’(SEQ ID NO.6)；
CDS-NtDA1-2-F：5’-ATGGGCTGGCTGAGCAAA-3’(SEQ ID NO.7)，
CDS-NtDA1-2-R：5’-TCAAAAAGGAAATGTTCCTGTC-3’(SEQ ID NO.8)。
the PCR amplification system is as follows: primestar 25. Mu.L, CDS-NtDA1-1-F/CDS-NtDA 1-2-F1. Mu.L, CDS-NtDA1-1-R/CDS-NtDA 1-2-R1. Mu.L, cDNA 1. Mu.L, RNase-Free H 2 O up to 50μL。
The PCR amplification procedure was: pre-denaturation at 98 ℃ for 3min, denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 15s, extension at 72 ℃ for 15s,30 cycles, and extension at 72 ℃ for 10min.
(3) Connecting: the amplified PCR product was recovered and ligated to Blunt-Zero vector using T4 ligase at 25 ℃ for 15min.
(4) And (3) transformation: the ligation products were transformed into Trans-T1 competent cells, plated on Kan-resistant LB solid medium, and cultured overnight.
(5) And (3) detecting positive clones: the single clone was picked up in 10. Mu.L of sterile water, 4. Mu.L was used as a template, and PCR detection was carried out.
Example 2 characterization of expression patterns of the tobacco NtDA1 Gene in different tissues
To verify the results, the present example extracted RNA from the roots, taproots, stems, leaves, flowers, pistils, stamens, axillary buds, veins, petioles and crowns of tobacco at flowering stage and seeds three days after sowing, and detected the expression thereof in the above tissues by quantitative fluorescence PCR (qRT-PCR) according to example 1.
The results are shown in FIG. 1: the NtDA1-1 and NtDA1-2 genes are expressed in the tissues of corolla, stamen, flower, vein, petiole and axillary bud, but NtDA1-1 is mainly expressed in corolla and vein, and NtDA1-2 is mainly expressed in corolla and stamen.
Example 3 construction of Gene editing vectors
(1) Target sites were designed.
The gene editing vector comprises a target site knockout primer sequence designed according to an NtDA1 gene sequence, and the principle of the primer is as follows: the length of the target site sequence is 20bp; the first base of the target site sequence is G; the target site sequence is followed by NGG three bases; the target site is designed on the front exon of the gene.
The schematic design of target sites for the NtDA1 gene knockout in this example is shown in fig. 2, and the knockout primer sequences provided in this example are shown below:
Nt sgRNA 1-F：5’-GAGGATCACCAATCTACACC-3’(SEQ ID NO.9)，
Nt sgRNA 1-R：5’-GGTGTAGATTGGTGATCCTC-3’(SEQ ID NO.10)；
Nt sgRNA 2-F：5’-AGGATCACCAATCTACACCT-3’(SEQ ID NO.11)，
Nt sgRNA 2-R：5’-AGGTGTAGATTGGTGATCCT-3’(SEQ ID NO.12)；
Nt sgRNA 3-F：5’-ACAACTTGCCAGAGCTCTGC-3’(SEQ ID NO.13)，
Nt sgRNA 3-R：5’-GCAGAGCTCTGGCAAGTTGT-3’(SEQ ID NO.14)。
(2) Construction of vectors
(1) Annealing the primer at 95 ℃ for 5-8 min, closing the metal bath, and naturally cooling to 25 ℃.
(2) Digesting the pORE-Cas9 vector by BsaI at 37 ℃ for 1 hour, and recovering a digestion product; wherein the enzyme digestion system is as follows: plasmid 10. Mu.L, bsaI 1. Mu.L, cutSmart Buffer (10X) 5. Mu.L, ddH 2 O to 50. Mu.L.
(3) Connecting: ligation with T4 ligase at 25 ℃ for 10min; wherein the linking system (20. Mu.L) is: 2 μ L of 10 XT 4 DNA LigaseBuffer, 5 μ L of the target fragment,vector 2. Mu.L, T4 DNA Ligase 1. Mu.L, ddH 2 O to 20. Mu.L.
(4) And (3) transformation: the ligation products were transformed into Trans-T1 competent cells, plated on Kan-resistant LB solid medium, and cultured overnight.
(5) And (3) detecting positive clones: the single clone was picked up in 10. Mu.L of sterile water, 4. Mu.L was taken as template, and the sgRNA was detected by primers to be linked to the knockout vector. Wherein, the detection primers are as follows:
jc-f:5’-ttaggtttacccgccaata-3’(seq id no.15)，
u26-r：5’-cagaaaacgaagagaaaaaccc-3’(seq id no.16)。
the PCR detection system is as follows: 4 μ L of bacterial liquid, 1 μ L of JC-F, 1 μ L of U26-R, 7.5 μ L of GoTaqR O Green Master Mix enzyme, add ddH 2 O to 15. Mu.L.
The PCR amplification procedure was: pre-denaturation at 94 ℃ for 4min; denaturation at 94 ℃ 40s, annealing at 56 ℃ 40s, extension at 72 ℃ 45s,30 cycles; extension at 72 ℃ for 10min.
Example 4 obtaining tobacco NtDA1 Gene knockout plants
(1) Agrobacterium transformation
(1) LBA4404 chemically competent cells stored at-80 ℃ were removed and frozen and thawed on ice.
(2) When competence is just thawed, 5. Mu.L (1 ng) of knockout vector is added, flicked evenly and placed on ice for 30min.
(3) The cells were snap frozen in liquid nitrogen for 5min, and then incubated in a water bath at 37 ℃ for 5min.
(4) 1mL of YEB non-resistant liquid medium was added and incubated at 28 ℃ and 220rpm for 3 hours.
(5) 200. Mu.L of YEB liquid medium was applied to YEB solid medium containing 50mg/L rifampicin, 50mg/L streptomycin and 50mg/L kanamycin, and cultured in the dark at 28 ℃ for 2 to 3 days.
(2) Genetic transformation of tobacco
(1) And (3) culturing agrobacterium: picking single colony of successfully transformed knockout vector in 1mL YEB culture medium (containing 50 ug/mL rifampicin, 50 ug/mL streptomycin and 50 ug/mL kanamycin) and culturing at 28 deg.C and 220rpm overnight; adding 50 mu L of bacterial liquid into 50mL of YEB culture medium containing the same resistance, culturing at 28 ℃,220rpm until OD600= 0.6-0.8,4 ℃, centrifuging at 3000rpm for 7min, collecting thalli, and suspending the thalli by using 30-40 mL of MS liquid culture medium to be impregnated.
(2) Leaf beating disc: taking 2-month-sized tobacco sterile seedlings, removing leaf edges and veins from mature leaves of the sterile seedlings under the sterile condition (in an ultra-clean workbench), beating the mature leaves into leaf discs with the size of 5mm multiplied by 5mm by a puncher, and soaking the leaf discs in an MS culture medium liquid culture medium (without hormone) for 20-30 min.
(3) Infection of agrobacterium: placing the soaked leaf discs in MS liquid culture medium of plasmid-carrying agrobacterium LBA4404, infecting for 8min, taking out the leaves, absorbing bacterial liquid on sterilized filter paper, contacting the upper surfaces of the leaves with the culture medium, paving the leaves on MS solid co-culture medium (without hormone), and co-culturing for 3 days at 28 ℃ in dark.
(4) Selecting and culturing: the leaves were placed again on a selection medium (MS +0.5mg/L NAA +2mg/L6-BA +250mg/L Cb +50mg/L Kan) for inducing callus differentiation, and cultured under the conditions of (28 ℃, light, 16 h)/(25 ℃, dark, 10 h), the medium was changed every 10 days, and the edges of the leaf disks were seen to appear as white or green enlarged callus after about 1 month.
(5) Rooting culture: when the green buds grow from the callus (after the leaf disc is placed in a callus differentiation culture medium for about 2 months), the green buds are cut off (the height of 1-2 cm) and are transferred into an MS solid culture medium (without hormone) added with corresponding antibiotics (250 mg/L of carbobenzomycin (inhibiting agrobacterium) +100mg/L of kanamycin) for rooting, the green buds grow out after about 10 days, and the green buds can be transplanted into soil after being placed in the MS culture medium for rooting for 1 month.
(3) Molecular detection
After obtaining the resistant T0 generation transgenic plant, extracting the genome of the leaf, and detecting whether the plant is a positive plant by PCR by using corresponding primers (the sequence is shown as SEQ ID NO. 15-16).
