CN101120667A - Method for optimizing variety of carp - Google Patents
Method for optimizing variety of carp Download PDFInfo
- Publication number
- CN101120667A CN101120667A CNA2007101443666A CN200710144366A CN101120667A CN 101120667 A CN101120667 A CN 101120667A CN A2007101443666 A CNA2007101443666 A CN A2007101443666A CN 200710144366 A CN200710144366 A CN 200710144366A CN 101120667 A CN101120667 A CN 101120667A
- Authority
- CN
- China
- Prior art keywords
- primer
- temperature
- microsatellite
- follows
- annealing temperature
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a method for the optimization of the fish variety, in particular to a method for the optimization of the carp variety, which resolves the problems that the inbreeding rate is high in the prior carp breeding cultivation and the intraspecific hybridization cultivation, thereby leading to the genetic degradation of the group and the decrease of the economic character and the production performance. The breeding procedures are: 1. performing the phenotypic character selection; 2. detecting the genetic information of the parent strain; 3. performing the reproduction grouping according to the genetic information; 4. the parent strains in each of the breeding group are free to mate with each other to get an optimized carp variety. The method of the present invention can avoid the inbreeding, so the variety can be optimized and the economic character and the production performance of the carps are obviously improved.
Description
Technical Field
The invention relates to a method for optimizing fish varieties.
Background
Carp is the largest aquaculture fish species in China and even in the world, and is the main economic aquaculture fish species in China. However, the economic characters and the production performance of carp breeding are reduced at present, and the main reason is the inbreeding of carps. The problems of inbreeding cannot be solved by the currently adopted colony breeding culture and intraspecific hybridization culture.
Disclosure of Invention
The invention aims to provide a carp variety optimization method for solving the problems of population genetic decline, economic character and production performance reduction caused by high near-parent mating proportion in the conventional carp breeding and intraspecific hybridization.
The carp is subjected to variety optimization according to the following steps: 1. selecting the phenotype characters of individual carps, and taking the carps meeting the requirements as breeding parents; 2. detecting genetic information between parents; 3. carrying out propagation matching according to genetic information, wherein propagation parents are divided into at least 2 propagation populations, and the genetic distance between any pair of male and female individuals in each propagation population is larger than the genetic distance between three generations of the family; 4. freely mating to obtain the carp with optimized variety.
The method comprises the following steps of selecting a surface type character formula
In the formula, xn is the phenotypic character measured value of the parent,
the average value of the carp population phenotypic characters is shown, and S is the standard difference of the carp population phenotypic characters. Step two, detecting genetic information among parents: a. extracting and propagating parent DNA; b. respectively carrying out PCR amplification on the parent DNA by using 30 pairs of microsatellite primers; c. carrying out digital treatment on the PCR amplification product by using map analysis software; d. and importing the digital data into genetic analysis software for analysis and calculation to obtain genetic information.
The method can avoid inbreeding, so that the variety can be optimized, and the economic character and the production performance of the carp are obviously improved.
Detailed Description
The first embodiment is as follows: the carp is subjected to variety optimization according to the following steps: 1. performing phenotypic character selection on individual carps, and taking the carps meeting the requirements as breeding parents; 2. detecting the genetic information between parents; 3. carrying out propagation matching according to genetic information, wherein propagation parents are divided into at least 2 propagation populations, and the genetic distance between any pair of male and female individuals in each propagation population is larger than the genetic distance between three generations of the family; 4. and (4) freely mating parents in each breeding group to obtain the carp with optimized variety.
The embodiment can also select the appearance, body type and other non-quantifiable phenotypic characters according to the breeding target. The embodiment can be used for selecting the phenotypic characters such as body type, body weight, body degree, body color and the like singly or comprehensively, and can also be used for selecting the comprehensive production characters such as fecundity, feed conversion rate and the like.
In the third step of the embodiment, the more the number of the breeding groups into which the breeding parents are divided is, the better the breeding groups are, more choices can be provided, and thus, carps with excellent varieties can be selected; and (5) eliminating parents which can not be matched in the third step.
The method of the embodiment has higher production efficiency than that of the gynogenesis method.
The second embodiment is as follows: the present embodiment differs from the first embodiment in that: in the first step, the expression character selection formula is
In the formula, xn is the measured value of the phenotypic character of the parent,the average value of the carp group phenotype traits is shown, and S is the standard deviation of the carp group phenotype traits. Other steps and parameters are the same as those in the first embodiment.
Since the selection intensity is known to be 1 time S, the selection intensity is highest, 2 times S, the selection intensity is medium, and 3 times S, the selection intensity is lowest, the present embodiment discards carp individuals that are greater than the mean value of the phenotypic trait + two-fold standard deviation and less than the mean value of the phenotypic trait-two-fold standard deviation.
The third concrete implementation mode: the difference between the present embodiment and the first embodiment is: step two, detecting genetic information among parents: a. extracting and propagating parent DNA; b. respectively carrying out PCR amplification on the parent DNA by using 30 pairs of micro-satellite primers; c. carrying out digital processing on the PCR amplification product by using map analysis software; d. and importing the digital data into genetic analysis software for analysis and calculation to obtain genetic information. Other steps and parameters are the same as those in the first embodiment.
In this embodiment, the breeding parents from which the DNA is extracted are marked by using electronic marking, conventional marking (cutting dorsal fins, tying plastic tubes of different colors, and other physical marking methods) or breeding in separate pools. In this embodiment, instead of using all 30 pairs of microsatellite primers, only some of the microsatellite primers (but more than 25 pairs of microsatellite primers) may be used for PCR amplification.
The fourth concrete implementation mode: the present embodiment is different from the third embodiment in that: in the step b, the total PCR reaction volume of each pair of microsatellite primers is 25 mu L, and the microsatellite primers are prepared from 18 mu LPCR reaction buffer solution, 50ng of propagation parent DNA, 1 mu L of microsatellite primers, 1UTaq polymerase and the balance of sterile ultrapure water; wherein each liter of the PCR reaction buffer solution consists of 0.25mmol of Tris-Cl with the pH value of 8.3, 1.25mmol of KCl,0.0375mmol MgCl 2 0.25mL of L-aspartic acid, 2.5mL of Tween, 2.5mL of L NP-40, 0.02mmol of dNTP and the balance of deionized water. Other steps and parameters are the same as those in the third embodiment.
The fifth concrete implementation mode: the present embodiment is different from the third embodiment in that: the PCR reaction procedure in step b is as follows: pre-denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 30sec, annealing at 30s, extension at 72 ℃ for 30s, cycling for 38 times, and final extension at 72 ℃ for 5min. Other steps and parameters are the same as those in the third embodiment.
The sixth specific implementation mode: the present embodiment is different from the third embodiment in that: the 30 pairs of microsatellite primers selected in step b and the annealing temperatures thereof are shown in Table 1. Other steps and parameters are the same as those in the third embodiment.
TABLE 1
| Genetic loci | Primer sequences | Repetitive sequence | Annealing temperature (. Degree.C.) |
| Cca04 | F：ATCCCTTACCGCCCTGTGT R：AGCTGAAAAACGCTGTCACG | (TA) 24 | 50 |
| HLJ019 | F：ACTGCTGGCTCAGGAACA R：AGAGCAAAGATGGTAGCTC | (CA) 26 | 53 |
| HLJ037 | F：CGTGGAGGCATAAGGGAT R：ACGGGAGCGTACAGAAAT | (CA) 14 | 53 |
| HLJ038 | F：CACAGAACGCATCAGTAA R：TGTAAACCTTCAACCTCC | (CA) 41 | 53 |
| HLJ041 | F：AGACCACCGCAGTAACAA R：GACTCACTCAGCACCAGA | (CA) 24 | 53 |
| HLJ044 | F：GTACAGCGTGACAGCATT R：AAGTTCATCGGTGTCCTC | (CA) 28 | 53 |
| HLJ046 | F：AACCCTGAACTCACAAAC R：CACGGAAACTGAGAAGAC | (GT) 14 | 53 |
| HLJ049 | F：GATTTGTGCTCCTCAACC R：CTGTCACTTCTCCTTCCA | (GT) 28 | 54 |
| HLJ055 | F：GGTACAACGGGAACCACA R：TGATTGACAGGCAGTGGG | (CT) 11 ；(CA) 29 | 54 |
| HLJ058 | F：CAGATGGCAGACAGGTAA R：GAGCAAGTGAGGGAACAG | (CA) 21 | 53 |
| HLJ060 | F：CGATCACTGGCAAGATTA R：ATGGACTACACCTCACCC | (GT) 23 | 54 |
| HLJ338 | F：GAAGAATGGGTGAGTAAGA R：ACTAGGATTTGGAAGAGC | (AC) 58 | 51 |
| HLJ372 | F：TCTACTTCTACCGCCACT R：GACTATTCACCTGCATCTT | (GT) 18 | 54 |
| HLJ379 | F：GGGGAGACGAGAAGTGCA R：AGCAGGTCTGTGGGCAAG | (CT) 13 | 54 |
| HLJ380 | F：AGGCAGACGAAAGGTAAA | (CA) 34 | 54 |
| R：CTCGCTTCTGTAGGCATT | |||
| HLJ383 | F：GGCTCCTCCTCATCCTCT R：GCACTTCTGCACCTTTCA | (CA) 14 | 51 |
| HLJ392 | F：GGCTACAAGGCAACACTG R：TGCGGTTAATGAGGTCTG | (CA) 22 | 54 |
| HLJ393 | F：TGCGGTCATTACTCATTCG R：CCCAGCACCTGTTTCCAC | (CA) 10 | 54 |
| HLJ398 | F：CATTACTTGAACTATCATCCA R：TGTGCTGAGGATTATTGG | (CT) 16 | 54 |
| HLJ400 | F：AAGAAGCCTCGGTCCTCC R：AAAGCCCAAAGCACATCA | (CA) 22 | 51 |
| HLJ805 | F：TCTGCTGAAGGGCGAACA R：ACGATCACGCTGCGACTA | (CA) 9 | 48 |
| HLJ806 | F：GGTGTCAGGCTTTAGTCC R：CATCTGAGTTTTCTCCAAGT | (CA) 48 | 48 |
| HLJ809 | F：ATCATCACAGCCAAAGAAGT R：TACGGACAIAGTGCAGACAA | (CA) 12 | 48 |
| HLJ817 | F：GACGATCCAGCAGCAATG R：CTCTTCCTAAAGCCTCAAA | (GT) 22 | 48 |
| HLJ848 | F：GAGAACACGGCTGGATGG R：GTGGGTGTTTGAATTGAGAT | (CA) 29 | 48 |
| HLJ855 | F：CGACCGAACTCAGAACAC R：GAGCACCGCATTAACAGA | (AC) 44 | 48 |
| HLJ873 | F：AGTGTCGTTTATGCGTATCTT R：AGCTCGCCTACTCTTCTACT | (CA) 50 | 48 |
| HLJ878 | F：AGTGGAGGACGTGACAGT R：AAGCAGAGCCTGATTTGA | (CA) 37 | 54 |
| HLJ896 | F：ATCACCAGTACATTCACT R：CGTTTAGCAAAGGTTAGT | (CA) 36 | 53 |
| HLJ900 | F：AAGGACGACGGAAGGTTT R：ACACTGACGGGTCAAGAG | (CT) 5 (CA) 34 | 50 |
The seventh embodiment: the present embodiment is different from the third embodiment in that: the genetic analysis software used in the step d is POPGENEN software and PHYLIP software. Other steps and parameters are the same as those in the third embodiment.
The specific implementation mode is eight: the present embodiment is different from the third embodiment in that: and c, carrying out gel electrophoresis on the PCR amplification product for 2h under the condition that the voltage is 200V, then dyeing by Gold View, carrying out gel electrophoresis by taking bromophenol blue as gel loading liquid, recording an electrophoresis result by using a gel imager, and carrying out digital processing by using map analysis software. Other steps and parameters are the same as those in the third embodiment.
The gel used in this embodiment is agarose gel with a concentration of 2%.
The specific implementation method nine: the present embodiment differs from the third or eighth embodiment in that: the mapping analysis software used in step c is Gel-pro4.5 software. Other steps and parameters are the same as those in the third or eighth embodiment.
The detailed implementation mode is ten: the carp is subjected to variety optimization according to the following steps:
step one, carrying out phenotypic character selection on parent carp of 450 uropygian carps in the national new improved breeding field, wherein the selection formula is
In the formula, xn is the measured value of the phenotypic character of the parent,
the average value of the carp group phenotype characters is obtained, S is the standard deviation of the carp group phenotype characters, carp individuals larger than the average value of the phenotype characters plus two-fold standard deviation and smaller than the average value of the phenotype characters minus two-fold standard deviation are removed, and carps meeting requirements are used as breeding parents.
Step two, detecting the genetic information among parents:
a. extracting and breeding parent DNA
Carrying out conventional physical marking on the breeding parents, cutting 0.08-0.12 g of fin rays one by one while marking, and putting the fin rays into a centrifugal tube (which can be put into a refrigerator for standby or directly used for extracting DNA) with the same mark as the breeding parents; adding 0.5mL of lysis solution (each liter of lysis solution contains 50mL of sodium dodecyl sarcosinate, 200 mu g of proteinase K and 0.01mol of EDTA) into a centrifuge tube, digesting for 1h at 50 ℃, and then treating the digestion solution in an environment at 68 ℃ for 15min; extracting with extractive solution (composed of phenol, chloroform and isoamyl alcohol at volume ratio of 25: 24: 1) with the same volume as digestive juice for 2 times; then digesting the RNA contained in the DNA-free RNA enzyme by using DNA-free RNA enzyme, and extracting for 2 times by using an extracting solution (the same as above); dialyzing for several times (each liter of dialysate contains 50mmol of Tris-Cl, 10mmol of EDTA, and 10mmol of NaCl) to OD 270 Less than 0.05; adding ice-precooled absolute ethanol with the volume 2 times that of the dialysate into the dialysate, centrifuging to remove supernatant after precipitation, adding ice-precooled ethanol with the volume equal to that of the precipitate into the precipitate, washing with the ethanol with the mass concentration of 70 percent, centrifuging to remove the supernatant, drying at room temperature, and dissolving with (1/10) xTE buffer solution. (or extracting DNA samples for PCR analysis by other standard methods, and storing the samples at 4 deg.C for further use)
b. 30 pairs of microsatellite primers are respectively used for carrying out PCR amplification on the parent DNA
The total PCR reaction volume of each pair of microsatellite primers is 25 mu L and is prepared by 18 mu L LPCR reaction buffer solution, 50ng propagation parent DNA, 1 mu L microsatellite primers, 1UTaq polymerase and the balance of sterile ultrapure water; wherein each liter of PCR reaction buffer solution comprises 0.25mmol of Tris-Cl with pH value of 8.3, 1.25mmol of KCl and 0.0375mmol of MgCl 2 、0.25mL Gelatin、2.5mL Tween、2.5mL NP-40、0.02mmol dNTP (the concentration of each dNTP of the 4 kinds of dNTP in a PCR reaction buffer solution is 0.005 mmol/L) and the rest deionized water; the PCR reaction program is: pre-denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 30sec, annealing at 30s, extension at 72 ℃ for 30s, circulating for 38 times, and finally extension at 72 ℃ for 5min; wherein 30 pairs of microsatellite primers are selected and usedThe annealing temperatures are shown in table 1.
c. The PCR amplification product is digitally processed by using map analysis software
Performing Gel electrophoresis on a PCR amplification product for 2h under the condition that the voltage is 200V, then dyeing by Gold View, performing Gel electrophoresis by taking bromophenol blue as a Gel loading solution, recording an electrophoresis result by using a Gel imager, and performing digital processing by using atlas analysis software Gel-pro 4.5.
d. Digital data import genetic analysis software analysis and calculation
And performing genetic analysis and calculation for POPGENEN software and PHYLIP software by using genetic analysis software to obtain genetic information of the propagating parents (poor individuals can be eliminated according to the genetic information).
And step three, carrying out propagation matching according to the genetic information, dividing the propagation parents into 2 propagation populations, wherein the genetic distance between any pair of male and female individuals in each propagation population is larger than the genetic distance between three generations of the family. (in this embodiment, each female parent has 2.5 male fishes in the population on average, and parents without close relationship or with genetic distance greater than the genetic distance of close relationship between three generations of families, i.e., genetic distance > 0.20, are selected for matching, and unmatched individuals with genetic distance less than 0.20 and heavy close relationship are removed.)
And step four, freely mating the parents in each breeding group to obtain the carp with optimized variety.
And comparing another 450-tailed mirror carp in the new and improved variety farm of China as a control group and Xingguo red carp as a blank group with the carp with the optimized variety in the embodiment. Under the condition of the same culture conditions, the carp with the optimized variety in the embodiment has an average growth speed which is 18.45% higher than that of a control group and 131.38% higher than that of a blank group; the body weight of the carp individual optimized according to the embodiment is 18% higher than that of the control group and 130% higher than that of the blank group.
Sequence listing
<110> research institute for aquatic products of Heilongjiang of China institute for aquatic science
<120> optimization method of carp variety
<160>60
<210>1
<211>19
<212>DNA
<213> Artificial sequence
<220>
<223> design of upstream primer of microsatellite primer (1) based on locus Cca04
<400>1
atcccttacc gccctgtgt 19
<210>2
<211>20
<212>DNA
<213> Artificial sequence
<220>
<223> design of downstream primer of microsatellite primer (1) based on locus Cca04
<400>2
agctgaaaaa cgctgtcacg 20
<210>3
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of upstream primer of microsatellite primer (2) based on locus HLJ019
<400>3
actgctggct caggaaca 18
<210>4
<211>19
<212>DNA
<213> Artificial sequence
<220>
<223> design of downstream primer of microsatellite primer (2) based on locus HLJ019
<400>4
agagcaaaga tggtagctc 19
<210>5
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of upstream primer of microsatellite primer (3) based on locus HLJ037
<400>5
cgtggaggca taagggat 18
<210>6
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of the downstream primer of microsatellite primer (3) according to locus HLJ037
<400>6
acgggagcgt acagaaat 18
<210>7
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of upstream primer of microsatellite primer (4) based on locus HLJ038
<400>7
cacagaacgc atcagtaa 18
<210>8
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of downstream primer of microsatellite primer (4) according to locus HLJ038
<400>8
tgtaaacctt caacctcc 18
<210>9
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of the upstream primer of microsatellite primer (5) according to locus HLJ041
<400>9
agaccaccgc agtaacaa 18
<210>10
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of the downstream primer of microsatellite primer (5) based on locus HLJ041
<400>10
gactcactca gcaccaga 18
<210>11
<211>17
<212>DNA
<213> Artificial sequence
<220>
<223> design of the upstream primer of microsatellite primer (6) according to locus HLJ044
<400>11
gtacagcgtg acagcat 17
<210>12
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of downstream primer of microsatellite primer (6) based on locus HLJ044
<400>12
aagttcatcg gtgtcctc 18
<210>13
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of the upstream primer of microsatellite primer (7) based on locus HLJ046
<400>13
aaccctgaac tcacaaac 18
<210>14
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of downstream primer of microsatellite primer (7) based on locus HLJ046
<400>14
cacggaaact gagaagac 18
<210>15
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of the upstream primer of microsatellite primer (8) according to locus HLJ049
<400>15
gatttgtgct cctcaacc 18
<210>16
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of downstream primer of microsatellite primer (8) according to locus HLJ049
<400>16
ctgtcacttc tccttcca 18
<210>17
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of the upstream primer of microsatellite primer (9) based on locus HLJ055
<400>17
ggtacaacgg gaaccaca 18
<210>18
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of the downstream primer of microsatellite primer (9) based on locus HLJ055
<400>18
tgattgacag gcagtggg 18
<210>19
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of the upstream primer of microsatellite primer (10) based on locus HLJ058
<400>19
cagatggcag acaggtaa 18
<210>20
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of downstream primers for microsatellite primers (10) based on locus HLJ058
<400>20
gagcaagtga gggaacag 18
<210>21
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of the upstream primer of microsatellite primer (11) based on locus HLJ060
<400>21
cgatcactgg caagatta 18
<210>22
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of downstream primer of microsatellite primer (11) based on locus HLJ060
<400>22
atggactaca cctcaccc 18
<210>23
<211>19
<212>DNA
<213> Artificial sequence
<220>
<223> design of the Forward primer of microsatellite primer (12) based on locus HLJ338
<400>23
gaagaatggg tgagtaaga 19
<210>24
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of the downstream primer of the microsatellite primer (12) according to the locus HLJ338
<400>24
actaggattt ggaagagc 18
<210>25
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of the upstream primer of microsatellite primer (13) based on locus HLJ372
<400>25
tctacttcta ccgccact 18
<210>26
<211>19
<212>DNA
<213> Artificial sequence
<220>
<223> design of downstream primer of microsatellite primer (13) based on locus HLJ372
<400>26
gactattcac ctgcatctt 19
<210>27
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of the upstream primer of the microsatellite primer (14) according to the locus HLJ379
<400>27
ggggagacga gaagtgca 18
<210>28
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of downstream primer of microsatellite primer (14) according to locus HLJ379
<400>28
agcaggtctg tgggcaag 18
<210>29
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of the upstream primer of microsatellite primer (15) according to locus HLJ380
<400>29
aggcagacga aaggtaaa 18
<210>30
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of downstream primer of microsatellite primer (15) based on locus HLJ380
<400>30
ctcgcttctg taggcatt 18
<210>31
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of the upstream primer of the microsatellite primer (16) according to the locus HLJ383
<400>31
ggctcctcct catcctct 18
<210>32
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of downstream primer of microsatellite primer (16) according to locus HLJ383
<400>32
gcacttctgc acctttca 18
<210>33
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of the upstream primer of microsatellite primer (17) based on locus HLJ392
<400>33
ggctacaagg caacactg 18
<210>34
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of downstream primer of microsatellite primer (17) based on locus HLJ392
<400>34
tgcggttaat gaggtctg 18
<210>35
<211>19
<212>DNA
<213> Artificial sequence
<220>
<223> design of the upstream primer of microsatellite primer (18) based on locus HLJ393
<400>35
tgcggtcatt actcattcg 19
<210>36
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of downstream primer of microsatellite primer (18) based on locus HLJ393
<400>36
cccagcacct gtttccac 18
<210>37
<211>21
<212>DNA
<213> Artificial sequence
<220>
<223> design of the upstream primer of microsatellite primer (19) according to locus HLJ398
<400>37
cattacttga actatcatcc a 21
<210>38
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of the downstream primer of microsatellite primer (19) according to locus HLJ398
<400>38
tgtgctgagg attattgg 18
<210>39
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of the upstream primer of the microsatellite primer (20) according to the locus HLJ400
<400>39
aagaagcctc ggtcctcc 18
<210>40
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of downstream primer of microsatellite primer (20) based on locus HLJ400
<400>40
aaagcccaaa gcacatca 18
<210>41
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> designing the upstream primer of microsatellite primer (21) based on locus HLJ805
<400>41
tctgctgaag ggcgaaca 18
<210>42
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of downstream primer of microsatellite primer (21) based on locus HLJ805
<400>42
acgatcacgc tgcgacta 18
<210>43
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of the upstream primer of the microsatellite primer (22) according to the locus HLJ806
<400>43
ggtgtcaggc tttagtcc 18
<210>44
<211>20
<212>DNA
<213> Artificial sequence
<220>
<223> design of downstream primer of microsatellite primer (22) based on locus HLJ806
<400>44
catctgagtt ttctccaagt 20
<210>45
<211>20
<212>DNA
<213> Artificial sequence
<220>
<223> design of the upstream primer of microsatellite primer (23) based on locus HLJ809
<400>45
atcatcacag ccaaagaagt 20
<210>46
<211>20
<212>DNA
<213> Artificial sequence
<220>
<223> design of the downstream primer of microsatellite primer (23) based on locus HLJ809
<400>46
tacggacata gtgcagacaa 20
<210>47
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of the upstream primer of microsatellite primer (24) according to locus HLJ817
<400>47
gacgatccag cagcaatg 18
<210>48
<211>19
<212>DNA
<213> Artificial sequence
<220>
<223> design of the downstream primer of microsatellite primer (24) based on locus HLJ817
<400>48
ctcttcctaa agcctcaaa 19
<210>49
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of the upstream primer of the microsatellite primer (25) according to the locus HLJ848
<400>49
gagaacacgg ctggatgg 18
<210>50
<211>20
<212>DNA
<213> Artificial sequence
<220>
<223> design of the downstream primer of the microsatellite primer (25) according to the locus HLJ848
<400>50
gtgggtgttt gaattgagat 20
<210>51
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> designing the upstream primer of the microsatellite primer (26) according to the locus HLJ855
<400>51
cgaccgaact cagaacac 18
<210>52
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of downstream primer of microsatellite primer (26) based on locus HLJ855
<400>52
gagcaccgca ttaacaga 18
<210>53
<211>21
<212>DNA
<213> Artificial sequence
<220>
<223> design of the upstream primer of microsatellite primer (27) based on locus HLJ873
<400>53
agtgtcgttt atgcgtatct t 21
<210>54
<211>20
<212>DNA
<213> Artificial sequence
<220>
<223> design of the downstream primer of the microsatellite primer (27) according to the locus HLJ873
<400>54
agctcgccta ctcttctact 20
<210>55
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of the upstream primer of the microsatellite primer (28) according to the locus HLJ878
<400>55
agtggaggac gtgacagt 18
<210>56
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of the downstream primer of the microsatellite primer (28) according to the locus HLJ878
<400>56
aagcagagcc tgatttga 18
<210>57
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of the upstream primer of microsatellite primer (29) based on locus HLJ896
<400>57
atcaccagta cattcact 18
<210>58
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of downstream primer of microsatellite primer (29) based on locus HLJ896
<400>58
cgtttagcaa aggttagt 18
<210>59
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of the upstream primer of the microsatellite primer (30) according to the locus HLJ900
<400>59
aaggacgacg gaaggttt 18
<210>60
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223> design of downstream primer of microsatellite primer (30) based on locus HLJ900
<400>60
acactgacgg gtcaagag 18
Claims (9)
1. The carp breed optimization method is characterized in that the carp breed optimization is carried out according to the following steps: 1. selecting the phenotype characters of individual carps, and taking the carps meeting the requirements as breeding parents; 2. detecting genetic information between parents; 3. carrying out propagation matching according to genetic information, wherein propagation parents are divided into at least 2 propagation populations, and the genetic distance between any pair of male and female individuals in each propagation population is larger than the genetic distance between three generations of the family; 4. and (4) freely mating the parents in each breeding group to obtain the carp with optimized variety.
2. The method of claim 1, wherein the step one of selecting the phenotypic character is represented by the following formula
In the formula, xn is the measured value of the phenotypic character of the parent,
the average value of the carp group phenotype traits is shown, and S is the standard deviation of the carp group phenotype traits.
3. The method for optimizing variety of carp according to claim 1, wherein the step two is to detect the genetic information between parents: a. extracting and propagating parent DNA; b. respectively carrying out PCR amplification on the parent DNA by using 30 pairs of micro-satellite primers; c. carrying out digital processing on the PCR amplification product by using map analysis software; d. and importing the digital data into genetic analysis software for analysis and calculation to obtain genetic information.
4. Method for optimizing carp breeds according to claim 3The method is characterized in that the total volume of PCR reaction of each pair of microsatellite primers in the step b is 25 muL, and the PCR reaction is prepared from 18 muL of LPCR reaction buffer solution, 50ng of propagation parent DNA, 1 muL of microsatellite primers, 1UTaq polymerase and the balance of sterile ultrapure water; wherein each liter of PCR reaction buffer solution comprises 0.25mmol of Tris-Cl with pH value of 8.3, 1.25mmol of KCl and 0.0375mmol of MgCl 2 0.25mL of L-aspartic acid, 2.5mL of Tween, 2.5mL of L NP-40, 0.02mmol of dNTP and the balance of deionized water.
5. The method for optimizing the variety of carp according to claim 3, wherein the PCR reaction program in step b is: pre-denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 30sec, annealing for 30s, extension at 72 ℃ for 30s, cycling for 38 times, and final extension at 72 ℃ for 5min.
6. The method of claim 3, wherein the 30 pairs of microsatellite primers and annealing temperatures thereof selected in step b are:
the microsatellite primer (1) is an upstream primer: ATCCTTACCCGCCTGTGTGT
A downstream primer: AGCTGAAAAACGCTGTCACG
The annealing temperature is as follows: at a temperature of 50 c,
the upper primer of the microsatellite primer (2): ACTGCTGGCTCAGGAACA
A downstream primer: AGAGCAAAGATGGTAGCTC
The annealing temperature is as follows: at a temperature of 53 c,
microsatellite primer (3) upstream primer: CGTGGAGGCATAAGGGAT
A downstream primer: ACGGGAGCGTACAGAAAT
The annealing temperature is as follows: at a temperature of 53 c,
the upper primer of the microsatellite primer (4): CACAGAAACGCATCAGTAA
A downstream primer: TGTAAACCTTCAACCTCC
The annealing temperature is as follows: at a temperature of 53 c,
microsatellite primer (5) upstream primer: AGACCACGCGCCAGTAACAA
A downstream primer: GACTCACTCACTCAGCACCAGA
The annealing temperature is as follows: at a temperature of 53 c,
microsatellite primer (6) upstream primer: GTACAGCGTGACAGCAT
A downstream primer: AAGTTCATCGGTGTCCTC
The annealing temperature is as follows: at a temperature of 53 c,
microsatellite primer (7) upstream primer: AACCCTGAACTCACAAAC
A downstream primer: CACGGAAACTGAAGAC
The annealing temperature is as follows: at a temperature of 53 c,
microsatellite primer (8) upstream primer: GATTTGTGCTCCTCAACC
A downstream primer: CTGTCACTTTCTCCTTCCA
The annealing temperature is as follows: at a temperature of 54 c,
microsatellite primer (9) upstream primer: GGTACAACGGGGAACCAC
A downstream primer: TGATTGACAGGCAGTGGG
The annealing temperature is as follows: at a temperature of 54 c,
microsatellite primer (10) upstream primer: CAGATGGCAGACAGGTAA
A downstream primer: GAGCAAGTGAGGGAACAG
The annealing temperature is as follows: at a temperature of 53 c,
microsatellite primer (11) upstream primer: cgATCACTGGCAAGATTA
A downstream primer: ATGGACTACACCTCACCCC
The annealing temperature is as follows: at a temperature of 54 c,
microsatellite primer (12) upstream primer: GAAGAATGGGTGAGTAAGA
A downstream primer: ACTAGGATTTGGAAGAGC
The annealing temperature is as follows: at a temperature of 51 c,
microsatellite primer (13) upstream primer: TCTACTTCTACCGCCACT
A downstream primer: GACTATTCACCTGCATCTT
The annealing temperature is as follows: at a temperature of 54 c,
microsatellite primer (14) upstream primer: GGGGAGACGAGAAGTGCA
A downstream primer: AGCAGGTCTGTGGGCAAG
The annealing temperature is as follows: at a temperature of 54 c,
microsatellite primer (15) upstream primer: AGGCAGACGAAAGGTAAA
A downstream primer: CTCGCTTCTGTAGGCATT
The annealing temperature is as follows: at a temperature of 54 c,
microsatellite primer (16) upstream primer: GGCTCCTCTCATCCTCT
A downstream primer: GCACTTCTGCACCTTTCA
The annealing temperature is as follows: at a temperature of 51 c,
microsatellite primer (17) upstream primer: GGCTACAAGGCAACACTG
A downstream primer: TGCGGTTAATGAGGTCTG
The annealing temperature is as follows: at a temperature of 54 c,
microsatellite primer (18) upstream primer: TGCGGTCATTCATTCG
A downstream primer: CCCAGCACCTGTTCCAC
The annealing temperature is as follows: at a temperature of 54 c,
microsatellite primer (19) upstream primer: CATTTACTTGAACTATCATCCA
A downstream primer: TGTGCTGAGGATATTGG
The annealing temperature is as follows: at a temperature of 54 c,
microsatellite primer (20) upstream primer: AAGAAGCCTCGCGTCCTCC
A downstream primer: AAAGCCCAAAGCCACATCA
The annealing temperature is as follows: at a temperature of 51 c,
microsatellite primer (21) upstream primer: TCTGCTGAAGGGCGAACA
A downstream primer: ACGATCACGCTGCGACTA
The annealing temperature is as follows: at a temperature of 48 c,
microsatellite primer (22) upstream primer: GGTGTCAGGCTTTAGTCC
A downstream primer: CATCTTGAGTTTCTCCAAGT
The annealing temperature is as follows: at a temperature of 48 c,
microsatellite primer (23) upstream primer: ATCA CAGCCAAAGAAGT
A downstream primer: TACGGACATAGTGCAGACAGACA
The annealing temperature is as follows: at a temperature of 48 c,
microsatellite primer (24) upstream primer: GACGATCCAGCAGCAATG
A downstream primer: CTCTTCCTAAAGCCTCAAA
The annealing temperature is as follows: at a temperature of 48 c,
microsatellite primer (25) upstream primer: GAGAACACGGCTGGATGGAGG
A downstream primer: GTGGGTGTTTGAATTGAGAT
The annealing temperature is as follows: at a temperature of 48 c,
microsatellite primer (26) upstream primer: CGACCGAACTCAGAGACAC
A downstream primer: GAGCACCGCATTAACAGA
The annealing temperature is as follows: at a temperature of 48 c,
microsatellite primer (27) upstream primer: AGTGTCGTTTATGCGTATCTT
A downstream primer: AGCTCGCCTACTCTTACT
The annealing temperature is as follows: at a temperature of 48 c,
microsatellite primer (28) upstream primer: AGTGGAGGACGTGACAGT
A downstream primer: AAGCAGAGCCTGATTGA
The annealing temperature is as follows: at a temperature of 54 c,
microsatellite primer (29) upstream primer: ATCACCAGTACATTCACT
A downstream primer: CGTTTAGCAAAGGTTAGT
The annealing temperature is as follows: at a temperature of 53 c,
microsatellite primer (30) upstream primer: AAGGACGACGGAAGGTTT
A downstream primer: ACACTGACGGGTCAAGAG
The annealing temperature is as follows: at 50 deg.C.
7. The method of claim 3, wherein the genetic analysis software used in step d is POPGENEN software and PHYLIP software.
8. The method for optimizing the variety of the carp, according to the claim 3, characterized in that the PCR amplification product in the step c is subjected to gel electrophoresis for 2h under the condition that the voltage is 200V, then Gold View is dyed, then bromophenol blue is used as gel loading liquid for gel electrophoresis, and then a gel imager is used for recording the electrophoresis result and graph analysis software is used for digital processing.
9. The method for optimizing variety of carp according to claim 3 or 8, wherein the mapping analysis software used in step c is gelpro4.5 software.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2007101443666A CN101120667A (en) | 2007-09-26 | 2007-09-26 | Method for optimizing variety of carp |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2007101443666A CN101120667A (en) | 2007-09-26 | 2007-09-26 | Method for optimizing variety of carp |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101120667A true CN101120667A (en) | 2008-02-13 |
Family
ID=39083334
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2007101443666A Pending CN101120667A (en) | 2007-09-26 | 2007-09-26 | Method for optimizing variety of carp |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101120667A (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102100201A (en) * | 2010-12-27 | 2011-06-22 | 上海海洋大学 | Method for breeding ornamental type Cyprinus carpio var. color |
| CN103276089A (en) * | 2013-05-31 | 2013-09-04 | 中国水产科学研究院长江水产研究所 | Paternity test method and kit of common suckers |
| CN105284685A (en) * | 2015-11-04 | 2016-02-03 | 台江县国营水产养殖场 | Crossbreeding method for Qingshui river carps and Furui carps |
| CN107018935A (en) * | 2017-05-23 | 2017-08-08 | 中国水产科学研究院黑龙江水产研究所 | A kind of wild makeup of chum salmon seedling is put |
| CN108796095A (en) * | 2018-07-03 | 2018-11-13 | 中国水产科学研究院黑龙江水产研究所 | A kind of selection improving carp feed efficiency |
| CN108866204A (en) * | 2018-07-03 | 2018-11-23 | 中国水产科学研究院黑龙江水产研究所 | A kind of selection of elongated mirror carp fast-growth strain |
| US11896188B2 (en) | 2018-04-30 | 2024-02-13 | Lg Electronics Inc. | Nozzle for cleaner |
-
2007
- 2007-09-26 CN CNA2007101443666A patent/CN101120667A/en active Pending
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102100201A (en) * | 2010-12-27 | 2011-06-22 | 上海海洋大学 | Method for breeding ornamental type Cyprinus carpio var. color |
| CN102100201B (en) * | 2010-12-27 | 2012-12-12 | 上海海洋大学 | Method for breeding ornamental type Cyprinus carpio var. color |
| CN103276089A (en) * | 2013-05-31 | 2013-09-04 | 中国水产科学研究院长江水产研究所 | Paternity test method and kit of common suckers |
| CN105284685A (en) * | 2015-11-04 | 2016-02-03 | 台江县国营水产养殖场 | Crossbreeding method for Qingshui river carps and Furui carps |
| CN105284685B (en) * | 2015-11-04 | 2018-02-16 | 台江县国营水产养殖场 | A kind of Qingshuijiang carp and the auspicious carp cross breeding method of good fortune |
| CN107018935A (en) * | 2017-05-23 | 2017-08-08 | 中国水产科学研究院黑龙江水产研究所 | A kind of wild makeup of chum salmon seedling is put |
| CN107018935B (en) * | 2017-05-23 | 2023-07-21 | 中国水产科学研究院黑龙江水产研究所 | Wild device of marijuana fry |
| US11896188B2 (en) | 2018-04-30 | 2024-02-13 | Lg Electronics Inc. | Nozzle for cleaner |
| CN108796095A (en) * | 2018-07-03 | 2018-11-13 | 中国水产科学研究院黑龙江水产研究所 | A kind of selection improving carp feed efficiency |
| CN108866204A (en) * | 2018-07-03 | 2018-11-23 | 中国水产科学研究院黑龙江水产研究所 | A kind of selection of elongated mirror carp fast-growth strain |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101120666A (en) | Method for selectively cultivating new variety of carp | |
| Zhou et al. | Karyotypic diversity in polyploid gibel carp, Carassius auratus gibelio Bloch | |
| CN101120667A (en) | Method for optimizing variety of carp | |
| CN109852710B (en) | SNP marker related to ammonia tolerance of grouper and application thereof | |
| CN111394445B (en) | Indel marker for sex identification of channa maculata and application thereof | |
| CN106868112B (en) | molecular identification method for culter alburnus, triangular bream and filial generation thereof | |
| CN113930520A (en) | SNP molecular marker related to grass carp traits and application thereof | |
| Ma et al. | Parentage assignment of the mud crab (Scylla paramamosain) based on microsatellite markers | |
| CN111304337A (en) | SRAP molecular marker, kit and method for identifying first filial generation of pelteobagrus fulvidraco, pelteobagrus vachelli and hybride and application | |
| CN108611405B (en) | Microsatellite fluorescent multiplex PCR (polymerase chain reaction) method for parent-child identification of culter alburnus | |
| CN103484459B (en) | Primer group, marking method and application of EST-SSR (Expressed Sequence Tag-Simple Sequence Repeats) molecular marker of macrobrachium nipponense | |
| CN111057771B (en) | SNP molecular marker for distinguishing 'Zhongyang No. 1' from common fugu obscurus and application thereof | |
| CN111057772B (en) | SNP (Single nucleotide polymorphism) marker related to growth traits of grass carps and application thereof | |
| Kocher et al. | Genome mapping and genomics in fishes and aquatic animals | |
| Tseng et al. | Polymorphisms of GA/GT microsatellite loci from Anguilla japonica | |
| Kang et al. | Microsatellite analysis as a tool for discriminating an interfamily hybrid between olive flounder and starry flounder | |
| CN114395635B (en) | SNP molecular marker related to growth traits of macrobrachium rosenbergii and application of SNP molecular marker | |
| CN108410963B (en) | Rhinogobio ventralis paternity test method based on microsatellite fluorescent multiplex PCR | |
| CN113604587B (en) | Molecular marker T5198 for rapidly identifying low-temperature tolerant variety of penaeus japonicus and application thereof | |
| CN105603097B (en) | Microsatellite marker primer for identifying pinctada fucata microsatellite families as well as identification method and application | |
| CN114990233A (en) | SNPs (single nucleotide polymorphisms) marker related to genetic sex of Chinese softshell turtles as well as primer and application thereof | |
| CN108841930B (en) | Paramisgurnus dabryanus microsatellite family identification method and application thereof | |
| CN107287323B (en) | Molecular breeding method of new species cynoglossus semilaevis | |
| CN114480601A (en) | Molecular marker, primer, method and application for identifying genetic sex of hippocampus kelloggi | |
| Awodiran et al. | Microsatellite variability of two populations of Clarias gariepinus (siluriformes, Clariidae) in Nigeria |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20080213 |