CN115851981A - Good colony breeding method of bream - Google Patents
Good colony breeding method of bream Download PDFInfo
- Publication number
- CN115851981A CN115851981A CN202211458063.2A CN202211458063A CN115851981A CN 115851981 A CN115851981 A CN 115851981A CN 202211458063 A CN202211458063 A CN 202211458063A CN 115851981 A CN115851981 A CN 115851981A
- Authority
- CN
- China
- Prior art keywords
- bream
- primer
- primer pair
- individual
- individuals
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the field of animal molecular genetics, and relates to a fine bream population breeding method, which comprises the following steps: 1) Selecting a plurality of bream individuals; 2) Extracting DNA of bream individuals and carrying out PCR amplification to obtain genetic relationship; 3) Selecting bream individuals in the farthest genetic relationship for pairing propagation, and selecting bream generation individuals with optimal biological characters as candidate parents; 4) Extracting DNA of bream first generation individuals and carrying out PCR amplification to obtain the genetic relationship of the bream first generation; 5) Selecting bream generation individuals in the farthest genetic relationship for pairing propagation, and selecting bream generation individuals with optimal biological characters as candidate parents; 6) And (5) repeating the steps 4) to 5) until bream with a good population is obtained. The invention provides a good colony breeding method of bream, which can be rapidly cultured, has stable good characters and great popularization value.
Description
Technical Field
The invention belongs to the field of animal molecular genetics, relates to a fish group breeding method, and particularly relates to a fine group breeding method of bream.
Background
Bream is herbivorous fish, fish seeds and adult fish take aquatic vascular bundle plants such as tape grass, hydrilla verticillata, eyebright and the like as main foodstuff, and like terrestrial gramineous plants and vegetable leaves, and can eat partial lake bottom plant debris and a small amount of zooplankton, so the herbivorous range is wide. Food intake started at 4 months and continued for 11 months, with a maximum food intake at 6-10 months. Bream belongs to medium-sized fish, has high growth speed and grows fastest in 1-2 years. Under the condition of rich aquatic weeds, the weight of the fishes in the current year can reach 100-200 g, the weight of the fishes in the second age can reach 300-500 g, the growth speed is gradually reduced later, and the maximum individual weight can reach 3-5 kg.
With the expansion of artificial culture of the bream, the genetic diversity of the bream is rapidly degenerated, the bream is seriously close to and propagated, so that the excellent characters of the bream are reduced, the growth speed of the bream is slowed, the sexual maturity time is early, and individual bream is reduced. These all restrict the income of farmers, so a method capable of improving the fine bream population breeding is urgently needed.
Disclosure of Invention
In order to solve the technical problems in the background art, the invention provides a good colony breeding method of bream, which can be rapidly cultured, has stable good properties and great popularization value.
In order to achieve the purpose, the invention adopts the following technical scheme:
a PCR primer for identifying bream is characterized in that: the PCR primer for identifying the bream comprises 5 groups, wherein each group comprises two pairs of primer sequences;
the group A comprises a primer pair A1 and a primer pair A2, wherein a forward primer F of the primer pair A1 is ATTGACTTGTTATCGTTTGT, and a reverse primer R is GTTCCGACATGAGGCT; the forward primer F of the primer pair A2 is TACTGATACATGCAGAA, and the reverse primer R is GAAAGCAAATTTAGGAG;
the B group comprises a B1 primer pair and a B2 primer pair, wherein the forward primer F of the B1 primer pair is GTGCGACAAGGAGTCAA, and the reverse primer R is CCTGCTGTCCGTGAGT; the forward primer F of the B2 primer pair is AAGAATAACTACTACCAAGT, and the reverse primer R is GATTATCAGCCGAACAA;
the C group comprises a C1 primer pair and a C2 primer pair, wherein the forward primer F of the C1 primer pair is GTTAGTTTCGTGCGCAT, and the reverse primer R is CGTTCTCGCGTCCAT; the forward primer F of the C2 primer pair is GTATCTGCACTTTCAAATAA, and the reverse primer R is GTGAACTTCAGCCTGTG;
the D group comprises a D1 primer pair and a D2 primer pair, wherein the forward primer F of the D1 primer pair is TGTGCGCGAGTGAATG, and the reverse primer R is TCCAGACGGAACAATCC; the forward primer F of the D2 primer pair is ATTCATAAGGTACGTGA, and the reverse primer R is ATTCATAGACCATCATCT;
the E group comprises an E1 primer pair and an E2 primer pair, wherein the forward primer F of the E1 primer pair is GTGGCTGTGACCATCTG, and the reverse primer R is TACATTATGGCGTGCTG; the forward primer F of the E2 primer pair was CTGAGCACTGATACTTC and the reverse primer R was AAAGTTCATTTCTGTTC.
The PCR primer for identifying bream as described above is used for identifying bream.
The use of PCR primers for identifying bream as described above for identifying different families of bream.
A good colony breeding method of bream based on PCR primers for identifying the bream is characterized in that: the method for breeding the excellent bream group comprises the following steps:
1) Selecting a plurality of bream individuals;
2) Respectively extracting DNA of the bream individuals selected in the step 1), performing PCR amplification by using the DNA as a template and PCR primers for identifying the bream, and acquiring the genetic relationship of each bream individual in the step 1) according to the amplification result;
3) Selecting bream individuals in the farthest genetic relationship for pairing propagation to form M families, obtaining a bream generation in each family, feeding each individual of the bream generation independently, measuring the biological characters of each bream generation individual when each individual of the bream generation reaches sexual maturity, and selecting the bream generation individual with the optimal biological characters as candidate parents from the M families respectively;
4) Respectively extracting DNA of the candidate parents, repeating the step 2) by taking the DNA as a template to obtain the genetic relationship of each bream generation individual in the candidate parents;
5) Selecting bream individuals in the farthest genetic relationship for pairing propagation, continuously pairing to form M families, obtaining two generations of bream in each family, feeding each individual of the two generations of bream separately, measuring the biological character of each individual of the two generations of bream when each individual of the two generations of bream reaches sexual maturity, and respectively selecting the bream individuals with the optimal biological characters as candidate parents in the M families;
6) Repeating the steps 4) to 5) until bream with good colony is obtained.
Preferably, in step 2) adopted by the present invention, the manner of acquiring the genetic relationship is:
2.1 Obtaining a bream individual fin ray sample;
2.2 Extracting DNA of individual bream fin strip samples;
2.3 Using DNA as a template and using a PCR primer for identifying bream to carry out PCR amplification to obtain a PCR amplification product;
2.4 Carrying out electrophoretic separation on the PCR amplification product on 10% polyacrylamide gel, and counting the genotype of the PCR amplification product according to the separation result;
2.5 Based on the genotype of the PCR product, a cluster development tree was constructed using the mega5.0 software and the population software, and the genetic relationship between individuals was identified based on the cluster analysis map.
Preferably, in step 2.3) of the present invention, the PCR reaction system is 25ul:10 XPCR Buffer 3ul,2.5mmol/L dNTP 2ul,2mmol/LMgCl 2 3ul of PCR primers for identifying bream, 0.5ul of each PCR primer for identifying bream, 2ul of DNA template and 10.5ul of ultrapure water.
Preferably, in step 2.3) adopted by the invention, the PCR reaction procedure is as follows: pre-denaturation at 94 ℃ for 3min; denaturation at 94 ℃ for 30s, annealing temperature renaturation for 30s, extension at 72 ℃ for 30s, and 35 cycles; extending for 10min at 72 ℃; storing at 4 ℃.
Preferably, the specific implementation manner of step 1) adopted by the invention is as follows: the bream is collected in a natural water area, the biological characteristics of the bream are measured, and the bream with the optimal biological character is selected as a bream individual.
Preferably, the individual breeding adopted by the invention is to hatch and grow seedlings under the same conditions, the fed feed is unified into bream compound feed, the feed is fed for 4 times every day, and the feeding amount of each time is 2 percent of the fish body weight.
Compared with the prior art, the invention has the following advantages:
the invention provides a bream excellent group breeding method, which can effectively breed stably inherited bream groups with excellent characters, wherein the traditional fish excellent shape breeding method is to simply carry out pairing propagation on male and female individuals with better shapes, and the traditional pairing mode does not take little role of heredity in propagation because many characters can be highlighted by environmental factors, but the excellent characters of the individuals cannot be inherited to the next generation, so that farmers waste a lot of time and financial resources. The method combines inheritance and excellent characters, so that the offspring of the bream has stable excellent characters, and the income of bream farmers is increased. Compared with the traditional excellent character cultivation method, the method has the characteristics of rapidness, stability and great popularization value.
Drawings
FIG. 1 shows the genetic relationship results of 9 breams in example 3;
fig. 2 shows the results of the 30-tailed bream-individual affinity in example 4.
Detailed Description
Example 1 extraction of bream DNA
Genomic DNA extraction was performed according to the conventional phenol/chloroform method, approximately 50mg of fin tissue was clipped, placed in a 1.5mL EP tube, added with a lysis buffer (50 mmol/L NaCl,30mmol/L Tris-HCl (pH 8.0), 200mmol/L EDTA (ethylene diamine tetraacetic acid) (pH 8.0), 1%: chloroform: isoamyl alcohol (25.
Example 2 PCR amplification of bream samples using microsatellite loci
Taking all bream fin-fin sample to be measured, extracting bream sample DNA by using a DNA extraction kit produced by Tiangen Biochemical technology (Beijing) Limited, performing PCR amplification on the bream sample DNA by using microsatellite loci, and performing electrophoretic separation on a 10% polyacrylamide gel of a PCR amplification product; and (4) counting the genotype of the PCR amplification product according to the separation result. Wherein, the PCR reaction system is 25ul:10 XPCR Buffer 3ul,2.5mmol/L dNTP 2ul,2mmol/L MgCl 2 3ul, 1ul, 5U/. Mu.LTaq enzyme 0.5ul, DNA template 2ul, and ultrapure water 10.5ul, respectively, were added to the upstream and downstream primers shown in Table 1. The PCR reaction program is: pre-denaturation at 94 ℃ for 3min; denaturation at 94 ℃ for 30s, annealing temperature renaturation for 30s, extension at 72 ℃ for 30s, and 35 cycles; extending for 10min at 72 ℃; storing at 4 deg.C.
TABLE 1
Example 3
9 individual sex mature breams are collected in the Yangtze river area, and the distance of the genetic relationship of the 9 individual sex mature breams is measured.
Fin-ray samples were taken from the 9 bream individuals and DNA was extracted using the method disclosed in example 1. The 9 bream DNA was amplified by the PCR method provided in example 2, the mega5.0 software and the population software were used as a cluster development tree according to the amplification results, the genetic relationship between individuals was identified according to the cluster analysis map, and the distance of the genetic relationship between the 9 bream individuals was measured. The results of the 9-tailed bream's individual relatedness are shown in fig. 1, in which the relatedness of individual 7 to individual 4 is closer, the relatedness of individual 2 to individual 5 is closer, and the distance between the branch formed by individual 4 and individual 7 and the branch formed by individual 2 and individual 5 is further, indicating that the relatedness between the two branches is further. It is therefore recommended that individual 7 and individual 5 constitute a paired reproduction, that individual 2 and individual 4 constitute a paired reproduction, and that individual 1 and individual 6 constitute a paired reproduction. In this way, the sub-generation bream with excellent performance can be obtained.
Example 4
Collecting 11 tails of sexual mature bream (marked as a bream colony) from the Yangtze river region, 10 tails of sexual mature bream (marked as a bream colony) from the yellow river region, and 9 tails of sexual mature bream (marked as a bream colony) from the Yangtze river region. The 30 breams were measured for distance to individual relatedness.
Fin ray samples were taken from the 30 bream individuals in example 1, and DNA was extracted. The 30 bream DNA was amplified by the PCR method provided in example 2, the mega5.0 software and the population software were used as a cluster development tree according to the amplification results, the genetic relationship between individuals was identified according to the cluster analysis map, and the distance of the 30 bream individual genetic relationship was measured. The results of the relationship between the 30 breams are shown in fig. 2, and the three populations (the bream population in pearl river, the bream population in yellow river and the bream population in Yangtze river) can be distinguished from each other according to the cluster analysis map so that the relationship between the bream population in pearl river and the bream population in Yangtze river is closer to that between the bream population in yellow river. According to the cluster analysis chart, individuals 2 and 15 are recommended to form paired reproduction, individuals 8 and 16 are recommended to form paired reproduction, individuals 13 and 5 are recommended to form paired reproduction, individuals 14 and 6 are recommended to form paired reproduction, individuals 7 and 12 are recommended to form paired reproduction, individuals 10 and 21 are recommended to form paired reproduction, individuals 20 and 29 are recommended to form paired reproduction, individuals 22 and 17 are recommended to form paired reproduction, and individuals 18 and 23 are recommended to form paired reproduction. These 9 male and female individuals constitute 9 families. 10 individuals with excellent characters are selected from the 9 family offspring generations to serve as backup parent fishes for carrying out pairing propagation offspring generations, the specific pairing mode is the mode, and the bream group with excellent characters and stable inheritance can be obtained through breeding of 3-5 generations.
Claims (9)
1. A PCR primer for identifying bream is characterized in that: the PCR primer for identifying the bream comprises 5 groups, wherein each group comprises two pairs of primer sequences;
the group A comprises a primer pair A1 and a primer pair A2, wherein a forward primer F of the primer pair A1 is ATTGACTTGTTATCGTTTGT, and a reverse primer R is GTTCCGACATGAGGCT; the forward primer F of the primer pair A2 is TACTGATACATGCAGAA, and the reverse primer R is GAAAGCAAATTTAGGAG;
the B group comprises a B1 primer pair and a B2 primer pair, wherein the forward primer F of the B1 primer pair is GTGCGACAAGGAGTCAA, and the reverse primer R is CCTGCTGTCCGTGAGT; the forward primer F of the B2 primer pair is AAGAATAACTACTACCAAGT, and the reverse primer R is GATTATCAGCCGAACAA;
the C group comprises a C1 primer pair and a C2 primer pair, wherein the forward primer F of the C1 primer pair is GTTAGTTTCGTGCGCAT, and the reverse primer R is CGTTCTCGCGTCCAT; the forward primer F of the C2 primer pair is GTATCTGCACTTTCAAATAA, and the reverse primer R is GTGAACTTCAGCCTGTG;
the D group comprises a D1 primer pair and a D2 primer pair, wherein the forward primer F of the D1 primer pair is TGTGCGCGAGTGAATG, and the reverse primer R is TCCAGACGGAACAATCC; the forward primer F of the D2 primer pair is ATTCATAAGGTACGTGA, and the reverse primer R is ATTCATAGACCATCATCT;
the group E comprises an E1 primer pair and an E2 primer pair, wherein a forward primer F of the E1 primer pair is GTGGCTGTGACCATCTG, and a reverse primer R is TACATTATGGCGTGCTG; the forward primer F of the E2 primer pair was CTGAGCACTGATACTTC and the reverse primer R was AAAGTTCATTTCTGTTC.
2. Use of the PCR primer for identifying bream according to claim 1 for identifying bream.
3. Use of the PCR primers of claim 1 for identifying bream for identifying different families of bream.
4. A method for breeding a good colony of bream based on the PCR primers for identifying bream as claimed in claim 1, wherein: the good colony breeding method of bream comprises the following steps:
1) Selecting a plurality of bream individuals;
2) Respectively extracting DNA of the bream individuals selected in the step 1), performing PCR amplification by using the DNA as a template and the PCR primer for identifying the bream as claimed in claim 1, and acquiring the genetic relationship of each bream individual in the step 1) according to the amplification result;
3) Selecting bream individuals in the farthest genetic relationship for pairing propagation to form M families, obtaining a bream generation in each family, feeding each individual of the bream generation independently, measuring the biological characters of each bream generation individual when each individual of the bream generation reaches sexual maturity, and selecting the bream generation individual with the optimal biological characters as candidate parents from the M families respectively;
4) Respectively extracting DNA of the candidate parents, repeating the step 2) by taking the DNA as a template to obtain the genetic relationship of each bream generation individual in the candidate parents;
5) Selecting bream individuals in the farthest genetic relationship for pairing propagation, continuously pairing to form M families, obtaining two generations of bream in each family, feeding each individual of the two generations of bream separately, measuring the biological character of each individual of the two generations of bream when each individual of the two generations of bream reaches sexual maturity, and respectively selecting the bream individuals with the optimal biological characters as candidate parents in the M families;
6) Repeating the steps 4) to 5) until bream with good colony is obtained.
5. The method for breeding superior colony of bream according to claim 4, wherein: in the step 2), the manner of acquiring the genetic relationship is as follows:
2.1 Obtaining a bream individual fin ray sample;
2.2 Extracting DNA of individual bream fin strip samples;
2.3 Using DNA as a template, and performing PCR amplification by using the PCR primer for identifying bream according to claim 1 to obtain a PCR amplification product;
2.4 Carrying out electrophoretic separation on the PCR amplification product on 10% polyacrylamide gel, and counting the genotype of the PCR amplification product according to the separation result;
2.5 Based on the genotype of the PCR product, a cluster development tree was constructed using the mega5.0 software and the population software, and the genetic relationship between individuals was identified based on the cluster analysis map.
6. The method for breeding the fine bream population according to claim 5, wherein: in the step 2.3), the PCR reaction system is 25ul:10 XPCR Buffer 3ul,2.5mmol/L dNTP 2ul,2mmol/LMgCl 2 3ul, 1ul of each of the PCR primers for identifying bream described in claim 1, 0.5ul of 5U/. Mu.LTaq enzyme, 2ul of DNA template, and 10.5ul of ultrapure water.
7. The method for breeding superior colony of bream according to claim 6, wherein: in the step 2.3), the PCR reaction procedure is as follows: pre-denaturation at 94 ℃ for 3min; denaturation at 94 ℃ for 30s, annealing temperature renaturation for 30s, extension at 72 ℃ for 30s, and 35 cycles; extending for 10min at 72 ℃; storing at 4 deg.C.
8. The method for breeding the fine colony of the bream according to any one of claims 4-7, wherein: the specific implementation manner of the step 1) is as follows: bream is collected in a natural water area, the biological characteristics of the bream are measured, and the bream with the optimal biological character is selected as a bream individual.
9. The method for breeding the fine bream population according to claim 8, wherein: the independent feeding is to adopt the same conditions to hatch and raise seedlings, the fed feed is unified into bream compound feed, the feed is fed for 4 times every day, and the feeding amount of each time is 2 percent of the fish body weight.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211458063.2A CN115851981A (en) | 2022-11-16 | 2022-11-16 | Good colony breeding method of bream |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211458063.2A CN115851981A (en) | 2022-11-16 | 2022-11-16 | Good colony breeding method of bream |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115851981A true CN115851981A (en) | 2023-03-28 |
Family
ID=85664493
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211458063.2A Pending CN115851981A (en) | 2022-11-16 | 2022-11-16 | Good colony breeding method of bream |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115851981A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116836989A (en) * | 2023-06-30 | 2023-10-03 | 中国长江三峡集团有限公司中华鲟研究所 | Male molecular marker of bream and application thereof |
-
2022
- 2022-11-16 CN CN202211458063.2A patent/CN115851981A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116836989A (en) * | 2023-06-30 | 2023-10-03 | 中国长江三峡集团有限公司中华鲟研究所 | Male molecular marker of bream and application thereof |
| CN116836989B (en) * | 2023-06-30 | 2024-01-05 | 中国长江三峡集团有限公司中华鲟研究所 | Male molecular marker of bream and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114107522B (en) | Specific marker of female and male genetic sex of oplegnathus punctatus, identification method and kit | |
| CN111394445B (en) | Indel marker for sex identification of channa maculata and application thereof | |
| CN101120666A (en) | Method for selectively cultivating new variety of carp | |
| CN105506162B (en) | SNP (single nucleotide polymorphism) marker related to rapid growth of crassostrea gigas as well as identification method and application thereof | |
| CN113201549B (en) | RNA for improving low-temperature tolerance of plants and application thereof | |
| CN108998547A (en) | A kind of microsatellite marking method for C. guichenoti paternity test | |
| CN102634522A (en) | Gene for controlling rice fertility, encoded protein and application thereof | |
| CN111466291A (en) | Breeding method of low cadmium accumulation rice | |
| CN115851981A (en) | Good colony breeding method of bream | |
| CN103798169A (en) | Method for quickly establishing improved breeding system of YY super-male pelteobagrus fulvidraco | |
| CN110331217B (en) | Microsatellite marker paternity test primer suitable for Nile tilapia, Oreochromis aureus and hybrid thereof, method and application | |
| CN114657264A (en) | Clarias fuscus gender-specific molecular marker primer and application thereof | |
| CN111304337A (en) | SRAP molecular marker, kit and method for identifying first filial generation of pelteobagrus fulvidraco, pelteobagrus vachelli and hybride and application | |
| CN109402170B (en) | Method for establishing fish male sterility model | |
| CN101120667A (en) | Method for optimizing variety of carp | |
| CN111057771B (en) | SNP molecular marker for distinguishing 'Zhongyang No. 1' from common fugu obscurus and application thereof | |
| CN113249442B (en) | Method for screening oyster unsaturated fatty acid content-related methylation modifying gene | |
| CN103320463B (en) | Method for obtaining rice sterile line by utilizing RNAi (Ribose Nucleic Acid interfere) technology to control rice fertile gene | |
| CN108184736B (en) | Nondestructive sampling method and application of procambarus clarkii living body | |
| CN113981103A (en) | Microsatellite primer pair for parent-child identification of macrobrachium rosenbergii microsatellites, detection kit and identification method | |
| CN108728551B (en) | Breeding method for keeping fine characters of Chinese sturgeons | |
| CN117025788B (en) | Microsatellite marker related to growth traits of Hippocampus kelloggi and application thereof | |
| CN113621711B (en) | Dual PCR microsatellite primer for bighead genetic diversity analysis and application | |
| CN114672572B (en) | Molecular marker related to 10-week-old weight of meat geese and application thereof | |
| CN117947183B (en) | Specific marker, primer, identification method, kit and application for detecting deficiency variation of intronic region of oplegnathus fasciatus gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |