CN106754848B

CN106754848B - Alkaline pectinase mutant with improved thermal stability

Info

Publication number: CN106754848B
Application number: CN201611222643.6A
Authority: CN
Inventors: 刘松; 陈坚; 堵国成; 赵伟欣; 黎青华
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2016-12-27
Filing date: 2016-12-27
Publication date: 2020-11-03
Anticipated expiration: 2036-12-27
Also published as: CN106754848A

Abstract

The invention discloses an alkaline pectinase mutant with improved thermal stability, belonging to the field of enzyme engineering. The sequence of the alkaline pectinase mutant provided by the invention is shown as SEQ ID No.1, and compared with the existing PGL, the mutant has the advantages that the specific enzyme activity is improved by 3.4 times, the half-life period at 60 ℃ is improved to 19min from the original 5.2min, and the half-life period is improved by 3.6 times. The alkaline pectinase of the invention can catalyze the alpha-1, 4 glycosidic bond cracking of polygalacturonic acid through trans-elimination under alkaline conditions, and can be widely applied to industries of food, textile, paper making and the like.

Description

Alkaline pectinase mutant with improved thermal stability

Technical Field

The invention relates to an alkaline pectinase mutant with improved thermal stability, belonging to the field of enzyme engineering.

Background

Pectinase is a complex enzyme which can break down pectin polymers into unsaturated oligogalacturonans. The enzyme is widely distributed and found in partial parasitic nematodes, plants and microorganisms. Pectinase has been widely used, and has been used industrially for over 40 years. Pectinase is classified into acid pectinase and alkaline pectinase PGL according to the difference of optimal reaction pH. The acidic pectinase is mainly applied to aspects of clarifying fruit juice, fruit wine, extracting fruit and vegetable juice, peeling fruits and the like. PGL applications are mainly applied in the textile, food, paper industry and environmental fields. The enzyme method is applied to the related reactions in the field, and the method has the advantages of environmental protection, material and material saving, mild reaction conditions and the like. However, there are few studies on molecular modification of PGLs and few PGLs that are commercially available.

At present, the strains which are deeply researched on the alkaline pectinase are mainly pichia pastoris, bacillus subtilis and escherichia coli. Compared with different hosts capable of expressing alkaline pectinase comprehensively, the pichia pastoris has long fermentation period, complex process and high low-temperature induction energy consumption although the expressed protein is easy to purify and the yield is high; the bacillus subtilis is not easy to express or the expression enzyme activity is low.

Disclosure of Invention

In order to solve the problems, the invention provides an alkaline pectinase mutant, the amino acid sequence of which is shown as SEQID NO. 1.

The second purpose of the invention is to provide a gene for coding the alkaline pectinase mutant.

In one embodiment of the invention, the gene sequence is shown in SEQ ID NO. 2.

The third purpose of the invention is to provide a method for improving the thermal stability of alkaline pectinase, which is to connect the N end of the alkaline pectinase shown in SEQ ID NO.3 with the amphiphilic short peptide shown in SEQ ID NO.4 through PT-Linker.

In one embodiment of the invention, the PT-Linker sequence is PTPPTTPTPPTTPTPT.

The fourth purpose of the invention is to provide a cell line expressing the alkaline pectinase mutant.

The fifth purpose of the invention is to provide a genetic engineering bacterium for producing alkaline pectinase, which takes escherichia coli as a host and pET-22b (+) as a vector to express an alkaline pectinase mutant shown in SEQ ID NO. 1.

The sixth purpose of the invention is to provide a construction method of the genetic engineering bacteria, which takes pET-22b (+) as a vector, connects the gene shown in SEQ ID NO.2 with the vector and transforms the gene into escherichia coli.

The seventh purpose of the invention is to provide a production method of alkaline pectinase, which is to inoculate the genetically engineered bacteria to a fermentation medium and culture the genetically engineered bacteria at 37 ℃ to OD₆₀₀Adding IPTG with the final concentration of 0.04-0.06 mmol/L to the mixture of 0.6-1.0, and inducing the mixture for 24-72 hours at the temperature of 30 ℃.

In one embodiment of the invention, the method is to inoculate the genetically engineered bacteria to the fermentation medium and culture the genetically engineered bacteria to OD at 37 ℃₆₀₀Adding 0.04-0.06 mmol/L of the total amount of the componentsIPTG, induction at 30 ℃ for 48 h.

In one embodiment of the invention, the inoculation is to inoculate 3-5% of the seed solution by volume.

In one embodiment of the invention, the seed solution is obtained by inoculating the recombinant bacterium in an LB culture medium and culturing at 37 ℃ and 200-250 rpm for 10-12 h.

In one embodiment of the invention, the method comprises the steps of firstly culturing seeds and then fermenting; the seed culture is to take a proper amount of the constructed recombinant bacterium E.coli BL21(DE3) from a glycerol tube to inoculate the recombinant bacterium in a medium containing 100 mu g/mL^-1Ampicillin and 2% glucose were added to LB medium in a volume of 20mL/250 mL. 37 ℃ and 200r min^-1Shaking and culturing on a shaking table for 10 h; the shake flask fermentation is to inoculate seed liquid cultured for 10h with the inoculation amount of 3% (V/V) to the culture medium containing 100 mug. multidot.mL^-1Ampicillin in TB Medium in a volume of 20mL/250mL at 37 ℃ at 200 r.min^-1Culturing until the bacterial concentration OD₆₀₀Induction was performed with the addition of 0.04mM IPTG at a final concentration of 0.6 and at 30 ℃ for 48 h.

The invention also claims the application of the mutant and the genetically engineered bacteria in the fields of food, textile or paper making.

Has the advantages that: compared with the existing PGL, the specific enzyme activity of the mutant PGL-3S1 constructed by the invention is improved by 3.4 times, and the half-life period at 60 ℃ is improved from 5.2min to 19min, which is improved by 3.6 times. The alkaline pectinase of the invention can catalyze the alpha-1, 4 glycosidic bond cracking of polygalacturonic acid through trans-elimination under alkaline conditions, and can be widely applied to industries of food, textile, paper making and the like.

The specific implementation mode is as follows:

culture medium:

seed culture medium: 10g/L of tryptone, 5g/L, NaCl 10g/L of yeast powder and 2g/L of glucose.

Fermentation medium: peptone 12g/L, yeast powder 24g/L, glycerin 10g/L, KH₂PO₄2.32g/L、K₂HPO₄16.43g/L。

And (3) measuring the enzyme activity of alkaline pectinase:

the measurement is carried out by spectrophotometry. Definition of unit enzyme activity: an amount of enzyme used to cleave polygalacturonic acid per unit time to produce 1. mu. mol of unsaturated polygalacturonic acid. The enzyme activity determination conditions are as follows: and (3) enzyme activity detection: and (4) centrifuging the fermentation liquor at 8000rpm for 10min, so that the extracellular PGL is contained in the fermentation supernatant, and taking a certain amount for detection. PGL reaction system: Glycine-NaOH buffer (0.2 mol. L.) containing 0.2% polygalacturonic acid (substrate)^-1，0.44mmol·L^-1CaCl2, pH9.4)2mL, 20 μ L of the sample to be tested, and a blank with inactive enzyme solution. The PGL reaction conditions were: the reaction system was placed in a water bath at 45 ℃ for 15min, and 3mL of a phosphoric acid solution (0.03 mol. L) was added^-1) The reaction was stopped and the absorbance was measured at 235 nm.

And (3) measuring the thermal stability:

and (3) subpackaging the diluted enzyme solution, placing the enzyme solution in a metal bath at 60 ℃, sampling every 3min, determining the residual enzyme activity, and calculating the half-life period.

Example 1: obtaining of mutant strains

An alkaline pectinase gene with a sequence shown as SEQ ID NO.2 is obtained by adopting a PCR amplification or chemical synthesis method, then the gene is connected to pET-22b (+), and then is transformed into Escherichia coli E.coli BL21(DE3), and a correct transformant is selected and named as a recombinant bacterium E.coli BL21(DE3) (pET-22b (+)/PGL-3S 1).

Example 2: verification of mutant strains

Seed culture: the recombinant strain E.coli BL21(DE3) (pET-22b (+)/PGL-3S1) was inoculated in LB medium (100. mu.g.mL) in a suitable amount from a glycerol tube^-1Ampicillin, 2% glucose), the liquid loading was 20mL/250 mL. 37 ℃ and 200r min^-1Shaking and culturing on a shaking table for 10 h.

And (3) shaking flask fermentation: the seed solution cultured for 10 hours was inoculated into fermentation medium TB (100. mu.g.mL) in an inoculum size of 3% (V/V)^-1Ampicillin) in the container, the liquid loading amount was 20mL/250mL, 37 ℃,200 r.min^-1Culturing until the bacterial concentration OD₆₀₀Induction was performed with the addition of 0.04mM IPTG at a final concentration of 0.6 and at 30 ℃ for 48 h.

Example 3: purification of alkaline pectinase

Centrifuging the recombinant bacterium fermentation liquor at 8000r/min for 20min, taking supernatant, adding ammonium sulfate for gradient salting-out, centrifuging at low temperature to collect 30-50% ammonium sulfate precipitate, dissolving the enzyme subjected to salting-out precipitation in glycine-sodium hydroxide buffer solution (pH7.5), and dialyzing with 20mmol/L glycine-sodium hydroxide buffer solution for 24 h. And (3) further separating and purifying the supernatant obtained by centrifugation through cation exchange chromatography, desalting the obtained protein with 95% electrophoretic purity through a desalting column, and performing property determination on the obtained pure enzyme solution.

Example 4: determination of specific activity and half-life period of pure alkaline pectinase

Diluting the purified alkaline pectinase, measuring the enzyme activity, and measuring the protein concentration by using a BSA protein concentration measuring kit. The result shows that the alkaline pectinase mutant PGL-3S1 constructed by the invention has obviously improved thermal stability, and the half-life period at 60 ℃ is improved to 19min from the original 5.2. And the determination result of the enzyme activity shows that the specific enzyme activity of the starting PGL is 264.17 +/-5.48U/mg, while the specific enzyme activity of the mutant PGL-3S1 is as high as 902.25 +/-20.22U/mg, and the enzyme activity is improved by 3.42 times compared with the starting PGL.

In addition, the present invention also compares the thermal stability of the remaining fusion proteins fused with self-assembled amphiphilic short peptides of different lengths, and the results are shown in table 1.

TABLE 1 Effect of different lengths of amphiphilic short peptides on enzyme thermostability

The alkaline pectinase mutant constructed by the sequence shown in SEQ ID NO.4 has obviously improved thermal stability and the half-life period of 19.06 min.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> alkaline pectinase mutant with improved thermostability

<160>6

<170>PatentIn version 3.3

<210>1

<211>474

<212>PRT

<213> Artificial sequence

<400>1

Met His His His His His His Ala Glu Ala Glu Ala Lys Ala Lys Ala

1 5 10 15

Glu Ala Glu Ala Lys Ala Lys Ala Glu Ala Glu Ala Lys Ala Lys Ala

20 25 30

Glu Ala Glu Ala Lys Ala Lys Ala Glu Ala Glu Ala Lys Ala Lys Ala

35 40 45

Glu Ala Glu Ala Lys Ala Lys Pro Thr Pro Pro Thr Thr Pro Thr Pro

50 55 60

Pro Thr Thr Pro Thr Pro Thr Pro Ala Met Asp Ala Asp Leu Gly His

65 70 75 80

Gln Thr Leu Gly Ser Asn Asp Gly Trp Gly Ala Tyr Ser Thr Gly Thr

85 90 95

Thr Gly Gly Ser Lys Ala Ser Ser Leu Asn Val Tyr Thr Val Ser Asn

100 105 110

Arg Asn Gln Leu Val Ser Ala Leu Gly Lys Glu Thr Asn Thr Thr Pro

115 120 125

Lys Ile Ile Tyr Ile Lys Gly Thr Ile Asp Met Asn Val Asp Asp Asn

130 135 140

Leu Lys Pro Leu Gly Leu Asn Asp Tyr Lys Asp Pro Glu Tyr Asp Leu

145 150 155 160

Asp Lys Tyr Leu Lys Ala Tyr Asp Pro Ser Thr Trp Gly Lys Lys Glu

165 170 175

Pro Ser Gly Thr Gln Glu Glu Ala Arg Ala Arg Ser Gln Lys Asn Gln

180 185 190

Lys Ala Arg Val Met Val Asp Ile Pro Ala Asn Thr Thr Ile Val Gly

195 200 205

Ser Gly Thr Asn Ala Lys Val Val Gly Gly Asn Phe Gln Ile Lys Ser

210 215 220

Asp Asn Val Ile Ile Arg Asn Ile Glu Phe Gln Asp Ala Tyr Asp Tyr

225 230 235 240

Phe Pro Gln Trp Asp Pro Thr Asp Gly Ser Ser Gly Asn Trp Asn Ser

245 250 255

Gln Tyr Asp Asn Ile Thr Ile Asn Gly Gly Thr His Ile Trp Ile Asp

260 265 270

His Cys Thr Phe Asn Asp Gly Ser Arg Pro Asp Ser Thr Ser Pro Lys

275 280 285

Tyr Tyr Gly Arg Lys Tyr Gln His His Asp Gly Gln Thr Asp Ala Ser

290 295 300

Asn Gly Ala Asn Tyr Ile Thr Met Ser Tyr Asn Tyr Tyr His Asp His

305 310 315 320

Asp Lys Ser Ser Ile Phe Gly Ser Ser Asp Ser Lys Thr Ser Asp Asp

325 330 335

Gly Lys Leu Lys Ile Thr Leu His His Asn Arg Tyr Lys Asn Ile Val

340 345 350

Gln Arg Ala Pro Arg Val Arg Phe Gly Gln Val His Val Tyr Asn Asn

355 360 365

Tyr Tyr Glu Gly Ser Thr Ser Ser Ser Ser Tyr Pro Phe Ser Tyr Ala

370 375 380

Trp Gly Ile Gly Lys Ser Ser Lys Ile Tyr Ala Gln Asn Asn Val Ile

385 390 395 400

Asp Val Pro Gly Leu Ser Ala Ala Lys Thr Ile Ser Val Phe Ser Gly

405 410 415

Gly Thr Ala Leu Tyr Asp Ser Gly Thr Leu Leu Asn Gly Thr Gln Ile

420 425 430

Asn Ala Ser Ala Ala Asn Gly Leu Ser Ser Ser Val Gly Trp Thr Pro

435 440 445

Ser Leu His Gly Ser Ile Asp Ala Ser Ala Asn Val Lys Ser Asn Val

450 455 460

Ile Asn Gln Ala Gly Ala Gly Lys Leu Asn

465 470

<210>2

<211>1431

<212>DNA

<213> Artificial sequence

<400>2

atgcatcatc atcatcatca tgcagaagca gaagcgaaag ccaaagcaga agcagaagcg 60

aaagccaaag cagaagcaga agcgaaagcc aaagcagaag cagaagcgaa agccaaagca 120

gaagcagaag cgaaagccaa agcagaagca gaagcgaaag ccaaatggat atcgcctact 180

ccgccgacga ccccgacccc gccgaccacc ccgactccga ccccagccat ggatgctgat 240

ttaggccacc agacgttgggatccaatgat ggctggggcg cgtactcgac cggcacgaca 300

ggcgggtcaa aagcatcgtc cttaaatgtg tataccgtca gcaacagaaa ccagcttgtc 360

tcggcattag ggaaggaaac gaacacaacg ccaaaaatca tttatatcaa gggaacgatt 420

gacatgaacg tagatgacaa tctgaagccg cttggtctaa atgactataa agatccggag 480

tatgatttgg acaaatattt gaaagcctat gatcctagca catggggcaa aaaagagccg 540

tcgggaacac aagaagaagc gagagcacgc tctcagaaaa accaaaaagc acgggttatg 600

gtggatatcc ctgcaaacac gacgatcgtc ggttcaggga ctaacgctaa agtcgtggga 660

ggaaacttcc aaatcaagag tgataacgtc attattcgca acattgaatt ccaggatgcc 720

tatgattatt ttccgcaatg ggatccgact gacggaagct caggaaactg gaactcacaa 780

tacgacaaca tcacgataaa cggcggcaca cacatctgga ttgatcactg tacatttaac 840

gacggttcgc gtccggacag cacatcaccg aaatattatg gaagaaaata tcagcaccat 900

gacggccaaa cggatgcgtc caacggcgct aactatatca cgatgtccta caactattat 960

cacgatcatg ataaaagctc cattttcgga tcaagtgaca gcaaaacctc cgatgacggc 1020

aaattaaaaa ttacgctcca tcataaccgc tataaaaata ttgtccagcg cgcgccgaga 1080

gtccgcttcg ggcaagtgca cgtatacaac aactattatg aaggaagcac aagctcttca 1140

agttatcctt tcagctatgc atggggaatc ggaaagtcat ctaaaatcta tgcccaaaac 1200

aatgtcattg acgtaccggg actgtcagct gctaaaacga tcagcgtatt cagcggggga 1260

acggctttat atgactccgg cacgttgctg aacggcacac agatcaacgc atcggctgca 1320

aacgggctga gctcttctgt cggctggacg ccgtctctgc atggatcgat tgatgcttct 1380

gctaatgtga aatcaaatgt cataaatcaa gcgggtgcgg gtaaattaaa t 1431

<210>3

<211>401

<212>PRT

<213> Artificial sequence

<400>3

Met Asp Ala Asp Leu Gly His Gln Thr Leu Gly Ser Asn Asp Gly Trp

1 5 10 15

Gly Ala Tyr Ser Thr Gly Thr Thr Gly Gly Ser Lys Ala Ser Ser Leu

20 25 30

Asn Val Tyr Thr Val Ser Asn Arg Asn Gln Leu Val Ser Ala Leu Gly

35 40 45

Lys Glu Thr Asn Thr Thr Pro Lys Ile Ile Tyr Ile Lys Gly Thr Ile

50 55 60

Asp Met Asn Val Asp Asp Asn Leu Lys Pro Leu Gly Leu Asn Asp Tyr

65 70 75 80

Lys Asp Pro Glu Tyr Asp Leu Asp Lys Tyr Leu Lys Ala Tyr Asp Pro

85 90 95

Ser Thr Trp Gly Lys Lys Glu Pro Ser Gly Thr Gln Glu Glu Ala Arg

100 105 110

Ala Arg Ser Gln Lys Asn Gln Lys Ala Arg Val Met Val Asp Ile Pro

115 120 125

Ala Asn Thr Thr Ile Val Gly Ser Gly Thr Asn Ala Lys Val Val Gly

130 135 140

Gly Asn Phe Gln Ile Lys Ser Asp Asn Val Ile Ile Arg Asn Ile Glu

145 150 155 160

Phe Gln Asp Ala Tyr Asp Tyr Phe Pro Gln Trp Asp Pro Thr Asp Gly

165 170 175

Ser Ser Gly Asn Trp Asn Ser Gln Tyr Asp Asn Ile Thr Ile Asn Gly

180 185 190

Gly Thr His Ile Trp Ile Asp His Cys Thr Phe Asn Asp Gly Ser Arg

195 200 205

Pro Asp Ser Thr Ser Pro Lys Tyr Tyr Gly Arg Lys Tyr Gln His His

210 215 220

Asp Gly Gln Thr Asp Ala Ser Asn Gly Ala Asn Tyr Ile Thr Met Ser

225 230 235 240

Tyr Asn Tyr Tyr His Asp His Asp Lys Ser Ser Ile Phe Gly Ser Ser

245 250 255

Asp Ser Lys Thr Ser Asp Asp Gly Lys Leu Lys Ile Thr Leu His His

260 265 270

Asn Arg Tyr Lys Asn Ile Val Gln Arg Ala Pro Arg Val Arg Phe Gly

275 280 285

Gln Val His Val Tyr Asn Asn Tyr Tyr Glu Gly Ser Thr Ser Ser Ser

290 295 300

Ser Tyr Pro Phe Ser Tyr Ala Trp Gly Ile Gly Lys Ser Ser Lys Ile

305 310 315 320

Tyr Ala Gln Asn Asn Val Ile Asp Val Pro Gly Leu Ser Ala Ala Lys

325 330 335

Thr Ile Ser Val Phe Ser Gly Gly Thr Ala Leu Tyr Asp Ser Gly Thr

340 345 350

Leu Leu Asn Gly Thr Gln Ile Asn Ala Ser Ala Ala Asn Gly Leu Ser

355 360 365

Ser Ser Val Gly Trp Thr Pro Ser Leu His Gly Ser Ile Asp Ala Ser

370 375 380

Ala Asn Val Lys Ser Asn Val Ile Asn Gln Ala Gly Ala Gly Lys Leu

385 390 395 400

Asn

<210>4

<211>48

<212>PRT

<213> Artificial sequence

<400>4

Ala Glu Ala Glu Ala Lys Ala Lys Ala Glu Ala Glu Ala Lys Ala Lys

1 5 10 15

Ala Glu Ala Glu Ala Lys Ala Lys Ala Glu Ala Glu Ala Lys Ala Lys

20 25 30

Ala Glu Ala Glu Ala Lys Ala Lys Ala Glu Ala Glu Ala Lys Ala Lys

35 40 45

<210>5

<211>16

<212>PRT

<213> Artificial sequence

<400>5

Pro Thr Pro Pro Thr Thr Pro Thr Pro Pro Thr Thr Pro Thr Pro Thr

1 5 10 15

<210>6

<211>8

<212>PRT

<213> Artificial sequence

<400>6

Ala Glu Ala Glu Ala Lys Ala Lys

1 5

Claims

1. An alkaline pectinase mutant is characterized in that the amino acid sequence is shown as SEQ ID NO. 1.

2. A gene encoding the alkaline pectinase mutant according to claim 1.

3. A cell line comprising the alkaline pectinase mutant of claim 1.

4. A vector carrying the gene of claim 2.

5. A method for improving the thermal stability of alkaline pectinase is characterized in that the N end of the alkaline pectinase shown in SEQ ID No.3 is connected with an amphiphilic short peptide shown in SEQ ID No.4 through PT-Linker.

6. A gene engineering bacterium for producing alkaline pectinase is characterized in that an alkaline pectinase mutant shown in SEQ ID NO.1 is expressed by taking escherichia coli as a host and pET-22b (+) as a vector.

7. The method for constructing the genetically engineered bacterium of claim 6, wherein pET-22b (+) is used as a vector, and the gene shown in SEQ ID NO.2 is connected with the vector and transformed into Escherichia coli.

8. A method for producing alkaline pectinase, which comprises inoculating the genetically engineered bacterium of claim 5 to a fermentation medium, and culturing at 30-37 deg.C to OD₆₀₀Adding IPTG with the final concentration of 0.04-0.06 mmol/L into the mixture of 0.6-1.0, and inducing the mixture for 24-72 hours at the temperature of 28-30 ℃.

9. The method according to claim 8, wherein the inoculation is a 3-5% seed solution by volume inoculation.

10. The method according to claim 8 or 9, characterized in that the fermentation medium is TB medium.

11. The use of the genetically engineered bacterium of claim 6 in the preparation of alkaline pectinase in the fields of textile, food, paper making and environment.