Then, a target site detection primer is adopted to detect and edit the target site of the positive plant; the positive plants KO #37 and KO #27 have the following gene editing conditions:
sgRNA2 KO #37 double gene knockout.
NtDA1-1 AGGATCACCAATCTACA-CCTGGG WT，
AGGATCACCAATCTACACCCTGGG+1bp，
AGGATCACCAATCTAC-CCTGGG-1bp；
NtDA1-2 AGGATCACCAATCTACACCTGGG WT，
AGGATCACCAATCTAC-CCTGGG-1bp。
sgRNA2 KO #27 double gene knockout.
NtDA1-1 AGGATCACCAATCTACA-CCTGGG WT，
AGGATCACCAATCTACACCCTGGG+1bp；
NtDA1-2 AGGATCACCAATCTACACCTGGG WT，
AGGATCACCAATCTAC-CCTGGG-1bp。
(4) Phenotypic observation of transgenic lines NtDA1
Selecting WT and T1 generation double gene knockout strains KO #27 and KO #37 to perform topping in the bud stage of tobacco, and collecting axillary bud growth lengths and pictures on the 0 th day, the 5 th day and the 15 th day after topping, wherein the axillary bud growth lengths and pictures are specifically shown in figure 3.
In conclusion, the invention provides tobacco NtDA1-1 protein, ntDA1-2 protein and coding genes thereof, wherein the proteins control the initial development of axillary buds and play an important role in the initial development of the axillary buds of tobacco; the invention also provides a gene editing vector capable of knocking out the NtDA1 gene in tobacco, and a new tobacco variety capable of controlling the number of axillary buds of tobacco can be obtained by using the gene editing vector.
While the invention has been described with reference to specific preferred embodiments, it will be understood by those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the invention as defined in the following claims.
Claims (10)
1. An NtDA1 protein of tobacco for controlling axillary bud initiation, wherein the protein is the following protein A1), A2) or A3):
a1 NtDA1-1 protein and the amino acid sequence thereof is shown in SEQ ID NO. 1;
a2 NtDA1-2 protein and the amino acid sequence thereof is shown as SEQ ID NO. 2;
a3 A fusion protein obtained by attaching a protein tag to the N-terminus or/and C-terminus of A1) or A2).
2. The biomaterial related to the protein according to claim 1, which is any one of the following B1) to B4):
b1 A nucleic acid molecule encoding the protein of claim 1;
b2 A recombinant vector or a recombinant microorganism containing the nucleic acid molecule according to B1);
b3 Substances for silencing or suppressing the expression of genes encoding the NtDA1-1 protein and the NtDA1-2 protein in tobacco or knocking out the genes encoding the NtDA1-1 protein and the NtDA1-2 protein;
b4 Substances for reducing or inhibiting the activity and/or content of the NtDA1-1 protein and the NtDA1-2 protein in the plant of interest.
3. The biomaterial according to claim 2, characterized in that the nucleic acid molecules of B1) are the NtDA1-1 gene with the sequence as shown in SEQ ID No.3 and/or the NtDA1-2 gene with the sequence as shown in SEQ ID No. 4.
4. The biomaterial according to claim 3, wherein B3) the substance in which the genes encoding the NtDA1-1 protein and the NtDA1-2 protein are knocked out is a gene editing vector or a recombinant microorganism comprising the vector; the gene editing vector comprises a target site knockout sequence designed according to the NtDA1-1 gene and the NtDA1-2 gene.
5. The biomaterial according to claim 4, wherein the knockout primer sequence designed according to the knockout sequence of the target site is shown in SEQ ID No.9 to 14.
6. Use of the protein according to claim 1 or the biomaterial according to any one of claims 2 to 5 for breeding new varieties of tobacco.
7. A preparation method of tobacco low axillary bud plants is characterized by comprising the following steps: is method A or method B;
the method A comprises the following steps: reducing or inhibiting the activity and/or content of NtDA1-1 protein and NtDA1-2 protein in tobacco;
the method B comprises the following steps: silence or inhibit the expression of the gene coding the NtDA1-1 protein and the NtDA1-2 protein in the tobacco or knock out the gene coding the NtDA1-1 protein and the NtDA1-2 protein.
8. The method for preparing a tobacco low axillary bud plant according to claim 7, wherein the method B comprises: mutating the gene encoding the NtDA1-1 protein or the NtDA1-2 protein in the target plant reduces the expression level of the gene encoding the protein in tobacco or causes the function of the gene encoding the NtDA1-1 protein or the NtDA1-2 protein in tobacco to be lost.
9. The method for preparing tobacco low axillary bud plants according to claim 8, wherein the tobacco mutant with double knockout of NtDA1-1 and NtDA1-2 genes is obtained by introducing a gene editing vector into tobacco, so as to reduce the number of leaf axillary buds after topping of the tobacco.
10. The method for preparing tobacco axillary bud plantlets according to claim 9, wherein the gene editing vector comprises a target site knockout sequence designed according to the NtDA1-1 gene and the NtDA1-2 gene, and a knockout primer sequence designed according to the target site knockout sequence is shown in SEQ ID nos. 9-14.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211537032.6A CN115925853A (en) | 2022-12-02 | 2022-12-02 | Tobacco axillary bud initiation-controlling NtDA1 protein and related biological material and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211537032.6A CN115925853A (en) | 2022-12-02 | 2022-12-02 | Tobacco axillary bud initiation-controlling NtDA1 protein and related biological material and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115925853A true CN115925853A (en) | 2023-04-07 |
Family
ID=86650173
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211537032.6A Pending CN115925853A (en) | 2022-12-02 | 2022-12-02 | Tobacco axillary bud initiation-controlling NtDA1 protein and related biological material and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115925853A (en) |
-
2022
- 2022-12-02 CN CN202211537032.6A patent/CN115925853A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2019297209B2 (en) | Method of obtaining multi-leaf alfalfa material by means of MsPALM1 artificial site-directed mutant | |
| CN110819639B (en) | Tobacco low-temperature early-flowering related gene NtDUF599 and application thereof | |
| CN110878302B (en) | Method for knocking out Brassica napus Bna. TT8 gene by using CRISPR/Cas9 system and application | |
| CN113637060B (en) | Application of soybean GmSPA3a/3b protein and related biological materials thereof in regulating plant flowering and plant height | |
| US11365423B2 (en) | Method of obtaining multileaflet Medicago sativa materials by means of MsPALM1 artificial site-directed mutants | |
| CN111621504A (en) | Stress-resistant gene BjuIBS of tumorous stem mustard and application thereof | |
| CN114350673B (en) | Rice KOB1 gene for regulating and controlling seed vigor and regulating and controlling method thereof | |
| CN112830963B (en) | GhFLA19-D protein for regulating and controlling male reproductive development of cotton as well as encoding gene and application thereof | |
| CN115724930A (en) | Tobacco NtMYB transcription factor and application thereof | |
| CN114150000A (en) | Application of rape BnLAC2 gene in improving cold resistance early blossoming | |
| CN115925853A (en) | Tobacco axillary bud initiation-controlling NtDA1 protein and related biological material and application thereof | |
| CN114292855A (en) | PagARR9 gene for regulating and controlling growth of xylem of poplar and application thereof | |
| CN117431256B (en) | Wheat yellow mosaic disease-resistant gene TaRx-2D, protein encoded by same and application thereof | |
| CN116064572B (en) | MdWOX11 gene and protein for promoting adventitious root development and application thereof | |
| CN115927310B (en) | China rose skin thorn specific expression promoter proRcLAC15 and application thereof | |
| CN113416735B (en) | Tobacco germ cell specific high expression gene and application thereof | |
| CN117025627A (en) | Tobacco chloride channel protein NtCLC13, and coding gene and application thereof | |
| CN117051006A (en) | Gene for positively regulating flowering of bolting of Chinese cabbage and application thereof | |
| CN117025626A (en) | Tobacco nitrate transporter NtNPF7.4, encoding gene thereof, gene editing vector and application | |
| CN116411017A (en) | Multi-target gene editing tool and application thereof in aspect of adjusting heading stage of rice | |
| CN117070515A (en) | Rice biological clock gene OsPRR37 promoter region guide RNA double-target sequence and application thereof | |
| CN115894645A (en) | Leaf margin schizophylly trait related gene BrrRCO and application thereof | |
| CN114875039A (en) | Method for creating sweet osmanthus flower-shaped chrysanthemum | |
| CN115948451A (en) | Application of LsARF3 protein or coding gene thereof in regulation and control of high-temperature bolting performance of leaf lettuce | |
| CN116622737A (en) | Pinus massoniana PmAP2/ERF gene and expression protein and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |