CN115896138B - Anaerobic sulfatase mature enzyme gene, anaerobic sulfatase mature enzyme, and preparation methods and application thereof - Google Patents
Anaerobic sulfatase mature enzyme gene, anaerobic sulfatase mature enzyme, and preparation methods and application thereof Download PDFInfo
- Publication number
- CN115896138B CN115896138B CN202211244713.3A CN202211244713A CN115896138B CN 115896138 B CN115896138 B CN 115896138B CN 202211244713 A CN202211244713 A CN 202211244713A CN 115896138 B CN115896138 B CN 115896138B
- Authority
- CN
- China
- Prior art keywords
- sulfatase
- anaerobic
- maturation
- expression vector
- enzyme
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Enzymes And Modification Thereof (AREA)
Abstract
The invention provides an anaerobic sulfatase mature enzyme gene, an anaerobic sulfatase mature enzyme, a preparation method and application thereof, and belongs to the technical field of genetic engineering. The nucleotide sequence of the anaerobic sulfatase mature enzyme gene is shown as SEQ ID No. 1. The anaerobic sulfatase maturation enzyme provided by the invention has modification activity to sulfatase.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to an anaerobic sulfatase mature enzyme gene, an anaerobic sulfatase mature enzyme, a preparation method and application thereof.
Background
Bacterial sulfatase generally acts as a scavenger which removes sulfate groups from exogenous substrates, provides a sulfur and carbon source for bacterial growth and reproduction, has a critical role in bacterial colonization and pathogenesis, for example, increased mucin sulfatase activity is detected in fecal extracts from patients with Ulcerative Colitis (UC), and pseudomonas aeruginosa sulfatase (Atsa) can facilitate its colonization in the gut.
Bacterial sulfatases require the necessary post-translational modification of the cysteinyl or seryl residues at key active sites to become commonly referred to as cα -formylglycine (FGly) for hydrolytic activity, thereby removing sulfate groups from a wide range of reaction substrates and providing nutrients to bacteria, such as with sulfated polysaccharides and colistin. This post-translational modification is anaerobically catalyzed by the enzyme anaerobic sulfatase maturation (anSME), a member of the free radical AdoMet superfamily. Many opportunistic pathogens such as clostridium perfringens ATCC 13124, pseudomonas aeruginosa, klebsiella pneumoniae, bacteroides thetaiotaomicron and the like carry sulfatase and mature enzyme genes. Goldman PJ et al (Goldman PJ, grove TL, sites LA, mcLaughlin MI, booker SJ, drennan CL.X-ray structure of an AdoMet radical activase reveals an anaerobic solution for formylglycine posttranslational modification.Proc NatlAcad Sci U.S. 2013May 21;110 (21): 8519-24.) characterized the anaerobic sulfatase maturation enzyme of Clostridium perfringens ATCC 13124 and validated that it had the activity characteristics of modifying sulfatase; hickey CA et al (Hickey CA, kuhn KA, donermeyer DL, porterNT, jin C, cameron EA, jung H, kaiko GE, wegorzewska M, malvin NP, glowacki RW, hansson GC, allen PM, martens EC, stappenbeck TS.cologenic Bacteroides thetaiotaomicronAntigens Access Host Immune Cells in a Sulfatase-Dependent Manner via Outer Membrane Vehicles.cell Host microbe.2015May 13;17 (5): 672-80) demonstrate that the anaerobic sulfatase maturation enzyme gene is essential for Bacteroides thetaiotaomicron to initiate colitis in mice, and that Bacteroides thetaiotaomicron does not initiate colon inflammation in mice when the anaerobic sulfatase maturation enzyme gene is knocked out. Therefore, the anaerobic sulfatase mature enzyme anSME is a novel medicine target point of inflammatory intestinal diseases, and the research of the enzyme has important significance for preventing and treating the intestinal diseases. However, no research on related anaerobic sulfatase mature enzyme anSME has been reported in China.
Disclosure of Invention
In view of the above, the present invention aims to provide an anaerobic sulfatase maturation enzyme gene, an anaerobic sulfatase maturation enzyme, a preparation method and an application thereof.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides an anaerobic sulfatase mature enzyme gene, and the nucleotide sequence of the anaerobic sulfatase mature enzyme gene is shown as SEQ ID No. 1.
The invention also provides application of the anaerobic sulfatase mature enzyme gene in modification of sulfatase.
The invention also provides an anaerobic sulfatase maturation enzyme coded by the anaerobic sulfatase maturation enzyme gene, and the amino acid sequence of the anaerobic sulfatase maturation enzyme is shown as SEQ ID No. 2.
The invention also provides application of the anaerobic sulfatase maturation enzyme in modification of sulfatase.
The invention also provides a preparation method of the anaerobic sulfatase mature enzyme, which comprises the following steps:
1) Inserting the anaerobic sulfatase mature enzyme gene in the technical scheme into an expression vector to obtain a recombinant expression vector;
2) Converting the recombinant expression vector obtained in the step 1) into escherichia coli for fermentation culture to obtain fermentation liquor;
3) Centrifuging the fermentation broth obtained in the step 2) at 7000g and 4 ℃ for 10min, collecting thalli, cracking the thalli by a cell cracking buffer solution, centrifuging at 13000g and 4 ℃ for 20min, and collecting precipitate;
4) Re-suspending the precipitate obtained in the step 3) in 13000g of inclusion body solution, centrifuging at 4 ℃ for 20min to obtain a supernatant, and mixing the supernatant with a diluted renaturation solution to obtain a renaturation protein solution;
5) Purifying the renaturated protein solution obtained in the step 4) through a nickel column to obtain the anaerobic sulfatase mature enzyme.
Preferably, the expression vector of the step 1) comprises pET-28a, and the expression vector is subjected to restriction enzyme digestion by BamHI and HindIII.
Preferably, the culture medium used in the fermentation culture of the step 2) is LB culture medium containing 50 mug/mL kanamycin sulfate;
the conditions of the fermentation culture include: shaking culture at 200rpm and 37℃to OD 600 When the concentration is=0.6-0.8, isopropyl-beta-D-thiogalactoside is added to the final concentration of 100 mu mol/L, and the mixture is induced for 20 hours at 16 ℃ and 160 rpm.
Preferably, the step 3) of the cell lysis buffer comprises: 50mmol/LTris-base,150mmol/LKCl,10% glycerol by volume, 1mmol/LDTT, pH 7.5.
Preferably, the step 4) of dissolving the inclusion body comprises: 8mol/L urea, 1mol/L KCl,10mmol/LTris-base, pH 7.5.
Preferably, the diluting renaturation solution in the step 4) comprises: 50mmol/L Tris-base,1mol/LNaCl,2mol/L urea, 100mmol/L glycine, 1mmol/L reduced glutathione, 1mmol/LEDTA, and the pH value is 7.5.
The beneficial effects of the invention are as follows:
the anaerobic sulfatase mature enzyme gene provided by the invention can be expressed in a large amount in escherichia coli, a large amount of soluble anaerobic sulfatase mature enzyme can be obtained after purification, and the gene still has good sulfatase modification activity, overcomes the problem that the anaerobic sulfatase mature enzyme is difficult to obtain by large purification, and can be widely applied to sulfatase and related disease research.
Drawings
FIG. 1 shows amino acid sequence alignment of various ansMEs of Clostridium perfringens (ansMepe), bacteroides thetaiotaomicron (ansMebt), klebsiella pneumoniae (ansMekp), escherichia coli (ansMeec) and Massiliomicrobiota timonensis DY (ansMemt); wherein dark grey is a strictly conserved cysteine residue CX 3 CX 2 C, light grey is conserved cysteine and other residues;
FIG. 2 is a SDS-PAGE map of recombinant expression and purification of the novel anaerobic sulfatase maturation enzyme ansmEmt; wherein M is a protein Marker of 10-190kDa, 1 is a supernatant of a recombinant expression strain BL21-ansMEmt which is not induced in LB, 2 is a thallus of the recombinant expression strain BL21-ansMEmt which is not induced in LB, 3 is a supernatant of the recombinant expression strain BL21-ansMEmt which is induced in LB, 4 is a thallus of the recombinant expression strain BL21-ansMEmt which is induced in LB, 5 is a supernatant of the recombinant expression strain BL21-ansMEmt which is induced in LB after ultrasonic disruption, 6 is a precipitate of the recombinant expression strain BL21-ansMEmt which is induced in LB after ultrasonic disruption, 7 is a protein solution of the recombinant expression strain BL21-ansMEmt which is dissolved after inclusion body is diluted and renatured, and 8 is a target protein ansmEmt (43 kDa) obtained after dilution and renaturation of the inclusion body after the recombinant expression strain BL21-ansMEmt is induced;
FIG. 3 is an HPLC plot after linear elution of 10% -90% acetonitrile at different time points after incubation of purified anaerobic sulfatase maturation enzyme ansmEmt with synthetic polypeptide 17C under anaerobic conditions;
FIG. 4 is an HPLC plot of synthetic polypeptide 17C and purified anaerobic sulfatase maturation enzyme ansmEmt after linear elution with 10% -90% acetonitrile.
Detailed Description
The invention provides an anaerobic sulfatase maturation enzyme gene, the nucleotide sequence of which is shown as SEQ ID No.1, which is specifically as follows: ATGAACGGACTTTTATTGTGTACAGAAGATTGCAACTTAAGATGCAAATATTGTTTTGAAGAAAATATGCATAAAGATTTATATCTTAGTAAGTTACAAGTTCAAAAAAATTTTAATTTTTTTATCGAAAATTATTTAGAAAAATTTGTAGATGAATTATATCAAATTAATCTTCAACAAAAAAAGAGACAAAATATTACTTTCCATGGAGGAGAACCACTTTTAATTGGAGAAGAACTATTTGAAAAAGCATTAAAAATTGTTTCAAAATATAAAGGCACAGATATTTGTATGCAAACAAATGGGACACTTTTTACTGATAAGATTATTGATTTATGTAAAAAATATAAAGTTAAAGTTGGCATTAGCATTGATGGGCCTAAAGAAATTCATGATGTATATAGACTAAATAGAGGGAAAAAAGGATCTTTTGATTTAGTGTATTCAAATATTAAAAAACTTCAAGAAAAAGGAGTTATTGTTGGGGGATTGGCTACGGTCACTGATGTTACAATACATAATCCAGAGAAATTCTATAATTTTTTTAAAGAAAATAATTTGAATTTTTCTTTTAATCCGTGTTATATAGAGCCTAATATTAAATCTTCATGCTCACATATAAATTTACAAGAATATATCAAATTTACAAATAAAATCTTTGATTTATGGATTAATGATAATTCGAGCAATATTTCAATTAACGCATTTGAAAGAATAATGAGTGCAATGTGTGTGAAAAAAAGAATTTATATGGAAGTTTGTTCATTTATTCCAGACTGCAGTAAAACAACTGTGGCAATTAATCCTAAAGGAGAATTTTATCGTTGTTTACATTATTGCTTAGATAAAAAAAATATGATCGGTAATTTA GATAATAATA CTTTATGGAAAGCAGTTGGAGATAATGATATGTGTAAAAGAATTGATTATTTAGAAAAAAATGAATGTAAAAATTGTGATATATTTGAATATTGTTATGGTGGATGTCCATATATTGCTGAATCTCTTAATGGAAATATTTATTCTAAGG CTAATACTTGTGAAAGTCAAAAAACAATAGTACATCACATTAGGGAGTATTTAAAGCAATTTGAAAAATAA.
The invention also provides application of the anaerobic sulfatase mature enzyme gene in modification of sulfatase.
The invention also provides an anaerobic sulfatase maturation enzyme coded by the anaerobic sulfatase maturation enzyme gene, wherein the amino acid sequence of the anaerobic sulfatase maturation enzyme is shown as SEQ ID No.2, and the method specifically comprises the following steps:
MNGLLLCTEDCNLRCKYCFEENMHKDLYLSKLQVQKNFNFFIENYLEKFVDELYQINLQQKKRQNITFHGGEPLLIGEELFEKALKIVSKYKGTDICMQTNGTLFTDKIIDLCKKYKVKVGISIDGPKEIHDVYRLNRGKKGSFDLVYSNIKKLQEKGVIVGGLATVTDVTIHNPEKFYNFFKENNLNFSFNPCYIEPNIKSSCSHINLQEYIKFTNKIFDLWINDNSSNISINAFERIMSAMCVKKRIYMEVCSFIPDCSKTTVAINPKGEFYRCLHYCLDKKNMIGNLDNNTLWKAVGDNDMCKRIDYLEKNECKNCDIFEYCYGGCPYIAESLNGNIYSKANTCESQ KTIVHHIREYLKQFEK。
the invention also provides application of the anaerobic sulfatase maturation enzyme in modification of sulfatase.
The invention also provides a preparation method of the anaerobic sulfatase mature enzyme, which comprises the following steps:
1) Inserting the anaerobic sulfatase mature enzyme gene in the technical scheme into an expression vector to obtain a recombinant expression vector;
2) Converting the recombinant expression vector obtained in the step 1) into escherichia coli for fermentation culture to obtain fermentation liquor;
3) Centrifuging the fermentation broth obtained in the step 2) at 7000g and 4 ℃ for 10min, collecting thalli, cracking the thalli by a cell cracking buffer solution, centrifuging at 13000g and 4 ℃ for 20min, and collecting precipitate;
4) Re-suspending the precipitate obtained in the step 3) in 13000g of inclusion body solution, centrifuging at 4 ℃ for 20min to obtain a supernatant, and mixing the supernatant with a diluted renaturation solution to obtain a renaturation protein solution;
5) Purifying the renaturated protein solution obtained in the step 4) through a nickel column to obtain the anaerobic sulfatase mature enzyme.
According to the invention, the anaerobic sulfatase mature enzyme gene in the technical scheme is inserted into an expression vector to obtain a recombinant expression vector. In the present invention, the expression vector preferably includes pET-28a (commercially available conventional vector), and the expression vector is preferably digested with BamHI and HindIII restriction enzymes. The conditions for the cleavage are not particularly limited, and those skilled in the art can operate conventionally. The conditions for inserting the anaerobic sulfatase maturation enzyme gene into the expression vector are not particularly limited, and the method can be performed by a person skilled in the art according to conventional operations.
The recombinant expression vector is transformed into escherichia coli for fermentation culture to obtain fermentation liquor. In the present invention, the E.coli is preferably E.coli BL21 (DE 3). The method for transforming the group expression vector into the escherichia coli has no special featureAnd is very limited, and a person skilled in the art can perform the conventional operation. In the present invention, the medium used for the fermentation culture is preferably LB medium containing 50. Mu.g/mL kanamycin sulfate. In the present invention, the conditions of the fermentation culture preferably include: shaking culture at 200rpm and 37℃to OD 600 When the concentration is=0.6-0.8, isopropyl-beta-D-thiogalactoside is added to the final concentration of 100 mu mol/L, and the mixture is induced for 20 hours at 16 ℃ and 160 rpm.
The invention carries out centrifugation on the obtained fermentation liquor, collects thalli, and carries out cell lysis buffer solution pyrolysis and centrifugation on the thalli, and collects sediment. The invention has no special limitation on the centrifugation conditions, and the conventional centrifugation conditions for obtaining the escherichia coli are adopted. In the present invention, the cell lysis buffer preferably comprises: 50mmol/LTris-base,150mmol/LKCl,10% glycerol by volume, 1mmol/L DTT, pH 7.5. In the invention, the ratio of the thalli to the cell lysis buffer is 10:1, namely, 50mL of cell lysis buffer is added into thalli obtained by 500mL of fermentation liquor for resuspension; the lysis is preferably carried out under ultrasound, the conditions of which preferably include 200W, 2s work, intervals of 2s,40min, ultrasound in an ice bath, 20min intervals of 10min. The present invention is not particularly limited to the centrifugation conditions after the cleavage, and those skilled in the art can operate conventionally.
The obtained precipitate is resuspended in 13000g inclusion body solution and centrifuged for 20min at 4 ℃ to obtain supernatant, and the supernatant is mixed with diluted renaturation solution to obtain renaturation protein solution. In the present invention, the inclusion body lysate preferably includes: 8mol/L urea, 1mol/L KCl,10mmol/L Tris-base, pH 7.5. In the present invention, the diluted renaturation solution comprises: 50mmol/L Tris-base,1mol/L NaCl,2mol/L urea, 100mmol/L glycine, 1mmol/L reduced glutathione, 1mmol/L EDTA, and the pH value is 7.5. In the present invention, the conditions of the centrifugation preferably include: the centrifugal force was 13000g, 20min, 4 ℃.
The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
The experimental procedures which do not address the specific conditions in the examples below are generally carried out under conventional conditions such as those described in the molecular cloning laboratory Manual (New York: cold Spring Harbor Laboratory Press, 2001) or under conditions recommended by the manufacturers of reagents or instruments.
Example 1
Heterologous expression and purification of anaerobic sulfatase anSMEmt
(1) The invention separates chicken intestinal anaerobic bacteria, strains pedicel Mo Masai group bacillus (Massiliomicrobiota timonensis DY520,520) with sulfatase activity, uses bacterial genome kit to extract genome DNA after anaerobic culture of Massiliomicrobiota timonensis DY520,520, and carries out whole genome sequencing. Analysis of the genomic sequence, alignment analysis with the amino acid sequences of four found anaerobic sulfatase maturation enzymes of clostridium perfringens (anssecpe), bacteroides thetaiotaomicron (anSMEbt), klebsiella pneumoniae (anSMEkp), escherichia coli (anSMEec) (see fig. 1 for results), found that all of the anaerobic sulfatase maturation enzymes have a strictly conserved cysteine sequence CX 3 CX 2 C (see dark marker sequence in FIG. 1), in addition to 7 strictly conserved cysteine residues and other residues (light gray marker sequence in FIG. 1), the gene encoding the mature enzyme protein of anaerobic sulfatase carried by Massiliomicrobiota timonensis DY was designated ansMEmt, which has a nucleotide sequence 1101 bases long (SEQ ID No. 1) and encodes a protein containing 366 amino acids (SEQ ID No. 2).
(2) Primers were designed based on the gene whose nucleotide sequence was ansmEmt, respectively ansmEmtF (SEQ ID No. 3): 5' -CTGGGATCCATGAACGGACTTTTATTGTGTACAG-3' (underlined as BamHI cleavage site) and ansmEmtR (SEQ ID No. 4): 5'-CTGAAGCTTTTATTTTTCAAATTGCTTTAAATAC-3' (underlined as HindIII cleavage site). The full-length anSMEmt gene was amplified using primers F and R using the extracted Massiliomicrobiota timonensis DY520 genomic DNA as a template. The PCR reaction conditions were: in a 50. Mu.L reaction system, 100ng of genomic DNA template, 500nmol/L of primer ansMEmtF,500nmol/L of primer ansMEmtR, 25. Mu. L PrimeSTAR Max Premix enzyme (2X), available from TaKaRa company; reaction conditions: 9The pre-denaturation is carried out at 4 ℃ for 3min, the cycle number of 98 ℃ for 10s, 60 ℃ for 15s and 72 ℃ for 10s is 35, and the extension is carried out at 72 ℃ for 10min. And (3) performing 1% agarose gel electrophoresis on the obtained product, and purifying and recovering the target gene according to the specification of a gel recovery kit. After recovery, double cleavage was performed using BamHI and HindIII restriction enzymes, and ligated to pET-28a vector digested with BamHI and HindIII restriction enzymes as well, using CaCl 2 The method was transformed into clone E.coil DH 5. Alpha. And positive clones were picked for sequencing.
(3) Induction expression and purification of anaerobic sulfatase maturation enzyme anSMEmt
Converting the recombinant expression vector pET-ansmEmt with correct sequencing obtained in the step (2) into E.coilBL21, selecting positive clone, culturing in LB culture medium containing 50 mug/mL kanamycin sulfate at 37 ℃ under shaking at 200rpm to OD 600 When=0.6-0.8, isopropyl- β -D-thiogalactoside was added to a final concentration of 100 μmol/L,16 ℃, and induced at 160rpm for 20h. The bacterial liquid is collected into a 50mL centrifuge tube, 70000 g is added, and bacterial cells are collected by centrifugation at 4 ℃ for 10min. The bacterial cells were resuspended in 50mL of bacterial lysis buffer (lysis buffer formulation: 50mmol/LTris-base,150mmol/LKCl,10% glycerol (v/v), 1mmol/L DTT, pH adjusted to 7.5), sonicated for 40min (power 200W, interval 2s, working 2 s), 13000g,4℃and the pellet collected by centrifugation for 20 min. The precipitate was resuspended and mixed with inclusion body-dissolving solution A (inclusion body-dissolving solution A was prepared from 8mol/L urea, 1mol/L KCl,10mmol/LTris-base, pH 7.5), allowed to stand overnight at 4℃for complete dissolution, 13000g, and collected supernatant by centrifugation at 4℃for 20 min. Adding the supernatant into the diluted renaturation solution B (the formula of the diluted renaturation solution B is 50mmol/LTris-base,1mol/LNaCl,2mol/L urea, 100mmol/L glycine, 1mmol/L reduced glutathione, 1mmol/L EDTA, deionized water to a constant volume of 1L, and regulating the pH value to 7.5) of an ice bath one drop by one drop, stirring while adding until precipitation is caused, replacing the new diluted renaturation solution B, and continuing renaturation until all the supernatant is dripped. And (3) uniformly mixing the renaturated protein solution with Ni-NTAAgarose balanced by the diluted renaturation solution B in advance, and purifying according to the specification of a purification kit to obtain the sulfatase mature enzyme ansMEmt (SEQ ID No. 2). Purified proteins were subjected to 12% SDS-PAGEThe molecular weight was about 43kDa and the purity was over 95% (see FIG. 2 for results).
Example 2
Activity verification of anaerobic sulfatase anSMEmt
(1) The present invention synthesizes polypeptide 17C (the sequence is (SEQ ID No. 5): ac-TAVPSCIPSRASILTGM-NH) based on the result of the test by aligning the amino acid sequences of various bacterial sulfatases, referring to Alhosna Benjdia et al (Benjdia A, subramanian S, leprice J, vaudry H, johnson MK, berheau O. Anaerobics sulfatase-maturating enzyme-a mechanistic link with glycyl radical-activating enzymesFEBS J.2010Apr;277 (8): 1906-20.) 2 Synthesized by Shanghai Botai Biotech Co., ltd., purity>95%). The characterized 1mg anaerobic sulfatase maturation enzyme anSMEmt was incubated with 500. Mu.M synthetic polypeptide in 1mL buffer (1 mmol/LAdoMet,6mmol/LDTT,3mmol/L sodium dithionite) in anaerobic environment and its absorbance at 215nm was measured using HPLC at 0h,4h,6 h. The C18 column of HPLC was equilibrated to 90% using solvent a (which is 0.1% pure trifluoroacetic acid) eluting with a linear gradient of 10% -90% acetonitrile at a constant flow rate of 1 mL/min. The retention time of synthesis 17C alone in HPLC was found to be 8.1 minutes (see fig. 4 for results) and the retention time of the expressed novel anaerobic sulfatase maturation enzyme anSMEmt alone was found to be 3.3 minutes (see fig. 4 for results). After incubation together for 4h under anaerobic conditions, the retention time of 17C became 7.9 min and a new peptide with a retention time of 8.9 min was produced, which increased further over time to 6h (see fig. 3 for results). When the time is further prolonged to 24 hours, the peak value of the generated new peptide is kept unchanged, which shows that when the concentration of the anaerobic sulfatase maturation enzyme ansmEmt in the reaction system is 1mg/mL and the concentration of sulfatase synthesized polypeptide 17C (SEQ ID No. 5) is 0.87mg/mL, the maximum reaction efficiency is achieved in 6 hours, the absorption peak of the modified peptide at 215nm is 550.14mV when the C18 analytical column of HPLC is used for detecting 10 mu L of the reaction liquid, and the obtained anaerobic sulfatase maturation enzyme ansmT has good sulfatase modification activity.
The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.
Claims (10)
1. The anaerobic sulfatase maturation enzyme gene is characterized in that the nucleotide sequence of the anaerobic sulfatase maturation enzyme gene is shown as SEQ ID No. 1.
2. Use of the anaerobic sulfatase maturation enzyme gene of claim 1 for modification of sulfatase.
3. An anaerobic sulfatase maturation enzyme encoded by the anaerobic sulfatase maturation enzyme gene of claim 1, wherein the amino acid sequence of the anaerobic sulfatase maturation enzyme is shown in SEQ ID No. 2.
4. Use of the anaerobic sulfatase maturation enzyme of claim 3 for modifying sulfatase.
5. A method of preparing the anaerobic sulfatase maturation enzyme of claim 3, comprising the steps of:
1) Inserting the anaerobic sulfatase maturation enzyme gene of claim 1 into an expression vector to obtain a recombinant expression vector;
2) Converting the recombinant expression vector obtained in the step 1) into escherichia coli for fermentation culture to obtain fermentation liquor;
3) Centrifuging the fermentation broth obtained in the step 2) at 7000g and 4 ℃ for 10min, collecting thalli, cracking the thalli by a cell cracking buffer solution, centrifuging at 13000g and 4 ℃ for 20min, and collecting precipitate;
4) Re-suspending the precipitate obtained in the step 3) in 13000g of inclusion body solution, centrifuging at 4 ℃ for 20min to obtain a supernatant, and mixing the supernatant with a diluted renaturation solution to obtain a renaturation protein solution;
5) Purifying the renaturated protein solution obtained in the step 4) through a nickel column to obtain the anaerobic sulfatase mature enzyme.
6. The method according to claim 5, wherein the expression vector of step 1) comprises pET-28a, and the expression vector is digested with BamHI and HindIII restriction enzymes.
7. The method according to claim 5, wherein the medium used in the fermentation culture in the step 2) is LB medium containing 50. Mu.g/mL kanamycin sulfate;
the conditions of the fermentation culture include: shaking culture at 200rpm and 37℃to OD 600 When the concentration is=0.6-0.8, isopropyl-beta-D-thiogalactoside is added to the final concentration of 100 mu mol/L, and the mixture is induced for 20 hours at 16 ℃ and 160 rpm.
8. The method of claim 5, wherein the step 3) of cell lysis buffer comprises: 50mmol/LTris-base,150mmol/LKCl,10% glycerol by volume, 1mmol/L DTT, pH 7.5.
9. The method according to claim 5, wherein the step 4) of dissolving the inclusion body comprises: 8mol/L urea, 1mol/L KCl,10mmol/LTris-base, pH 7.5.
10. The method according to claim 5, wherein the diluting and renaturation solution in step 4) comprises: 50mmol/LTris-base,1mol/LNaCl,2mol/L urea, 100mmol/L glycine, 1mmol/L reduced glutathione, 1mmol/L EDTA, pH 7.5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211244713.3A CN115896138B (en) | 2022-10-12 | 2022-10-12 | Anaerobic sulfatase mature enzyme gene, anaerobic sulfatase mature enzyme, and preparation methods and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211244713.3A CN115896138B (en) | 2022-10-12 | 2022-10-12 | Anaerobic sulfatase mature enzyme gene, anaerobic sulfatase mature enzyme, and preparation methods and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115896138A CN115896138A (en) | 2023-04-04 |
| CN115896138B true CN115896138B (en) | 2023-08-08 |
Family
ID=86473346
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211244713.3A Active CN115896138B (en) | 2022-10-12 | 2022-10-12 | Anaerobic sulfatase mature enzyme gene, anaerobic sulfatase mature enzyme, and preparation methods and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115896138B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101942427A (en) * | 2010-09-07 | 2011-01-12 | 国家海洋局第三海洋研究所 | Alkyl sulfatase and preparation method thereof |
| WO2014136065A2 (en) * | 2013-03-05 | 2014-09-12 | Oxyrane Uk Limited | Production of catalytically active type i sulfatase |
| CN106399334A (en) * | 2016-08-05 | 2017-02-15 | 集美大学 | Thermally stable mutant aromatic sulfatase and its gene and use |
| CN108026579A (en) * | 2015-03-06 | 2018-05-11 | 赢创德固赛有限公司 | The method for detecting fowl necrotic enteritis |
| CN115887444A (en) * | 2023-01-08 | 2023-04-04 | 吉林大学 | Antibacterial medical application of silibinin in preparation of sulfatase maturase inhibitor |
-
2022
- 2022-10-12 CN CN202211244713.3A patent/CN115896138B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101942427A (en) * | 2010-09-07 | 2011-01-12 | 国家海洋局第三海洋研究所 | Alkyl sulfatase and preparation method thereof |
| WO2014136065A2 (en) * | 2013-03-05 | 2014-09-12 | Oxyrane Uk Limited | Production of catalytically active type i sulfatase |
| CN108026579A (en) * | 2015-03-06 | 2018-05-11 | 赢创德固赛有限公司 | The method for detecting fowl necrotic enteritis |
| CN106399334A (en) * | 2016-08-05 | 2017-02-15 | 集美大学 | Thermally stable mutant aromatic sulfatase and its gene and use |
| CN115887444A (en) * | 2023-01-08 | 2023-04-04 | 吉林大学 | Antibacterial medical application of silibinin in preparation of sulfatase maturase inhibitor |
Non-Patent Citations (1)
| Title |
|---|
| Benjdia,A.等.SPASM domain-containing protein [Flavonifractor sp. An10].Genbank Database.2019,Accession NO.WP_087236862.1. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115896138A (en) | 2023-04-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112301013B (en) | Complex enzyme and application thereof in preparation of ergothioneine | |
| CN112725319B (en) | Alginate lyase FaAly7 with polyG substrate specificity and application thereof | |
| CN107794275B (en) | Recombinant pichia pastoris for producing (+) gamma-lactamase and construction method and application thereof | |
| CN111117977A (en) | Recombinant polypeptide linked zymogen, preparation method, activation method and application thereof | |
| CN113736763B (en) | Myrosinase Rmmr and application thereof in preparation of sulforaphane and sulforaphane | |
| CN113308453B (en) | Amidohydrolase SaAH, and coding gene and application thereof | |
| CN114774392A (en) | Mannase and application thereof | |
| CN103421734B (en) | The method of the soluble expression of a kind of recombination tyrosine decarboxylase and the application of this enzyme | |
| CN115896138B (en) | Anaerobic sulfatase mature enzyme gene, anaerobic sulfatase mature enzyme, and preparation methods and application thereof | |
| CN108034646B (en) | PvEH3 mutant with improved catalytic activity and improved enantiotropic normalization | |
| CN110551697A (en) | Application of ergothioneine synthetase PEGT1 and PEGT2 of Pleurotus ostreatus in synthesis of ergothioneine | |
| CN113862290B (en) | Isoflavone 4' -O-methyltransferase from liquorice and application thereof | |
| CN106754848B (en) | Alkaline pectinase mutant with improved thermal stability | |
| CN113249352B (en) | N-glycosyltransferase mutant P1 and application thereof | |
| CN112481320B (en) | Method for preparing (-) gamma-lactam with high catalytic efficiency | |
| CN114181927B (en) | Heparinase I | |
| CN111172143B (en) | D-xylonic acid dehydratase and application thereof | |
| CN113201074B (en) | PKEK fusion protein and preparation method and application thereof | |
| CN109762801B (en) | Halogen alcohol dehalogenase mutant and application thereof in synthesizing chiral drug intermediate | |
| CN109022471B (en) | Escherichia coli expression system for producing oxalate oxidase, and production method and application of oxalate oxidase | |
| CN114746548A (en) | Nucleic acids, vectors, host cells and methods for producing fructosyltransferase from aspergillus japonicus | |
| CN114958933B (en) | Method for preparing sulforaphane by using myrosinase Emyr | |
| CN112442474B (en) | Preparation method of (-) gamma-lactam | |
| CN107119035A (en) | Phenylalanine mutase, encoding gene, recombinant vector, host cell, multiple PCR primer and their application | |
| CN115232805B (en) | Chondroitin sulfate lyase, recombinant strain and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |